The LMP2A ITAM Is Essential for Providing B Cells with Development and Survival Signals In Vivo

J

OURNAL OF

V

IROLOGY

,

0022-538X/00/$04.00⫹0

Oct. 2000, p. 9115–9124

Vol. 74, No. 19

Copyright © 2000, American Society for Microbiology. All Rights Reserved.

The LMP2A ITAM Is Essential for Providing B Cells with

Development and Survival Signals In Vivo

MARK MERCHANT, ROBERT G. CALDWELL,

AND

RICHARD LONGNECKER*

Department of Microbiology-Immunology, Northwestern University Medical School, Chicago, Illinois 60611

Received 23 March 2000/Accepted 5 July 2000

In Epstein-Barr virus-transformed B cells, known as lymphoblastoid cell lines (LCLs), LMP2A binds the

tyrosine kinases Syk and Lyn, blocking B-cell receptor (BCR) signaling and viral lytic replication. SH2

domains in Syk mediate binding to a phosphorylated immunoreceptor tyrosine-based activation motif (ITAM)

in LMP2A. Mutation of the LMP2A ITAM in LCLs eliminates Syk binding and allows for full BCR signaling,

thereby delineating the significance of the LMP2A-Syk interaction. In transgenic mice, LMP2A causes a

developmental alteration characterized by a block in surface immunoglobulin rearrangement resulting in

BCR-negative B cells. Normally B cells lacking cognate BCR are rapidly apoptosed; however, LMP2A

trans-genic B cells develop and survive without a BCR. When bred into the recombinase activating gene 1 null

(RAG

ⴚ/ⴚ

) background, all LMP2A transgenic lines produce BCR-negative B cells that develop and survive in

the periphery. These data indicate that LMP2A imparts developmental and survival signals to B cells in vivo.

In this study, LMP2A ITAM mutant transgenic mice were generated to investigate whether the LMP2A ITAM

is essential for the survival phenotype in vivo. LMP2A ITAM mutant B cells develop normally, although

transgene expression is comparable to that in previously described nonmutated LMP2A transgenic B cells.

Additionally, LMP2A ITAM mutant mice are unable to promote B-cell development or survival when bred into

the RAG

ⴚ/ⴚ

background or when grown in methylcellulose containing interleukin-7. These data demonstrate

that the LMP2A ITAM is required for LMP2A-mediated developmental and survival signals in vivo.

Epstein-Barr virus (EBV) is a ubiquitous human oncogenic

herpesvirus associated with a number of proliferative diseases.

In lymphoid cell types, EBV causes infectious mononucleosis

in naive adolescents and is associated with African Burkitt’s

lymphoma, Hodgkin’s lymphoma, and adult T-cell leukemia

(40, 49). Furthermore, individuals with congenital or immune

deficiencies often develop EBV-associated

lymphoprolifera-tive diseases (66, 81). In the oral epithelia, EBV is associated

with nasopharyngeal carcinoma and oral hairy leukoplakia (4,

35, 63, 71). EBV has also been found in smooth muscle tumors

and in assorted lung, breast, gastric, and salivary carcinomas;

however, it is unclear what role the virus plays in these cancers

(2, 3, 11, 27, 31, 32, 43, 45, 64).

The ability for the virus to remain latent within host B cells

is a hallmark of EBV infection. During latency, EBV expresses

a set of nine well-studied viral proteins. Six proteins are termed

Epstein-Barr nuclear antigens (EBNAs), which include

EBNA1, EBNA2, EBNA3A, EBNA3B, EBNA3C, and

EBNALP (40, 49). The remaining three proteins are the latent

membrane proteins 1 (LMP1), LMP2A, and LMP2B (40). B

cells transformed by EBV in vitro, termed lymphoblastoid cell

lines (LCLs), express all of these proteins, whereas most

EBV-related malignancies express only EBNA1, LMP1, and LMP2A

(65). In contrast to these cell types, primary B cells from

healthy individuals latently infected with EBV express a very

limited number of viral proteins, with LMP2A being the most

consistently detected transcript (1, 12, 20, 61, 74). While

EBNA1 has been shown to be necessary for maintaining the

viral episome (40, 80), LMP2A is thought to be important for

maintaining viral latency but not viral transformation (22, 48,

52–55, 57–59).

