Appendix B
Supporting material for chapter 2
Supplemental Methods Strain construction
To generate deletion strains, a linear hygromycin-resistance cassette was
amplified with overhanging 40 bp of STE4 homology on both ends and transformed into yGIL1113 (MATα, ura3Δ::PFus1-yEVenus; Lang et al. 2011). The resulting deletion mutant was converted to MATa by transforming with a gal-inducible HO (as described below) and used as the haploid deletion strain in competitions. The same deletion mutant was also crossed to yGIL121 (STE4, ura3) and yGIL128 (ste4Δ::KanMX, ura3; reported as DBY15087 in Lang et al. 2009) to generate heterozygous and homozygous deletions.
A cross of yGIL1113 to yGIL121 was used as a wild type control. Crosses of strains carrying null alleles were performed by first transforming with a STE4-expressing plasmid from the MoBY ORF plasmid collection to compliment ste4Δ. All diploid genotypes were then converted from MATa/α to MATa/a via transforming with pGIL088, a plasmid encoding a gal-inducible HO and a PSTE2HIS3 marker, and selecting his+
transformants.
Three evolved STE4 alleles were selected for reconstruction, 81ΔT (Ser261fs), G943T (Glu315*), and G935A (Arg312Gln). Alleles were reconstructed in yGIL432 (a yGIL121 derivative) using CRISPR-Cas9 alleles swaps. We constructed constitutive
Cas9-expressing plasmids starting from pML104 (Addgene 67638) expressing a STE4-specific guide RNAs (5’ CTACCCCTACTTATATGGCA 3’) and co-transformed the plasmid along with a 500 bp linear repair template (gBlock, IDT) encoding the one of three evolved alleles as well as a synonymous C954A PAM site substitution. A strain containing just the synonymous PAM site was also isolated and used as the wild-type control allele. To minimize variation due to transformation and Cas9 activity, one successful transformant per allele was backcrossed twice and the resulting diploid was sporulated and tetrad dissected. For each allele, spores were genotyped at STE4 and intercrossed to generate heterozygous and homozygous mutants. Crosses of strains carrying evolved ste4 alleles were performed by first transforming with a plasmid from the MoBY ORF plasmid collection to compliment STE4. Mutants carrying an evolved WHI2 C85T (Q29*) allele were generated in identical fashion with two exceptions. The evolved substitution is within the WHI2 gRNA used (5’
ACAGTACGAAGGTAACGAGG 3’), and therefore no synonymous mutation was needed to eliminate Cas9 activity. A correct whi2Q29* was backcrossed once and intercrossed to produce homozygotes and heterozygotes. All diploid genotypes were converted to MATa/a as described above.
We generated strains containing dominant drug cassettes tightly linked to the WHI2 locus using a similar CRISPR-based approach. We inserted either HphMX or KanMX 220 bp downstream of WHI2 or whi2C85T by transforming with the same gRNA (5’ ATCCCCTTCTGCAAATAACG 3’) and Cas9- expressing plasmid and co-transforming with linear drug cassettes flanked by 40 bp of homology to the targeted region. Successful transformants were then backcrossed to either a wild type background
or a ste4G943T (described above) mutant. Crosses were sporulated and spores were selected in which drug-marker tagged mutant and wild-type WHI2 alleles are present on the same chromosome as both mutant and wild type STE4. Correct spores were crossed to generate three genotypes; WHI2::HphMX-STE4/ WHI2::KanMX-STE4, WHI2::Hph-STE4, and WHI2::Hph- STE4/whi2C85T::KanMX-ste4G943T. All three genotypes were converted to MATa/a as described above.
Table B-1. Strains generated for this study.
