• No results found

3 Methods and materials

3.3 Nucleic acids

3.3.1 Standards

1kb ladder: GeneRuler™ 1kb DNA ladder (Fermentas), with the following 14 discrete fragments: 10000, 8000, 6000, 5000, 4000, 3500, 3000, 2500, 2000, 1500, 1000, 750, 500, 250 base pairs.

100bp ladder: GeneRuler™ 100bp DNA ladder plus (Fermentas). The DNA ladder yields the following 14 discrete fragments: 3000, 2000, 1500, 1200, 1031, 900, 800, 700, 600, 500, 400, 300, 200, 100 base pairs.

3.3.2 Plasmids 3.3.2.1 Cloning Vectors pBS2 (Stratagene) pcS2MT (Rupp et al, 1994) pCS2+MT(Rupp et al, 1994) pCS2+

3.3.2.2 Plasmids and in vitro transcription

The ORF of the Xenopus CHD4 was generated by PCR from an EST (BF047668; RZPD „Deutsches Ressourcenzentrum für Genomforschung GmbH“) and cloned into pCS2+ via BamHI/XhoI sites. In vitro transcription was performed by linearization with NotI and transcribed with Sp6 RNA polymerase.

Detailed information:

dbEST Id: 8588902 Clone information:

EST name: daf67d05.y1 Clone Id: IMAGE:4743585 (5') GenBank Acc: BG814448 Source: IMAGE

GenBank gi: 14185428 DNA type: cDNA

Comments:

cDNA Library Preparation: Life Technologies, Inc.

cDNA Library Arrayed by: The I.M.A.G.E. Consortium (LLNL)

DNA Sequencing by: Washington University Genome Sequencing Center Clone distribution: Xenopus clones from this library are available through the I.M.A.G.E. Consortium/LLNL at: [email protected]

Library:

Lib Name: LIBEST_008911 NICHD_XGC_Eye1 Organism: Xenopus laevis

Organ: eye Develop. stage: adult

Lab host: DH10B (phage-resistant)

Description:

Cloned unidirectionally. Primer: Oligo dT. Average insert size 2.3 kb. Constructed by Life Technologies. Note: This is a Xenopus Gene Collection (XGC) library.

Submitter:

Name: Sandy Clifton, Ph.D.

Laboratory: WashU Xenopus EST project, 1999 Institution: Washington University School of Medicine

Address: 4444 Forest Park Parkway, Box 8501, St. Louis, MO 63108, USA

dnxCHD4 cloned into pCS2+ with via BamHI/XhoI sites,

In vitro transcription was performed by linearization with NotI and transcribed with Sp6 RNA polymerase. The dominant-negative variant of CHD4 was generated by point-mutating the lysine residue at postion 748 to arginin with a site mutagenesis kit (Stratagene) according to the manufacturer’s instructions Analogous mutation in the SNF2 ATPase was shown not to disturb the integrity of the yeast SWI/SNF chromatin remodelling complex, but inhibits its enzymatic ATP-dependent remodelling function (Richmond & Peterson, 1996).

For the production of rat monoclonal antibodies against the c-terminal domain of xCHD4 (amino acid 1513-1891), the corresponding fragment was cloned into the pGEX-4T3 bacterial expression vector (Amersham), expressed in Escherica coli and purified.

xSip1 cloned into pCS2+ (Eisaki et al 2000)

In vitro transcription was performed by linearization with NotI and transcribed with Sp6 RNA polymerase

GFP cloned into pCS2+ with via BamHI/XhoI sites,

In vitro transcription was performed by linearization with NotI and transcribed with Sp6 RNA polymerase (Steinbach et al, 1997)

3.3.2.3 Plasmids for digoxigenin-labeled RNA in situ hybridization probes

- Plasmid # 315: xNSCL cloned into pBS II. Skt, Plasmid, a kind gift from Dr. Jaqueline E. Lee, Pediatric Oncology, Universty of Colorado, Denver

- anti-sense linearized with Not I,

- transcribed with T7 polymerase in Buffer Orange

Plasmid # 112: xAsh3a cloned into CS2-MT, (Turner & Weintraub, 1994) - anti-sense linearised with HinD3,

- transcribed with T7 polymerase

Plasmid # 111: xAsh3b cloned into CS2-MT, (Turner & Weintraub, 1994) - anti-sense linearised with HinD3,

- transcribed with T7 polymerase

Plasmid # 324: xNeuroD cloned into pCS2+MTx12A, provided by Jacquline E. Lee, Ph.D.

