Materials and methods 7

The mAb against Grb2 was purchased from Affiniti. The CD3 mAb OKT3 was purchased from Ortho Pharmaceuticals. The F(ab' ) 2 fragment of OKT3 was a gift from

Narin Osman. The RNGS antiserum reactive with Lck was a gift from Mark Marsh, UGL, London, and the CST-1 antiserum reactive with Fyn and Yes was kindly provided by Sara Courtneidge, Sugen, Redwood City, CA. Anti-human S6 kinase antibody (Ab) was from Santa Cruz (referred to as M5, (Lane et al., 1993)). The M l antiserum reactive with p70S6k (Lane et al., 1993) was a gift from George Thomas, FMI, Basel. The polyclonal mSosI Ab (S osi) and the Rac-PK-CT Ab reactive with PKB were from Upstate Biotechnology Incorporated. The Sos3 Ab was raised against a peptide from mSosI (aa 100-120) (Buday et al., 1994). The p llO Ab (PW38) was raised against a peptide from bovine p i 10a of PI 3-kinase (Miles et al., 1992).(KRPLWLNWENPDIMSE, aa776-791). The Sos3 and p i 10 Abs were kindly provided by Julian Downward, ICRF, London. The JNK2 (FL) Ab reactive with p54a Sapk and p54p Sapk was from Santa Cruz. The pan-ras (0P41) mAb was from Oncogene Science.

Mouse immunoglobulins G (mIgG) purified from serum was purchased from Sigma and rabbit anti-mouse immunoglobulins (Igs) from DAKO. Goat anti-mouse IgG (y chain specific) conjugated to fluorescein isothiocyanate (FITC) (Sigma) and FITC- conjugated rabbit anti-mouse Igs (DAKO) were used for cell staining procedures.

Peptides

The PDGFR-Y(751)-P phosphotyrosine peptide had the sequence DYVPML(G), the EGFR-Y(1068)-P phosphotyrosine peptide had the sequence PVPEYINQS and the HaMT-Y(324)-P phosphotyrosine peptide had the sequence EEEPQYEEIPI. The CD28-Y(173)-P phosphotyrosine peptide corresponds to amino acid residues 166 to 200 of human CD28 (Aruffo and Seed, 1987) and had the sequence SRLLHSDYMNMTPRR (Pages et al., 1996). (Residues which are phosphorylated are in b o ld fa c e .) The Sos-PRO peptide had the sequence SKGTDEVPVPPPVPPRR which corresponds to the amino acid residues 1144 to 1159 in

C hapter 2 Materials and methods 7 7

the C-terminus of mSos1 (Bowtell et a!., 1992). The p85-PRO peptide had the sequence QPAPALPPKPPKPTTV which corresponds to amino acid residues 302-317 of bovine p85a (Otsu et al., 1991).

Fusion proteins

Fusion proteins encoding GST alone (GST), full length GST-Grb2 (Grb2), full length myc tagged GST-Grb2 (Grb2myc), myc tagged double SH3 mutant GST-Grb2 49L/203R (named Grb2mycpSH3 or Grb2pSH3), as well as C-terminal GST-mSosI (aa 1135-1336) (GST-C-Sos) have been described (Egan et al., 1993). The isolated N-terminal GST-huGrb2 SH3 domain (aa 1-58) (N-SH3) and the C-terminal GST- huGrb2 SH3 domain (aa 159-217) (C-SH3) have been described (Gout et al., 1993).

Piasmids and reporter constructs

HA-p70S6k (pBJ5) (Brown et al., 1995); HA-PKB (pSG5) and gagPKB (pSG5) (Burgering and Coffer, 1995); HA-Erki (pcDNAneo) (Ming et al., 1994); HA- Erk2 (pCEP4) (Frost et al., 1996); HA-p54p Sapk (pMT2) (here termed Jnk) (Yan et al., 1994) (a gift from J. R. Woodgett, OCI, Toronto); p85 (pcD-SRa) and p85A (pcD- S R a) (Dhand et al., 1994); Ha-v-ras (S12V, A59T) (Izquierdo et al., 1993); Myc- V14Rho (pEF), Myc-V12Rac (pEF), Myc-V12Cdc42 (pEF) and C3 transferase (pEF) (Hill et al., 1995) vector constructs have been described. For the microinjection experiments V12Rac was expressed as myc-tagged derivative in the pRK5 vector (Ferrari et al., 1993). Human Dbl (aa 495-826; EMBL accession number X I 2556) (pRK5) was kindly provided by M. F. Olson, Chester Beatty Laboratories, London. The reporter plasmids have been described: NIex.elk-1 (pMLV or pEF) and 2lexoptk.CAT (Marais et al., 1993); NIex.jun (aa 1-193) (pMLV) was a gift from R. Treisman, ICRF, London; lacZ encoding (3-galactosidase (pMLV or pEF) (Price et al., 1995); A P I.C A T was used to assess API activity in adherent cells consisted of one copy of the API binding site from the collagenase promotor/enhancer linked to the CAT

