• No results found

Chapter 3 Cloning, expression and processing of recombinant ECE1 protein

3.2.2 Molecular techniques

3.2.2.1 RNA extraction and purification

Total RNA was extracted from a broth culture of C. albicans ATCC 14053 using the RNeasy mini kit (Qiagen, Germany) with a slight modification for yeast. According to the manufacturer’s operating instructions for yeast cells, 2 ml of sorbitol lysis buffer (1 M sorbitol and 0.1 M EDTA pH 7.4) was added to 5-10 ml of ATCC strain 14053 broth culture. Then 50 units of lyticase (ICN Chemicals, USA), and 10 μl of β-

78

Mercaptoethanol (Sigma Aldrich) were added to the mixture to lyse the yeast cell wall and generate spheroplasts. The RNA solution obtained was then purified with Turbo DNA-free kit (Ambion Life Technologies, Carlsbad, CA, USA) to remove residual DNA according to the manufacturer’s instructions. Briefly, 0.1 volumes 10X TURBO DNase Buffer and 1 µl TURBO DNase were added to the RNA solution and gently mixed. The solution was then incubated at 37°C for 25 min to allow degradation of DNA. Following incubation, 0.1 volume of resuspended DNase Inactivation Reagent was added to the mixture and mixed well. This mixture was then incubated for 5 min at room temperature with occasional mixing. After incubation, this mixture was centrifuged at 12,000 x g for 1.5 min. The supernatant containing RNA was then transferred to a new tube.

3.2.2.2 Measurement of RNA concentration and quality by POLARstar Omega

The RNA concentration and quality were measured for purity estimation using a POLARstar Omega (BMG LABTECH Pty. Ltd. VIC. Australia). The absorbance at wavelengths 260 nm (nucleic acid) was compared to wavelengths at 280 nm (protein) and 230 nm (organics) to determine protein or biological contamination. The ratios of readings of A260/A280 and A260/A230 for all samples were above 2.0 in nuclease-free water.

3.2.2.3 Complementary DNA (cDNA) synthesis

Extracted RNA was then converted to cDNA using a QuantiTect Reverse Transcription Kit (QIAGEN, Australia) according to manufacturer’s instructions. Briefly, 2 µl of gDNA Wipeout Buffer 7X was added to 12 µl template RNA (< 1µg/µl) and then incubated for 2 min at 42°C. The RNA was immediately placed on ice, and 6 µl

79

reverse-transcription master mix were added and incubated for 15 min at 42°C. The mixture was then further incubated for 3 min at 93°C to inactivate the reverse transcriptase.

3.2.2.4 Prediction of signal peptides and transmembrane domain for ECE1 protein

It is usual that most secretory proteins are initially synthesised in the cytoplasm as precursors containing 15-30 residues of extra peptide extensions at the beginning of their sequence (N-terminus). These so-called signal peptides play a significant role in the translocation of newly synthesised proteins across the membrane of the endoplasmic reticulum (ER) in eukaryotic cells (Tsuchiya, et al. 2003). To improve the expression level of recombinant protein expressed in E. coli, signal peptides are excluded from designed recombinant genes. Therefore, the ECE1 protein sequence of

C. albicans SC5314 was subjected to SignalP 4.1 Server (predicts the presence and

location of signal peptide cleavage sites in amino acid sequences from different organisms) – CBS (Centre for Biological Sequence analysis) analysis to identify any signal sequences.

3.2.2.5 Design and preparation of the primers

The primers to amplify the complete gene coding for ECE1 protein were designed manually as well as designing the orientation of the genes within pCR 2.1 and pRSET- B vectors by SE Central (Clone Manager) software (Table. 3.3). Specifically, the first 17 bases (after excluding the signal peptide) and the last 21 bases corresponded to the forward and reverse primers were used, respectively. The primers were manufactured by GeneWorks Custom Oligo Service (Thebarton, SA, Australia). The primers were supplied in a dried form, so 100 µmol stock solutions were prepared as shown below:

80

1) For-Fila (forward primer), 58.4 nmol/tube, Concentration= Mass/Volume 𝑉𝑜𝑙𝑢𝑚𝑒 =58.4 𝑋 10100 3 = 584 µl of mQ water was added to reconstitute. 2) Rev-Fila (reverse primer), 52.4 nmol/tube Concentration= Mass/volume

𝑉𝑜𝑙𝑢𝑚𝑒 =52.4 𝑋 10100 3 = 524 µl of mQ water was added to reconstitute.

To prepare 10 µmol working solutions, the stock solutions were diluted 1:10 (50 µl of each vial mixed with 450 µl of mQ water) and were stored at -20°C.

Table 3.3 Primer sequences used to amplify the complete ECE1 coding for ECE1 protein

Primer Full

name Orientation Sequence (5′-3′)

Product

length (bp) Region Reference

ECE1 Forward 5’GCCATCATCCACCATGC3’ 758 55- 812 This study

Reverse 5’TTAAGCTTTTCCGAAATATTCTTC3’ This study

3.2.2.6 Production of PCR Products and gel purification

To produce an adequate and good quality of PCR product for optimal ligation efficiencies with the topo 2.1 vector, a conventional PCR was performed to amplify

ECE1 in a PCR thermal cycler machine (G-Storm, Australia). The total reaction

mixture volume was 50 µl and consisted of 10 µl of 5x MyTaq™ Reaction Buffer (Bioline, Alexandria, Australia), 1 µl (1.0 µM) of each primer and 1.0 µl (100 ng/µl) cDNA and 0.20 µl (2 U) Platinum Taq DNA polymerase (recommended to ensure the presence of 3’ A-overhangs on the PCR product). The PCR parameters were as follows: initial denaturing at 95°C for 2 min to activate the Platinum Taq DNA polymerase followed by 40 cycles of 15 s at 95°C, 30 s at 57°C and 60 s at 72°C and a final extension of 7 min at 72°C.

81

3.2.2.7 Purification of DNA from PCR amplification

To obtain a purified PCR product for optimal ligation process with topo pCR 2.1 vector and to confirm that the right size of ECE1 had been amplified, 50 µl of PCR product was run on 1.5% agarose gel using 1× TAE electrophoresis buffer, at a voltage of 100 V for 60 min. Gels were stained with ethidium bromide (3 µg/ml) before destaining in running tap water. The DNA product was visualised with an UV illuminator and photographed using a Biorad Geldoc imaging system running Quantity One Software. The size of the ECE1 band was compared to the 100 bp DNA ladder (Promega, Alexandria, Australia), of which 20 µl was loaded in the first well, then the ECE1 band was purified using Isolate II PCR and Gel Kit (Bioline) according to manufacturer’s instructions. Briefly, the gel slice was excised using a clean scalpel and dissolved in 200 µl binding buffer and incubated at 50°C for 10 min. The sample was vortexed briefly every 3 min until the gel slice was completely dissolved. To bind DNA, the dissolved mixture was loaded to a column provided in the kit and centrifuged for the 30 s at 11,000 x g and the flow-through discarded. The silica layer was washed with 700 µl CW buffer provided by the kit and centrifuged for the 30s at 11,000 x g. The centrifugation was repeated to dry the silica membrane and to remove residual ethanol and the column was transferred to a new 1.5 Eppendorf tube. The resulting DNA was eluted in 30 µl of elution buffer.