LMP2A consists of a long amino-terminal tail, 12

mem-brane-spanning domains, and a short carboxy-terminal tail

which aggregates in patches on the surface of latently infected

cells (22, 23, 50, 51, 58, 68). The amino-terminal tail of LMP2A

contains eight constitutively phosphorylated tyrosine residues

and several proline-rich regions which are critical for the

abil-ity of LMP2A to interact with cellular proteins (22, 24, 25,

57–59). Phosphorylation at tyrosine 112 is important for

asso-ciation between LMP2A and the protein tyrosine kinase (PTK)

Lyn (25). Similarly, phosphorylation at tyrosines 74 and 85 of

LMP2A, two key regulatory residues in the immunoreceptor

tyrosine-based activation motif (ITAM) of LMP2A, allows for

association and activation of the Syk PTK (24). Recent

evi-dence has suggested that ubiquitin ligases, such as Nedd4 and

AIP4, associate with the proline-rich PY motifs within LMP2A

in a phosphorylation-independent manner (37). These

LMP2A-cellular protein associations enable LMP2A to block

B-cell antigen receptor (BCR) cross-linking in LCLs, leading

to a model in which LMP2A maintains both B-cell quiescence

and viral latency.

To establish LMP2A as being critical for maintaining EBV

latency in vivo, we generated transgenic mice which express

LMP2A downstream of the

␮

immunoglobulin (Ig)

heavy-chain enhancer and promoter (E

␮

) (6, 7). Analysis of several

lines of these E

␮

LMP2A transgenic mice has revealed that two

distinct LMP2A in vivo phenotypes exist. Two lines of mice

display an LMP2A

BCR⫺

phenotype, best characterized by

transgenic line E (TgE), while three independent lines of

an-imals display an LMP2A

BCR⫹

phenotype, best typified by

transgenic line 6 (Tg6). E

␮

LMP2A

BCR⫺

transgenic lines have

been shown by quantitative PCR to express more

LMP2A-specific message than E

␮

LMP2A

BCR⫹

transgenic lines.

How-ever, since there are no data addressing the timing of transgene

expression in each line during the B-cell developmental time

line, these animals are currently considered to represent two

distinct phenotypic variants. E

␮

LMP2A

BCR⫺

transgenic mice

* Corresponding author. Mailing address: Department of

Microbi-ology-Immunology, Northwestern University Medical School, 303 E.

Chicago Ave., Chicago, IL 60611. Phone: (312) 503-0467. Fax: (312)

503-1339. E-mail: r-longnecker@nwu.edu.

9115

on November 9, 2019 by guest

http://jvi.asm.org/

[image:2.612.83.495.73.279.2]

FIG. 1. Generation of LMP2A ITAM mutant transgenic mice. (A) LMP2A ITAM mutant transgene construct. The E␮heavy-chain enhancer/promoter (wavy lines) was fused to the LMP2A ITAM mutant transgene containing both LMP2A cDNA sequences (striped lines) and EBV genomic sequences (stippled). The DNA, protein, and amino acid number (AA #) for the altered ITAM sequences are shown in the shaded inset at the bottom. A silent point mutation creates aKpnI site in the LMP2A ITAM mutant transgene, which aids in distinguishing ITAM mutant mice from LMP2A transgenic mice by PCR using OL129 and OL131 (upper inset) followed by

on November 9, 2019 by guest

http://jvi.asm.org/

display a B-cell developmental alteration characterized by a

bypass of Ig heavy-chain rearrangement resulting in an overall

loss of surface Ig (sIg) expression. PCR amplification of Ig

gene rearrangements in E

␮

LMP2A

BCR⫺

transgenic bone

mar-row cells demonstrated that rearrangement of the D-J

H

heavy

chain and V-J

K

light-chain genes occurs correctly; however,

there is a failure to complete the final V-DJ

H

rearrangement of

the heavy chain. B cells that lose a functioning BCR have been

shown to rapidly undergo apoptosis (44). Nonetheless,

E

␮

LMP2A

BCR⫺

B cells are capable of exiting the bone

mar-row and persisting in the periphery. E

␮

LMP2A

BCR⫹

lines

display a less prominent phenotype consisting of slight decreases

in mature B-cell numbers, while the resulting B cells appear

largely normal. When bred into a RAG-1-deficient (RAG

⫺/⫺

)

background, both E

␮

LMP2A

BCR⫺

and E

␮

LMP2A

BCR⫹

lines

are capable of producing B cells that exit the bone marrow and

persist in the periphery. These observations were supported by

the growth of RAG

⫺/⫺

E

␮

LMP2A bone marrow cells in

meth-ylcellulose containing interleukin-7 (IL-7). These data indicate

that LMP2A drives B-cell development and survival in the

absence of normal BCR signals.

