Oscheius sp TEL-2014 (Nematoda: Rhabditidae), a potential entomopathogenic nematode isolated from a grassland in South Africa

2. Materials and methods

2.1 Isolation of the nematodes

Soil samples were collected from Suikerbosrand Nature Reserve near Johannesburg in South Africa. They were collected to a depth of 15 cm and were placed into 1 L rectangular plastic

larvae per tub (Bedding and Akhurst 1975). Infective juveniles that emerged from dead insect larvae were collected by using a modified White trap method (Kaya and Stock 1997).

2.2 Morphological analysis by Olympus light microscope

The Olympus light microscope was used to photograph the internal structures of adult males, adult females and IJs. Nematodes taken from White traps and lipid agar plates were killed in 60 °C hot water. Nematodes were placed in a Petri dish in 1ml distilled water and 3-4ml of triethnolamine formaldehyde (TAF) was added and left at room temperature for 24 hours, (recipes for the solutions used are in Appendix 1). TAF was replaced with TAF with double- strength TAF and store at 4°C to relax nematodes for one hour. TAF was added again to allow fixative to infiltrate for at least 24 hours and then most of the fixative was removed. This was then followed by processing nematodes with pure glycerine where fixed nematodes were transferred to a clean Petri dish containing 0.5ml of solution I which was allowed to slowly evaporate and stored at room temperature for 12 hours in an uncovered Petri dish. Solution II was added to the Petri dish with nematodes and left partially opened to allow for slow ethanol evaporation and thereafter it was placed in an oven preheated to 40°C for 3 hours making sure that nematodes do not dry out. Nematodes were then mounted on glass slides carefully to avoid crushing them before analysis under the microscope.

2.3 Morphological analysis by scanning electron microscopy

Lipid agar plates

Lipid agar plates contain tributyrin which is a substrate. If bacteria cultured on these plates are

able produce the exoenzyme lipase it will have the potential to digest or hydrolyze the triglycerides/lipids in the tributyrin. This process results in development of clear zones around the growing colonies on the media. Lipid agar plates where used because they were ideal for growing lawns of symbiotic bacteria which were used to support growth of the nematodes. This method was also used to confirm that the isolated bacteria are a symbiont of the

Oscheius nematodes by stimulating nematodes growth and reproduction. The objective of

using this medium was also to allow IJs to grow into adults nematodes under suitable conditions. Lipids and glucose are some of the most imperative nutrients necessary for nematode growth, reproduction and bacterial proliferation (Gil et al., 2002). This is why the lipid agar media used was composed of honey (glucose), yeast extract, nutrient agar, cod liver

oil (lipids), and MgCl2.6H2O as seen Appendix 1. Some of these ingredients were also used

in lipid media in studies conducted by (Shapiro-Ilan et al, 2002).

EPNs were suspended with sterile distilled water and 1ml of EPNs was collected directly from lipid agar plates and transferred into 1.5ml Eppendorf tubes and heat-killed at 80°C for 5 minutes. EPNs were rinsed with Ringer solution three times with 5 minutes between each rinse. EPNs were then fixed in 8% glutaraldehyde overnight (glutaraldehyde 25% EM grade, diluted in Ringers solution). EPNs were further rinsed with distilled water three times and dehydrated with 30, 50, 70, 90, 95, and 100% ethanol at 10 minutes interval sequentially. Each sample was allowed to air dry overnight and mounted on SEM stubs, coated with carbon and palladium, then scanned using FEI QUANTA 200 scanning electron microscope fitted with a digital camera.

2.4 Measurements

Fresh IJs and adult nematodes prepared using the method in 2.3 were placed on clean slides then covered gently with cover slips. The IJs were then viewed under an Olympus light microscope connected to a digital camera and images were captured. 10 males, 10 Females and 10 IJs were measured. Morphometric table was generated based on the mean and standard deviation statistical calculations.

The following abbreviations were used: BL Body length

GD Greatest diameter

AEP Distance from anterior end to excretory pore PL Pharynx length

CL Corpus length IL Isthmus length

PVD Pharyngeal-intestinal valve diameter TBD Terminal bulb diameter

AGL Length of anterior gonad PGL Length of posterior gonad RAL Rectal length

SL Spicule Length CT Cuticle thickness

2.5 Molecular identification of EPNs by 18S rDNA Sanger sequencing

Genomic DNA was extracted from nematodes using the protocol from the Puregene® DNA Purification Kit, Gentra systems 2003. PCR amplification of 18S rDNA ITS region was performed. The following universal primers were used: forward primer; TW81 (5’- GCGGATCCGTTTCCGTAGGTGAACCTGC -3’, Tm: 71.94 ºC), and reverse primer; AB28 (5’- GCGGATCCATATGCTTAAGTTCAGCGGGT-3’, Tm: 68.87 ºC). Initial denaturation before cycling: 94°C for 5 minutes followed 25 cycle amplification series: denaturation at 95°C for 60 seconds, annealing at 64°C for 60 seconds, extension at 72°C for 120 seconds and final extension after cycling: 72°C for 10 minutes. PCR products were sequenced using Sanger sequencing method at Inqaba Biotechnical Industries (Pty) Ltd; South Africa using the above PCR primers. NCBI nucleotide database BLASTn tool was used identify the unknown sequences of EPNs. The 18S rDNA sequence for Oscheius sp. TEL-2014 (KM492926) was edited to derive the consensus using Bioedit sequence alignment editor. Phylogenetic analyses was done using the following: Oscheius carolinensis (FJ547241),

Oscheius sp. MCB (KF684370), Heterorhabditidoides chongmingensis (KF500235), Oscheius myriophilus strain JU1386 (KP792651), Oscheius sp. KAT-2015 (KR119081), Rhabditis sp. Tumian-2007 (EU273598), Oscheius sp. BW282 (AF082994), Oscheius insectivore (AF083019), Oscheius sp. Pak.S.N.10 (KT878513), Oscheius tipulae CEW1

(KP792649), Oscheius chongmingensis Tumian (EU273598), Oscheius dolichura LDY30 (M355811), Oscheius guentheri SB133 (EU195996), Oscheius dolichuroides DF5018 (AF082998), Oscheius sp.DF5000 (AF082995) were obtained from NCBI GenBank database and Caenorhabditis elegans (Z92784) sequence was used to root the tree. Sequences were aligned first using MUSCLE on MEGA 6 software. The evolutionary history of the aligned sequences was centred on the analysis of 18S rDNA ITS region inferred by using the Maximum Likelihood method based on the Tamura-Nei model in MEGA6. The bootstrap consensus tree inferred from 1000 replications and the tree is drawn to scale, with branch lengths measured in the number of substitutions per site (next to the branches).

2.6 Entomopathogenecity of Oscheius sp. TEL-2014

Nematode entomopathogenicity was evaluated using sixth instar stage of G. mellonella and T.

molitor, respectively. For evaluated nematode infectivity G. mellonella and T. molitor larvae

were each placed in 90 mm plastic Petri dishes containing sterile 40g of sandy loam soil, replicated four times for each larval species with each plate containing five larvae. The soil had an initial moisture content of 8% (w/w) and each plate was inoculated with 100 IJs suspended in 1 ml of sterile distilled water. The time interval for the onset of larval mortality after inoculation with IJs was monitored and recorded. Insect cadavers were placed on White-traps to monitor and recover the emerging IJs.

3. Results and discussion

In document Genome analysis of an entomopathogenic nematode belonging to the genus Oscheius and its insect pathogenic bacterial endosymbiont (Page 32-36)