- anti-sense linearised with Xho I, - transcribed with T3 polymerase

- GenBank accession number neuroD U28067

Plasmid # 697: Sox2 cloned into pCS2, a kind gift from Dr. Yoshiki Sasai (Mizuseki et al, 1998)

- anti-sense linearised with HinD3,

- transcribed with T7 polymerase in Buffer Red

Plasmid # 121: NCAM cloned into pCS2, (Tonissen & Krieg, 1993) - anti-sense linearised with Asp 718,

- transcribed with T7 polymerase in Buffer B

- GenBank accession number M76710, ordered from MWG-Biotech

Plasmid # 121: Pax6 cloned into pGEM, a kind gift from Dr. Thomas Hollemann, Institut für Biochemie und Molekulare Zellbiologie, Universität Göttingen

- anti-sense linearised with Not I,

3.3.2.4 CHD4 and Sip1 Morpholinos

Sip1 mRNA translation was inhibited by Morpholinos described by (Nitta et al, 2007). Sip1-Mo: CTTGCTTCATTGATAAGAGTGGGAT, purchased from Gene Tools, LLC, One Summerton Way, Philomath, OR 97370 USA.

CHD4 mRNA translation was inhibited by 25-mer anti-sense Morpholino oligo- nucleotide complementary to the Xenopus CHD4 translation start side:

xCHD4-Mo: 5’-CCATGCCCAGGAAGGAGCAAAATGG-3’, purchased from Gene Tools, LLC, One Summerton Way, Philomath, OR 97370 USA.

3.3.3 Transformation with E. coli strains

The handling, transformation and preparations of competent cells have been performed as standard methods. For each transformation 1 vial of competent cells (e.g.xL1blue), stored at -80°C, has been thawed one ice. Then, 1 l plasmid-DNA (1:100 diluted) or 10 l ligation product was given in 1,5 ml vial, put on ice and mixed with the cell suspension, followed by a 30 minute incubation step on ice. Then, plasmids and cell suspension was heat-shocked in a thermoblock at 42°C for 45 sec at 42°C, and put on ice afterwards immediately, followed by a 3 minute incubation time on ice with 1 ml LB-medium without Ampicillin. After that, the cell and plasmid suspension was incubated for 1 hour at 37°C with shacking. After incubation for 1 hour, the suspension was centrifuged for 2 minutes at 3000 rpm. The supernatant was discarded and the cells were resuspended in 50-100 l and streaked on a LB- Ampicillin plate, followed by incubation over night at 37°C.

After incubation of the transformed competent cells on a LB-Ampicillin plate over night, a single colony of cells was picked and incubated in 5 ml psi medium at 37°C over night. Then 400 ml of psi media was inoculated with 4 ml of the over night culture and incubated at 37°C until OD 600=0,5-0,6. After incubation, cells were chilled on ice for 5 minutes and poured into 50 ml polypropylene tubes and centrifuged at 3000 rpm for 10 minutes at 4°C. The supernatant was discarded and the pellet resuspended in 2 ml of Tfb2 media and kept on ice for 15 minutes. For storage, 200 l aliquots were frozen in liquid nitrogen. According to (Hanahan et al, 1991).

Table 4: Overview of E. coli strains used for transformation procedures

Strain Genotype Company

BL21(DE3) B F- dcm ompT hsdS(rB- mB-) gal (DE3) Novagene XL1Blue F'::TN10 proA

+

B+laclq(lacZ)M15/recA1 end A1

gyrA96(NalR) thi hadR17 (rK-mK-) glnV44 relA1 lac Stratagene