sco2987$ sven2241$ OhrR% Organic% hydroperoxide%
2 Materials and Methods
3.1 Chapter summary
3.2.1 The NsrR regulon: a disconnect of experiment and prediction
3.2.1.2 Refinement of the NsrR binding site, an 11 bp inverted repeat sequence
Results acquired from the ChIP-seq data allowed us to identify three NsrR target sites within the genome. The number of targets identified is more than 100-fold less than those predicted (322) bioinformatically using the hmpA1p and hmpA2p NsrR binding sites (Tucker et al. 2010). This was concerning and led us to further refine the NsrR binding site in S. coelicolor using DNaseI footprinting and then test some of the predicted binding sequences by EMSAs and test the hmpA1p binding site using short probes for the binding sites from S. coelicolor, Bacillus subtilis and E. coli.
We first produced 32P labelled DNA probes, which allowed for visualisation of the DNA using a phosphoimaging plate, using primers JTM0005-10, which carried the promoter regions of nsrR (nsrRp), hmpA1 (hmpA1p) and hmpA2 (hmpA2p) including their NsrR binding sites. Optimisation of the experiment was carried out primarily using the nsrRp probe and then these conditions were used for all three probes. Optimisation of the DNaseI digestion time of the probe resulted in a very clear protected region, which spans the predicted NsrR binding site (Figure 3.2a). The NsrR binding site was further confirmed and identified for each of the promoter probes by incubating reactions with increasing concentrations of NsrR (Figure 3.2b). From these two experiments we see a
protected region spanning the predicted NsrR binding sites (nsrRp
CAAATGCGCATGCTAGGTTCGCCTTTACCCGG, hmpA1p CTGTGGCCTAAAACACGA ATATCATCTACCAATTAAGAG, hmpA2p TCGGAAAACAAGCATCTGAGATCCAGTTCG GAG, the consensus binding site is underlined) at the promoters of these three genes. To further analyse the S. coelicolor NsrR binding site we produced EMSA probes using a nested primer system incorporating short sequences to be tested for NsrR binding, summarised in Table 3.1. Firstly, probes were designed to determine the outer edge of the hmpA1 promoter NsrR binding sites. JM0064 consists of the hmpA1 sequence used previously to examine NsrR binding using analytical ultracentrifugation (Tucker et al. 2008). JM0065 is the full, predicted, hmpA1p site. JM0068 is the hmpA1p with the conserved double AA and double TT removed from the ends. We also wanted to determine if S. coelicolor NsrR can bind to the experimentally derived E. coli and B.
subtilis NsrR binding sites at their respective hmpA promoters and if a binding site
remained functional when made preferentially GC rich (JM0069-71). For probe JM0071, when a base was wholly conserved between the three sites, we retained this regardless of AT or GC nature. However if the site was a G or C in any of the three probes, this was selected preferentially over an A or T.
Figure 3-2 NsrR DNaseI footprinting. NsrR DNaseI footprinting results showing the binding sites of NsrR within the nsrR, hmpA1 and hmpA2 promoters modified from Crack et al. 2015. a) Footprinting experiment using ~30k cpm of probe and 2 μM NsrR with varying digestion times (Lane 2-7, 10 s, 1 min, 2.5 min, 5 min, 7.5 min and 10 min respectively). b) nsrR, hmpA1 and hmpA2 promoter (~30k cpm of each) with increasing concentrations of purified NsrR added and digestion times extended appropriately (lane 2- 6, DNA only control, 0.1 μM, 0.25 μM, 1 μM and 2 μM digested for 10 s, 45 s, 90 s, 120 s, and 150 s respectively). In each, lane 1 contains G+A ladder for analysis.
