The fluoroscein-labelled -lactamase mutant T216Cf has shown its prospects as a sensitive and selective biosensor in -lactamase inhibitor screening. The T216C mutant (with a second C285S mutation) was successfully produced and purified. High sensitivity and applicability of fluorescein-5-maleimide (F5M) was regarded as the most suitable label of the four fluorophores tested. The comparison between T216Cf and T216Ciaf suggested that the linker was equally crucial as the fluorophore to the fluorescence signal. The fluorescence and kinetic studies showed T216Cf remained active against penicillins and common inhibitors, but it was unable to hydrolyse cephalothin, potentially because BlaC can no longer bind with cephalosporins after the mutations. Similar to the apo protein, the
active site could be recovered after hydrolysis. Juxtaposing the formation of enzyme-inhibitor complex and the change in fluorescence intensity confirmed the relationship between inhibitor binding and fluorescence signal.
Fluorescence spectra recorded with microplate reader exhibited the ability of T216Cf to be used in large-scale automated drug screening. Yet, the fluorescence intensity change for T216Cf has not exceeded 35%. To enhance the sensitivity of this biosensor, a second mutation near the active site was introduced to further improve its performance.
4 Advancement of the BlaC-based Biosensor
4.1 Introduction
Reducing the background fluorescence intensity was hypothesised as a mean to increase the sensitivity of T216Cf (Wong, 2010; Chung, 2008).
Fluorescein fluorescence is e↵ectively quenched by tryptophan located in close proximity to the probe (Togashi et al., 2009). A model was built based on the BlaC crystal structure to locate the neighbouring residues of the flurophore which were then mutated to tryptophan.
A well-defined crystallographic structure obtained from the Protein Data Bank (Berman et al., 2000) (PDB ID: 3CG5 (resolution 1.7 ˚A) (Tremblay et al., 2008)) was manipulated by mutating Thr-216 to Cys and Cys-285 to Ser using a molecular visualisation programme Coot (Crystallographic Object-Oriented Toolkit) (Emsley et al., 2010). The three-dimensional structure of fluorescein-5-malemide covalently bonded to cysteine was built and optimised geometrically using JLigand (Lebedev et al., 2012). R and S enantiomers arise from nucleophilic addition of the malemide bonds and the Cys-216 thiol side chain (Figure 26). Together with the three torsion angle of the side chain of Cys-216, there are theoretically six conformers, while three in Figure 27 are spatially allowed. After searching for the residues in vicinity of the fluorescein, possible mutation to tryptophan were modelled.
For e↵ective quenching, the tryptophan should be near the fluorescein and parallel to each other (Vaiana et al., 2003). For model CRF-t, mutating
Thr-237 to tryptophan allows the side chain of Trp-237 and fluorescein to be parallel to each other; for model CSF-m, a mutated Trp-105 side chain is parallel to the fluorescein. The two potential mutations at Ile-105 and Thr-237 (Figure 28) were then realised by site-directed mutagenesis and named as T216Cf/I105W and T216Cf/T237W respectively. Study of the T216Cf/I105W and T216Cf/T237W mutants by fluorescence spectrometry revealed the functionality as a bioseneor.
(a) R (b) S
Figure 26: R and S enantiomers of F5M-cysteine compound.
(a) CRF-t. (b) CRF-m. (c) CSF-m.
Figure 27: Molecular model of T216Cf (grey cartoon). The side chain of the residues close to the fluorophore (orange) are shown.
(a) I105W (b) T237W
Figure 28: Molecular model of T216Cf (grey cartoon). The fluorophore (orange) and the side chain of the mutated residues (blue) (a) I105W parallel to the fluorescein at CSF-m position and (b) T237W parallel to the fluorescein at CRF-t are shown.
4.2 Methods
4.2.1 Site-Diected Mutagenesis
Site-directed mutagenesis by PCR was performed with plasmid pRSET-K bla1 prepared using QIAprep Spin Miniprep Kit (Hilden, Germany) as template in the same method as described in 2.2.1. The primers used for T216C/I105W and T216C/T237W mutations are listed in Table 8. 0.5µl pRSET-K bla1 plasmid, 0.5µl pair of synthetic oligonucleotide primers (5'→3'forward primer and 3'→5'reverse primer), 5 µl Taq DNA Polymerase PCR Bu↵er, 0.5µl dNTPs, and 18 µl Milli-Q water was mixed and digestion protein was added to the mixture. The mixture was transferred to Applied Biosystems Veriti Thermal Cycler for PCR overnight. The details of the PCR procedures are stated in Table 9. The plasmids were stored at 20 C freezer.
Table 8. Primers for site-directed mutagenesis of T216Cf.
Mutant Primer Sequence Tm ( C)
I105W BlaC-I105W-F TGACGACATTCGGTCGTGGTCCCCGGTGGCCCAAC 79 BlaC-I105W-R GTTGGGCCACCGGGGACCACGACCGAATGTCGTCA 79
T237W BlaC-T237W-F CTCGTCCGTAGTCACCCCACCCGGTCTTGTCGATC 75 BlaC-T237W-R GATCGACAAGACCGGGTGGGGTGACTACGGACGAG 75
4.3 Preparation and Transformation
T216C/I105W and T216C/T237W were first transformed into E. coli TOP10 competent cell following the method mentioned in 2.3.2. 2µl of the
Table 9. PCR method and conditions for site-directed mutagenesis of T216Cf.
Stage Cycles Temperature ( C) Duration (s)
1 1 95 60
plasmid cloned with mutant genes was mixed with 100µl E. coli TOP10 competent cell and iced for 30 min. The mixtures were heat shocked at 42 C for precisely 2 min and cooled on ice for another 2 min, then incubated at 37 C for 90 min with shaking at 300 rpm in 200µl LB medium. The competent cells were streaked on a nutrient agar plate with 50µg/ml kanamycin, and was incubated at 37 C overnight for single colonies to grow, which were picked for overnight incubation in 5 ml LB medium with 50µg/ml kanamycin. 1 ml of each culture was then sent to BGI Genomics for DNA sequencing. The plasmids cloned with target gene were extracted and transformed into E. coli BL21 competent cell for expression.
4.3.1 Expression and Purification
The production of T216C/I105W and T216C/T237W was highly similar to the preparation of T216C recorded in 2.4. Single colonies of E. coli BL21 (DE3) on a nutrient agar plate incubated at 37 C overnight were inoculated into 5 ml LB medium with 50µg/ml kanamycin. The cultures were incubated at 37 C with shaking at 250 rpm for 16 h and transferred to 100⇥ 2 ⇥ TY medium with 50µg/ml kanamycin. 0.2 mM IPTG was added to the cultures
to induce the mutant expression when OD600 reached 0.6. The culture was harvested after 4 h by centrifugation. The intracellular T216C/I105W and T216C/T237W proteins were extracted by homogenisation and purified by nickel affinity chromatography.
4.3.2 Labelling of T216C/I105W and T216C/T237W with F5M
10-fold molar excess 0.2 M F5M in DMF was added to the purified protein and allowed to react in the dark with shaking at 800 rpm at room temperature for 2 h. Excess F5M was removed using centrifugal filter device and gel filtration as narrated in 2.7 and 2.4.3. The labelled mutants were named T216Cf/I105W and T216Cf/T237W, respectively.