Chapter 2 Materials and Methods
2.5 Materials and methods for human carriage study
For this part of study, ethical approval was obtained from the Massey University Human Ethics Committee (Southern A, Application 15/34). 44 participants were recruited for faecal sample donation and dietary intake assessment by Genelle Healey (Institute of Food Science and Technology, School of Food and Nutrition, Massey University) as a part of her PhD project “The influence of habitual dietary fibre intake on the responsiveness of the gut microbiota to a prebiotic”. 19 - 65 years old male/female participants were selected based on the following criteria: 1) has not taken antibiotics within the last 6 months of study; 2) has not taken laxatives and prebiotic/probiotic supplements within the last month; 3) no past history of food intolerance or clinically significant diseases including cancer, gastrointestinal disorders, autoimmune disorders, diabetes, heart disease, or renal failure; 4) body mass index (BMI) within the range of 18.5 – 30 kg/m2; 5) no significant changes in weight or dietary habits within past year; 6) not pregnant or breastfeeding; and 7) non-smokers and standard alcohol consumers (< 15 drinks per week for males and < 10 drinks per week for females; more than two alcohol-free days per week). Each participant completed 4 sets of 3-day diet records over a period of 10 weeks. Dietary fibre and food composition analysis was conducted using Foodworks version 8 software (Xyris Software Pty Ltd). Participants were divided into high, moderate, and low dietary fibre intake groups. The high dietary fibre intake cut-offs were chosen to reflect the New Zealand recommended dietary fibre intake which is > 25 g/day for females and > 30 g/day for males. The average dietary fibre intake in New Zealand (17.5 g/day for females and 22.1 g/day for males) was chosen as the low dietary fibre intake cut-offs, which is below recommended amounts. The amount of pectin consumed per day by each participant was calculated by using an established food composition database (Marlett and Cheung, 1997).
2.5.2 DNA extraction from faecal samples
Bacterial DNA was extracted from 0.25g of faecal samples using MoBio PowerLyzer® Powersoil DNA® isolation kit as per the manufacturer’s instructions. A FastPrep-24™ 5G (MP Biomedicals) was
used to homogenise the samples. The DNA was eluted in EB buffer. NanoDrop®-1000 spectrophotometry was used to quantify the DNA concentration.
2.5.3 Primer design and specificity testing
The primer sets used in this study are listed in Table 2.4. The M. pectinilyticus-specific primers sets were designed by using NCBI Primer Blast (Ye et al., 2012). Using Primer Blast, the primer specificity was virtually tested against 16S rRNA gene sequences from cultured and uncultured bacterial species available in the NCBI database. Parameters were set to meet the primer requirements recommended by Lightcycler® which suggested the use annealing temperatures around 60℃, and an optimal amplicon size of ~500 bp. The optimum annealing temperatures were calculated using OligoCalc, an online-based calculator for oligonucleotide properties (Kibbe, 2007). The specificity of M. pectinilyticus-specific primers was further tested by performing colony PCR using frozen stock cultures of the following strains; Eubacterium rectale ATCC 35183, Faecalibacterium prausnitzii DSM 17677, Roseburia intestinalis DSM 14610, Lactobacillus plantarum ATCC 14917,
Lactobacillus acidophilus ATCC 11975, Staphylococcus aureus ATCC 25923, Ruminococcus gnavus ATCC 29149, Lachnospira multipara ATCC 19207, and M. pectinilyticus. With the exception of L. multipara which was isolated from the animal rumen, all strains were human enteric bacterial species of the phylum Firmicutes, available from the in-house bacterial culture collection. PCR-grade water was used as a negative control. Each 20 µl of PCR reaction contained 4.7 µl of PCR-grade water; 4 µl of 5× Phusion Green HF Buffer (Thermo® Scientific); 0.4 µl of 10 mM dNTPs; 5 µl of 5 µM
forward primer; 5 µl of 5 µM reverse primer; 0.2 µl of Phusion DNA Polymerase (Thermo® Scientific); and 1 µl of frozen stock cultures or negative control. Optimized PCR cycling conditions
Table 2.4 Sequences of universal and M. pectinilyticus-specific PCR primers used in this study.