Ploidy Assay Genotype*†
MATa Competitive fitness STE4, ade2–1, his3–11, leu2–3,112, trp1–1, ura3Δ::PFus1-yEVenus, bar1Δ::ADE2, hmlαΔ::LEU2, GPA1::NatMX
MATa Competitive fitness ste4 Δ::KanMX, ade2–1, his3–11, leu2–3,112, trp1–
1, ura3Δ::PFus1-yEVenus, bar1Δ::ADE2, hmlαΔ::LEU2, GPA1::NatMX
MATa/a Competitive fitness STE4, ade2–1, his3–11, leu2–3,112, trp1–1, ura3Δ::PFus1-yEVenus/ura3, bar1Δ::ADE2, hmlαΔ::LEU2, GPA1::NatMX
MATa/a Competitive fitness STE4/ ste4 Δ::KanMX, ade2–1, his3–11, leu2–
3,112, trp1–1, ura3Δ::PFus1-yEVenus/ura3, bar1Δ::ADE2, hmlαΔ::LEU2, GPA1::NatMX MATa/a Competitive fitness ste4 Δ::KanMX, ade2–1, his3–11, leu2–3,112, trp1–
1, ura3Δ::PFus1-yEVenus/ura3, bar1Δ::ADE2, hmlαΔ::LEU2, GPA1::NatMX
MATa/a Competitive fitness ste4 Δ::KanMX, ade2–1, his3–11, leu2–3,112, trp1–
1, ura3Δ::PFus1-yEVenus/ura3, bar1Δ::ADE2, hmlαΔ::LEU2, GPA1::NatMX
MATa/a Competitive fitness ste4 Δ::KanMX, ade2–1, his3–11, leu2–3,112, trp1–
1, ura3Δ::PFus1-yEVenus/ura3, bar1Δ::ADE2, hmlαΔ::LEU2, GPA1::NatMX
MATa Competitive fitness ste4C958A‡, ade2–1, his3–11, leu2–3,112, trp1–1, ura3Δ::PFus1-yEVenus, bar1Δ::ADE2,
hmlαΔ::LEU2, GPA1::NatMX
MATa/a Competitive fitness ste4C958A‡/STE4, ade2–1, his3–11, leu2–3,112, trp1–1, ura3Δ::PFus1-yEVenus/ura3, bar1Δ::ADE2, hmlαΔ::LEU2, GPA1::NatMX/ GPA1::KanMX MATa/a Competitive fitness ste4C958A‡/ ste4C958A‡, ade2–1, his3–11, leu2–
3,112, trp1–1, ura3Δ::PFus1-yEVenus/ura3, bar1Δ::ADE2, hmlαΔ::LEU2, GPA1::NatMX/
GPA1::KanMX
MATa Competitive fitness ste4T81Δ, ade2–1, his3–11, leu2–3,112, trp1–1, ura3Δ::PFus1-yEVenus, bar1Δ::ADE2,
hmlαΔ::LEU2, GPA1::NatMX
MATa/a Competitive fitness ste4T81Δ/STE4, ade2–1, his3–11, leu2–3,112, trp1–
1, ura3Δ::PFus1-yEVenus/ura3, bar1Δ::ADE2, hmlαΔ::LEU2, GPA1::NatMX/GPA1::KanMX MATa/a Competitive fitness ste4T81Δ, ade2–1, his3–11, leu2–3,112, trp1–1,
ura3Δ::PFus1-yEVenus/ura3, bar1Δ::ADE2, hmlαΔ::LEU2, GPA1::NatMX/GPA1::KanMX MATa Competitive fitness ste4G943T, ade2–1, his3–11, leu2–3,112, trp1–1,
ura3Δ::PFus1-yEVenus, bar1Δ::ADE2, hmlαΔ::LEU2, GPA1::NatMX
MATa/a Competitive fitness ste4G943T /STE4, ade2–1, his3–11, leu2–3,112, trp1–1, ura3Δ::PFus1-yEVenus/ura3, bar1Δ::ADE2, hmlαΔ::LEU2, GPA1::NatMX/GPA1::KanMX MATa/a Competitive fitness ste4G943T, ade2–1, his3–11, leu2–3,112, trp1–1,
ura3Δ::PFus1-yEVenus/ura3, bar1Δ::ADE2, hmlαΔ::LEU2, GPA1::NatMX/GPA1::KanMX MATa Competitive fitness ste4G935A, ade2–1, his3–11, leu2–3,112, trp1–1,
ura3Δ::PFus1-yEVenus, bar1Δ::ADE2, hmlαΔ::LEU2, GPA1::NatMX
MATa/a Competitive fitness ste4G935A /STE4, ade2–1, his3–11, leu2–3,112, trp1–1, ura3Δ::PFus1-yEVenus/ura3, bar1Δ::ADE2, hmlαΔ::LEU2, GPA1::NatMX/GPA1::KanMX MATa/a Competitive fitness ste4G935A, ade2–1, his3–11, leu2–3,112, trp1–1,
ura3Δ::PFus1-yEVenus/ura3, bar1Δ::ADE2, hmlαΔ::LEU2, GPA1::NatMX/GPA1::KanMX MATa/a Short-term-evolution STE4-WHI2::HphMX/ STE4-WHI2::KanMX,
ade2–1, his3–11, leu2–3,112, trp1–1, ura3Δ::P
Fus1-yEVenus, bar1Δ::ADE2, hmlαΔ::LEU2, GPA1::NatMX
MATa/a Short-term-evolution WHI2::HphMX- STE4/whi2C85T::KanMX-STE4, ade2–1, his3–11, leu2–3,112, trp1–1, ura3Δ::P
Fus1-yEVenus, bar1Δ::ADE2, hmlαΔ::LEU2, GPA1::NatMX
MATa/a Short-term-evolution WHI2::HphMX-STE4/whi2C85T::KanMX-ste4G943T, ade2–1, his3–11, leu2–3,112, trp1–1, ura3Δ::PFus1-yEVenus, bar1Δ::ADE2,
hmlαΔ::LEU2, GPA1::NatMX
*Two alleles provided only for heterozygous loci in diploid genotypes.
†ura3 alleles harbor spontaneous LOF mutations isolated from 5FOA.
‡ ste4C958A control allele to ensure there is no fitness effect of a synonymous PAM site substitution used in strain construction.