In this study, we used an LMP2A ITAM mutant, encoding

mutations of tyrosines 74 and 85 to phenylalanines [Y(74/

85)F], to create E

␮

LMP2A

⌬

ITAM transgenic mice.

Genera-tion of these mice allows for investigaGenera-tion of whether the in

vivo developmental and survival signals observed in LMP2A

transgenic mice derive from the LMP2A ITAM. These mice

show no B-cell developmental alteration or survival phenotype

in any B-cell compartment. Furthermore, this transgene is

in-capable of driving B-cell development or survival when bred

into the RAG

⫺/⫺

background in vivo or when grown in

meth-ylcellulose in vitro. These data show that LMP2A must have a

functional ITAM in order to enhance B-cell development and

survival. These results suggest that Syk activation by a

phos-phorylated ITAM is required for LMP2A to provide

develop-mental and survival signals in vivo.

MATERIALS AND METHODS

Mice.Constructions of the E␮LMP2A transgene and LMP2A ITAM mutant [Y(74/85)F] have been previously described (7, 24). The LMP2A⌬ITAM mutant transgene containing the double mutation Y(74/85)F was constructed as follows. TheEcoRI-SalI DNA fragment from pRH38, coding for the Y(74/85)F mutant amino-terminal tail of LMP2A, was cloned intoMunI-SalI-digested pRL202, which codes for the E␮enhancer and promoter transgene construct, to generate pRG3. TheMscI-XhoI fragment from pRL209, which codes for the remainder of the LMP2A transgene, was inserted intoMscI-XhoI-digested pRG3 to generate pRG4. TheSacI-XhoI fragment of pRG4 containing the E␮promoter/enhancer and LMP2A⌬ITAM transgene was used for standard microinjection into (B6⫻

CBA)F1single-cell fertilized eggs as described elsewhere (36). The resulting

offspring were screened by PCR and Southern blotting for the presence of LMP2A. The identified founders were bred to C57BL/6 or RAG⫺/⫺_{animals in} the BL/6 background for all described experiments. The animals were housed at the Northwestern University Center for Experimental Animal Resources in accordance with university animal welfare guidelines. Wild-type C57BL/6 and RAG⫺/⫺_{animals were obtained from Jackson Laboratories.}

Tail DNA isolation.DNA was prepared as previously described (6, 7). Briefly, a 1-cm piece of tail was digested in a 1.5-ml microcentrifuge tube overnight in 500

␮l of tail lysis buffer (100 mM Tris [pH 8], 100 mM NaCl, 5 mM EDTA, 0.2% sodium dodecyl sulfate [SDS], 100␮g of proteinase K/ml) at 55°C. Digested tail lysates were vortexed and centrifuged for 10 min, and supernatants were trans-ferred to a new 1.5-ml microcentrifuge tube. Supernatants were precipitated with 2 volumes of 95% ethanol and centrifuged at 4°C for 20 min; DNA pellets were air dried and resuspended in 200␮l of Tris-EDTA.

Southern hybridization.Ten micrograms of mouse genomic tail DNA was digested overnight at 37°C withBamHI (1⫻ NEB [New England Biolabs] BamHI buffer, 1⫻bovine serum albumin [BSA], 20 U ofBamHI [NEB]) and electrophoresed on a 0.8% agarose gel. The gel was then treated sequentially with 0.25 N HCl for 10 min and 0.4 M NaOH for 30 min followed by transfer of the gel onto GeneScreen Plus (NEN) using a vacuum blotter (Appligene). LMP2A probe was generated by digesting the LMP2A cDNA clone pRL34 with EcoRI, releasing the 2.0-kb cDNA in its entirety, followed by gel purification, ethanol precipitation, and resuspension to 20 ng/␮l. Then 1.0␮l (20 ng) of this DNA was labeled with [␣-32_{P]dCTP (Amersham-Pharmacia) using Ready-to-Go}