Primer set Target Sequence (5’→3’) Annealing
Tm (℃) Product size (bp) Uni331F Bacteria TCCTACGGGAGGCAGCAGT 58 466 Uni797R GGACTACCAGGGTATCTAATCCTGTT 55 MP1087F M. pectinilyticus GAGCGCAACCCTTACTGTCA 54 495 MP1581R CTCTTACTTCCGCTCTCCGC 56
recommended by the manufacturer was used: initial denaturation step of 98 ℃ for 30 sec; 30 cycles of 98 ℃ for 10 sec (denaturation), 65 ℃ for 20 sec (annealing), and 72 ℃ for 15 sec (extension); and a final elongation step at 72 ℃ for 5 min. Purified PCR products were analysed on 1 % (w/v) agarose gel, and the bands were visualized by E-Gel® Safe Imager™ (Invitrogen™).
2.5.4 Preparation of qPCR standard
M. pectinilyticus was grown in RC medium containing 0.5 % (w/v) D-fructose. E.coli strain Nissle was grown on standard LB broth medium. Cell densities were determined by manual cell counting using a Neubauer haemocytometer. Cultures were diluted using a sterile medium to achieve 1.0 x 109cells/ml. Diluted cultures were centrifuged at 12,000 g for 10 min at room temperature. Cell pellets were homogenized using FastPrep-24™ 5G (MP Biomedicals). Genomic DNA was extracted using MoBio PowerLyzer® Powersoil DNA® isolation kit as per the manufacturer’s instructions. Extracted DNA was eluted in EB buffer and quantified using Qubit™ dsDNA BS assay. Genomic DNA samples were serially diluted (10-fold) to construct standard curves ranging between 1.0 × 103 cells/ml and 1.0 × 109 cells/ml.
2.5.5 Quantitative PCR
Samples and standards were run in triplicate by absolute quantification on Roche Lightcycler® 480 real-time PCR instrument. Lightcycler® 480 SYBR Green I Master Mix was used for specific
detection of double-stranded PCR-amplified products. A 20 µl reaction contained 10 µl SYBR® Green I Master Mix; 4 µl of 2.5 µM forward primer; 4 µl of 2.5 µM reverse primer; and 2 µl of template DNA from samples and standards. Negative controls were prepared with PCR-grade sterile water in place of DNA samples. Quantitative PCR was performed using the following conditions: one activation cycle at 95℃ for 10 min; 45 run cycles of denaturation (95℃ for 10 sec), annealing (60℃ for 20 sec), and extension (72℃ for 20 sec); one cycle of melting (95℃ for 30 sec, 65 ℃ for 1 min, followed by 65℃ to 95℃ at 0.1℃ increment per second with continuous fluorescence acquisition); and a cooling cycle at 40℃. Results were analysed and visualized using Lightcycler® 480 software package (version 1.5).
2.5.6 Statistics and calculations
Log10 concentration of M. pectinilyticus and the % abundance of M. pectinilyticus relative to the total bacterial concentration were plotted to determine the split point at which the participants were separated into M. pectinilyticus-positive and M. pectinilyticus-negative groups. A chi-square test was performed to calculate p-values to assess the distribution relationships between high fibre
consumption and the number of participants showing a positive presence of M. pectinilyticus. The median amounts (g) or servings of fibre, pectin, vegetable, fruit, grain, and protein intake per day were calculated for M. pectinilyticus-positive and –negative groups, and the statistical significance of the data was assessed based on p-values obtained through performing a non-parametric Mann- Whitney-U test. The p-value < 0.05 was considered statistically significant.
2.5.7 Metagenomic analysis
Full-length protein sequences of 23 S-layer homology (SLH) domain-containing proteins from the M. pectinilyticus were manually extracted from the genome database. As the SLH proteins of M.
pectinilyticus did not find sequence matches with a significant homology in the currently available protein databases (Chapter 4), this suggested that the possession of these proteins may be a unique characteristic of M. pectinilyticus and possibly its closely related uncultured bacterial species. Therefore, these SLH protein sequences were used as query sequences to search for the presence of M. pectinilyticus in the metagenome databases constructed from the stool samples of 85 donors living in the US, as part of the Human Microbiome Project (HMP) initiated by National Institutes of Health (NIH). Although the faecal samples were collected from each donor over two separate visits, only the data from the first visit was used in this study. The metagenome databases were accessed through the Integrated Microbial Genomes with Microbiome Samples (IMG/M) system of Joint Genome Institute (JGI) funded by the United States Department of Energy (Chen et al., 2017). A built-in Blast Genome function of IMG/M system was used to carry out metagenome mining in which the FASTA sequences of 23 SLH proteins were simultaneously searched against the selected databases using BlastP with an e-value threshold of 1e-5. A stringent cut-off was used to identify true positives which showed 80 –
100 % identical amino acid residue matches along the same positions over a relatively long (> 100 amino acids) length of aligned protein sequences (Nelson et al., 2010).