Chapter 2 Materials and methods 7 8

gene (Angel et al., 1987); API .CAT used for expression in T cells consisted of three copies of the API binding site from the IL-2 promotor/enhancer linked to the CAT gene (Williams et al., 1992); wild type SRE.CAT (Hill et al., 1993); c-fos.CAT (Treisman, 1985) and NF-AT.CAT (three copies of the IL-2.N F-A T binding site: TAAGGAGGAAAAACTGTTTCATACAGAAGGCG) (Woodrow et al., 1993).

Cells and cell culture

Human blood was obtained from the blood transfusion service, and peripheral blood mononuclear cells (PBMC) were isolated by Ficoll-Hypaque discontinuous gradient centrifugation. T lymphoblasts were prepared as described (Cantrell and Smith, 1984). Briefly, PBMC (10®/ml) were resuspended in complete media consisting of RPMI 1640 medium supplemented with 10% (v/v) heat-inactivated (56 °C for 30min) PCS, 2 mM L-glutamine, 100 pg/ml streptomycin, and 100 units/ml penicillin and stimulated with 2 |xg of phytohemagglutinin per ml for 72 h at 37 °C. After being washed, cells were maintained in exponential growth phase in RPMI/10% FCS supplemented with 20 ng of rlL-2 per ml. After 10 to 15 days, the T lymphoblasts (>99% T cells, represented by CD4+^e and CD8+ve subpopulations) were cultured

without rlL-2 for 16 to 48 hours to ensure their reaccumulation in the early G1 phase of the cell cycle (Cantrell and Smith, 1983).

The Kit225 T leukaemic cell line (Hori et al., 1987), the JHTAg subclone (Clipstone and Crabtree, 1992) or the JKHM1 2.2 subclone (Goldsmith et al., 1989) of the Jurkat T leukaemic cell line were maintained in RPM11640 medium containing 10% heat-inactivated FCS, 2 mM L-glutamine, 100 pg/ml streptomycin, and 100 units/ml penicillin at 37 °C. Kit225 cells were supplemented with 20 ng/ml (1 nM) of rlL-2 during normal growth conditions. For IL-2 activation assays of endogenous proteins, Kit225 cells were washed three times with PBSA to remove the IL-2 and cultured further in RPMI supplemented with 5% FCS in the absence of rlL-2 for 48h to 72h prior to IL-2

Chapter 2 Materials and methods 7 9

activation assays. When Kit225 cells were transfected, cells were treated as above but only deprived of rlL-2 for 24h prior to transfection.

Rat-1 fibroblasts, simian Cos7 kidney cells (Gluzman, 1981), human embryonic kidney 293 cells (epithelial) (Graham et al., 1977), Swiss 3T3 cells and NIH 3T3 cells (referred to as adherent cells) were maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% FCS, 2 mM L-glutamine, 100 pg/ml streptomycin, and 100 units/ml penicillin at 37 °C. For microinjection experiments (into sub-confluent cells), Swiss 3T3 cells were plated at a density of 1 xIO^ onto 6 cm dishes or 3 x 10^ onto 80 cm2 flasks and grown to confluence. The cells were left without medium change to become quiescent (usually 7-10 days after seeding) and then serum-starved overnight in DMEM containing 2 g/l NaHCOg. After washing with PBSA cells were trypsinised briefly, resuspended in serum-free medium containing 0.5 mg/ml soy bean trypsin inhibitor (Sigma), pelleted and resuspended in serum-free medium and allowed to attach for 30 min before injection.

Metabolic labelling

T cells: The labelling of cells with pssjmethionine was in methionine free RPMI medium and for the p2p]orthophosphate labelling in Pj free DMEM. For both labelling procedures the T cells were washed three times in labelling media including 10 min incubation in these media at 37 °C between each wash and finally resuspended in media supplemented with 4% dialysed FCS and 10 mM Hepes, pH7.4. The 25$. labelling was performed for 6 h at 37 °C with Im Ci pssjmethionine ( 1 4 x 1 0 ^ cells/14 ml) and the 22p_|abelling was carried out for 5 h at 37 °C with 2.5 mOi [22p]orthophosphate (1.7 x 10® cells/18 ml). The cells were washed twice in labelling media, and incubated for 10 min at 37 °C prior to stimulation with UCHT-1 (10 pg/ml) prior to cell lysis and purification procedures as described above. The 25$. metabolically labelled proteins or the 22p.phosphoproteins were separated by SDS-