(-dCTP) labeling beads (Amersham-Pharmacia) followed by a purification step to remove unincorporated [␣-32_{P]dCTP, using G-50 Probe-Quant spin columns}

(Amersham-Pharmacia) according to the manufacturers recommendations. The blot was prehybridized for 1 h at 68°C in 30 ml of hybridization solution (6⫻SSC [0.9 M NaCl, 0.09 M sodium citrate], 1⫻Denhardt’s solution [0.02% BSA, 0.02% Ficoll, 0.02% polyvinylpyrrolidine], 62.5 mM Tris [pH 7.5], 0.05% SDS) with 100

␮g of denatured herring sperm DNA per ml. Roughly 106_{cpm of labeled probe}

was denatured and added directly to 10 ml of 68°C hybridization solution; the blot was added, and the solution was allowed to hybridize overnight at 68°C. Following hybridization, the blot was washed according to the following regimen: twice with 2⫻SSC at room temperature, twice with 2⫻SSC–1% SDS, and twice with 0.1⫻SSX–1% SDS. The blot was then wrapped in Saran Wrap and exposed to film.

PCR.PCR for the presence of the LMP2A transgene was done as previously described (6, 7). Briefly, each 25.0-␮l reaction mixture contained 1⫻PCR buffer (Pharmacia), 0.2 mM each deoxynucleoside triphosphate, 1.0 U ofTaq polymer-ase (Pharmacia), 1␮M each oligonucleotide primer, 1⫻PCR cresol red loading dye (60% sucrose, 5 mM cresol red [Sigma]), and 1.0␮l of genomic tail DNA. The amplification cycle (15 s at 94°C, 30 s at 58°C, and 75 s at 72°C) was repeated 30 times, followed by a single 10-min extension at 72°C. A unique silentKpnI site was engineered between residues 74 and 85 to distinguish LMP2A ⌬ITAM mutant animals from nonmutated LMP2A transgenic animals (Fig. 1A). LMP2A amino-terminal primers (OL129 and OL131) were designed to amplify the re-gion of LMP2A containing the engineeredKpnI site. These primers were used, in combination with RAG internal control primers, in a PCR followed by over-night digestion withKpnI (1⫻NEB buffer 1, 1⫻BSA, 25.0␮l of PCR mixture, 1.0 U ofKpnI [NEB]) at 37°C. The oligonucleotide primers not previously described are as follows: LMP2A amino-terminal primer pair (370 bp), OL129 (TGGGTACGATGGCGGAAACAACTC) and OL131 (TGAAACACGAGGC GGCAATAGC); RAG (180 bp), OL107 (TGACTGTGGGAACTGCTGAAC TTT) and OL138 (CCGTGGACGCTAAAACCCAAAGTC); and Neo (280 bp), Neo-2 (CAACAGACAATCGGCTGCTCTGATG) and Neo-3 (CATTGC ATCAGCCATGATGGA).

Protein isolation.Spleens were dissected from animals, homogenized between the frosted edges of two microscope slides, and suspended into 10 ml of ice-cold 1⫻phosphate-buffered saline (PBS). Samples were centrifuged at 1,500 rpm for 10 min, supernatants were poured off, and red blood cells were lysed in 5 ml of red blood cell lysis buffer (150 mM NH4Cl, 17 mM Tris base [pH 7.2]) for 5 min.

[image:3.612.336.523.74.161.2]

Cell suspensions were added to 5 ml of ice-cold 1⫻PBS through a nylon mesh. Bone marrow methylcellulose samples were prepared by washing methylcellulose cultures with 10 ml of 1⫻PBS, centrifuging them at 1,500 rpm for 10 min, and resuspending them in 10 ml of 1⫻PBS. Following cell counting, samples were FIG. 2. LMP2A expression in LMP2A ITAM mutant transgenic lines is sim-ilar to that in nonmutated LMP2A transgenic mice. Immunoblot analyses of LMP2A and p85 expression in splenic tissues from Tg⌬ITAM1, Tg⌬ITAM2, WT, TgE, and Tg6 animals are shown. The LMP2A and p85 subunit (PI-3K) bands are indicated by arrows. LMP2A-expressing EBV-transformed LCLs served as a positive control.