The concentration of NsrR used in each EMSA throughout this chapter corresponds to the approximate molar ratio of [Fe:S]:DNA required to completely and specifically shift each of the target probes, 2.5:1.0, 5.0:1.0, and 8.0:1.0 for hmpA1, nsrR and hmpA2 probes respectively, in addition to a DNA only control. These ratios were selected based on the EMSA results in our publication Crack et al., 2015 and shown in Figure 3.3. addtionally we were able to show that neither [2Fe-2S] or apo NsrR were capable of shifting target DNA, only Holo [4Fe-4S] NsrR is capable of this as indicated in Figure 3.4 and Figure 3.5 respectively. A ratio of 16.0:1.0 was also used as a higher limit for EMSA’s in section 3.2.1.3.
Figure 3-3 NsrR [4Fe-4S] EMSAs. Taken from Crack et al., 2015. EMSAs were carried out using holo NsrR ([4Fe-4S]) using (a) hmpA1p (6.9 nM), (b) hmpA2p (6.9 nM) and (c)
nsrRp (8.8 nM) DNA probes. B = Bound, U = Unbound DNA probe. Each illustrates the
approximate ratio required to shift each probe to near completion. These ratios were used for down stream experiments in this thesis.
Figure 3-4 NsrR [2Fe-2S] EMSAs. Taken from Crack et al., 2015. EMSAs were carried out using NsrR [2Fe-2S] and NsrR ([4Fe-4S]) as a control using (a) hmpA1p (11.1 nM), (b) hmpA2p (6.8 nM) and (c) nsrRp (5.3 nM) DNA probes. Each illustrates the concentration of each form used (nM) and the ratio of [Fe-S]:[DNA].
Figure 3-5 NsrR Holo vs. Apo EMSAs. Taken from Crack et al., 2015. EMSAs were carried out using holo NsrR ([4Fe-4S]) using (a) hmpA1p (6.9 nM), (b) hmpA2p (8.8 nM) and (c) nsrRp (8.8 nM) DNA probes. Each illustrates the concentration of each form used (nM) and the ratio of [Fe-S]:[DNA].
EMSA reactions were carried out using these probes and the results are summarised in Table 3.1 and shown in Figure 3.6. NsrR was able to bind to JM0064, our positive control and JM0065 the refined probe with the conserved AA and TT at the ends. However, NsrR did not bind to JM0068-70. This highlights the importance of the AA/TT at the ends of the binding sites, following the removal of these the protein is no longer able to bind. A clear difference in sequence binding between the S. coelicolor, E. coli and B. subtilis proteins and their target sequences. We observed that NsrR had a lower affinity for Short hmpA1 (JM0068) which could be due to the loss of non-essential but important bases flanking the binding site. Additionally, due to ScoNsrR having a [4Fe-4S] cluster and only sharing between 30-40% amino acid sequence identity with E. coli and B. subtilis which [2Fe-2S] cluster, it is likely that the binding architecture is substantially different and as a result contribute to an inability to bind the ScoNsrR binding sequence.
Promoter Sequence NsrR binding Primer
hmpA1 long CTAAAACACGAATATCATCTACCAATTAAG Y JM0064
hmpA1 AACACGAATATCATCTACCAATT Y JM0065
Short hmpA1 CACGAATATCATCTACCAG N JM0068
Bsu hmpA 17 bp
AAGATCATGTATTTTAAAGATATATTTTA N JM0069
Eco hmpA ATAAGATGCATTTGAGATACATCAA N JM0070
GC rich AACGCGCATCTGAGATGCGCGTT N JM0071
Consensus AACACGAATCTNANATNCCAATT - -
Table 3-1 A summary of the short EMSA reactions. The EMSA column indicates if a shift was detected (Y = yes, N = no).
Figure 3-6 Short probe EMSA reactions. Using short probes JM0064-JM0071 showing that ScoNsrR can bind the Sco nsrR hmpA1 and hmpA2 sequence very specifically (taken from Crack et al. 2015). Ratio of cluster to DNA was determined using 8 nM DNA probe in each case. Black arrows show unbound (U) and Bound (B) DNA to NsrR.