KpnI digestion. The LMP2A cDNA probe shown spans sequences throughout the LMP2A transgene.BamHI (B) sites are indicated. TheBamHI site in parentheses may be lost upon integration. (B) PCR/KpnI digest identification of LMP2A ITAM mutant transgenic mice. Tail genomic DNA sequences from LMP2A ITAM mutant, nonmutated LMP2A, and WT littermate control animals were amplified using OL129-OL131 and RAG positive control primers, followed by digestion withKpnI (K) or no enzyme (NE). Identities of the amplified products and their subsequent digested fragments are shown to the left.␾X DNA digested withHaeIII was used as a size standard (right-most lane). (C) Southern hybridization analysis of LMP2A ITAM mutant lines. Tail DNAs from Tg⌬ITAM1, Tg⌬ITAM2, TgE, and WT animals were digested withBamHI, run on an 0.8% agarose gel, and probed for LMP2A sequences by Southern hybridization. Size standards are indicated at the right.

V

OL

. 74, 2000

LMP2A

⌬ITAM TRANSGENIC MICE

9117

on November 9, 2019 by guest

http://jvi.asm.org/

centrifuged at 1,500 rpm for 5 min, and cell pellets were lysed with the addition of enough Triton X lysis buffer (1% Triton X-100, 20 mM Tris [pH 8.0], 137 mM NaCl, 10% glycerol, 2 mM EDTA, 1 mM sodium vanadate, 10 mM sodium fluoride, 1⫻phenylmethylsulfonyl fluoride, 1⫻pepstatin, 1⫻leupeptin) to bring samples to 200⫻106_{cells/ml for spleen samples or 100⫻10}6_{cells/ml for}

methylcellulose samples. Lysates were allowed to rotate at 4°C for 15 min before being vortexed and cleared of nonsoluble proteins by centrifugation three times for 20 min. Cleared lysates were mixed 1:1 with 2⫻SDS sample buffer (150 mM Tris-HCl [pH 6.8], 2% SDS, 2% glycerol, 1.43 M␤-mercaptoethanol) before being loaded.

Immunoblotting.For immunoblot analysis, 2.5⫻106_{cell equivalents of spleen}

cell equivalents and 0.25⫻106_{cell equivalents of control LCLs were heated at}

70°C for 10 min, loaded onto a 1.5 mM 7% polyacrylamide gels, and run at 100 V for 1.5 h. Gels were electroblotted to Immobilon-P (Millipore) according to the manufacturer’s recommendations. Blots were stained with Ponceau S reagent (Sigma) to ensure equal loading and then blocked in 4% milk in 1⫻TBST (10 mM Tris [pH 8.0], 150 mM NaCl, 0.05% Tween 20) for 1 h at room temperature. Blots were then washed once for 15 min and twice for 5 min each with 1⫻TBST. Rat monoclonal anti-LMP2A antibody (14B7-1-1; 2.8␮g/ml) or rabbit anti-phosphatidylinositol 3-kinase (PI3-K) p85 antibody (1␮g/ml; Upstate Biotech-nology) was diluted in 1% milk–1⫻TBST to 1:2,500 and 1:5,000, respectively, and allowed to incubate with blots overnight at 4°C. Blots were again washed once for 15 min and twice for 5 min each with 1⫻TBST. Horseradish peroxidase (HRP)-conjugated goat anti-rat (Jackson ImmunoResearch Laboratories) or HRP-conjugated sheep anti-rabbit (New England Biolabs) secondary antibodies were diluted in 1⫻TBST to 1:10,000 and 1:5,000, respectively, and added to the appropriate blots for 30 min at room temperature. Blots were washed once for 15 min and four times for 5 min each with 1⫻TBST followed by detection with Western blotting Luminol reagent (Santa Cruz Biotechnology, Inc.) according to manufacturer’s recommendations; the blots were exposed to film.

Flow cytometry.Spleens were dissected from animals, homogenized between the frosted edges of two microscope slides, and suspended into 10 ml of ice-cold FACS (fluorescence-activated cell sorting) buffer (1⫻PBS, 10 mM HEPES, 1% fetal calf serum, 0.01% sodium azide). The femurs and tibia were dissected from mice, and the bone marrow was rinsed out into 15-ml tubes with a total of 10 ml of ice-cold serum-free RPMI 1640 (Gibco). Spleen samples were centrifuged at 1,500 rpm for 10 min, and supernatants were poured off. The splenic red blood cells were lysed in 5 ml of red blood cell lysis buffer (150 mM NH4Cl, 17 mM Tris

base [pH 7.2]) for 5 min and were then added to 5 ml of ice-cold FACS buffer through a nylon mesh. Following cell counting, samples were centrifuged at 1,500 rpm for 5 min, and cells were resuspended to 40⫻106_{/ml in ice-cold FACS}

buffer; 2⫻106_{cells per spleen stain or 4⫻10}6_{cells per bone marrow stain were}

used in 100␮l of antibody stains. Samples were incubated with 0.5␮g of Fc block (Pharmingen) per stain for 15 min at 4°C, followed by addition of staining antibodies for 30 min at 4°C in the dark. The following antibody dilutions were made in FACS buffer and used in various combinations to stain cells: IgM-fluorescein isothiocyanate (FITC) (1:60) and CD19-phycoerythrin (PE) (1:1,200). Following staining, samples were washed once in 2 ml of 1⫻PBS and

were routinely fixed in 1% paraformaldehyde–1⫻PBS at 4°C overnight in the dark. All antibodies were purchased from Pharmingen. Samples were run on a Becton Dickinson FACScan, and data were analyzed using CellQuest software.

Methylcellulose cultures.Bone marrow cells were collected in serum-free RPMI 1640 as outlined above, counted, centrifuged at 1,500 rpm for 10 min, and resuspended to 10⫻106_{/ml. A total of 2⫻10}6_{bone marrow cells were seeded}

in 3 ml of murine preB Methocult containing IL-7 (Stem Cell Technologies). Cells were vortexed for 30 s to evenly distribute cells in the methylcellulose and then evenly plated into two 60-mm-diameter dishes according to the manufac-turer’s recommendations. Cultures were grown for 7 days at 37°C in 5% CO2.

Colonies were photographed and scored for morphology and number before being harvested for use in flow cytometry and immunoblots.

RESULTS

Generation of LMP2A ITAM mutant transgenic mice.

The

E

␮

LMP2A Y(74/85)F mutant ITAM transgene was

con-structed as outlined in Materials and Methods, released from

the parent plasmid by digestion with

Sac

I and

Xho

I, purified,

and microinjected into (B6

⫻

CBA)F

1

mouse oocytes. From

these injections, 12 offspring were produced, 2 of which were

found to be transgenic by PCR (see Materials and Methods)

and designated Tg

⌬

ITAM1 and Tg

⌬

ITAM2.

[image:4.612.61.552.73.285.2]

Founder DNA was subjected to restriction enzyme and

se-quence analysis to determine whether the newly constructed

transgenic lines contained the proper mutated sequences. The

Y(74/85)F ITAM mutant LMP2A sequence contains an

engi-neered silent point mutation creating a unique

Kpn

I site in the

amino-terminal portion of the transgene (Fig. 1A), enabling

ITAM mutant founders to be distinguished from previously

described nonmutated LMP2A transgenic mice. Genomic tail

DNA from the Tg

⌬

ITAM1 founder, the Tg

⌬

ITAM2 founder,

an LMP2A transgenic line E (TgE) animal, and a wild-type

(WT) littermate control animal were subjected to PCR using

primers OL129 and OL131, amplifying the amino-terminal

portion of LMP2A containing the unique

Kpn

I site. Following

PCR amplification, the reactions were subjected to digestion

with

Kpn

I or an equivalent reaction with no enzyme. DNA

from both Tg

⌬

ITAM1 and Tg

⌬

ITAM2 produced PCR

prod-ucts of 370 bp, equal to those produced in nonmutated LMP2A

transgenic mice (Fig. 1B). When these products were digested

FIG. 3. Tg⌬ITAM1 and Tg⌬ITAM2 mice show no B-cell developmental defect. (A) Spleen (SP) tissues were immunostained with CD19-PE and IgM-FITC

antibodies; flow cytometry dot plots are shown. Two distinct cell types are highlighted with boxes, and the respective percentages of gated cells within those regions are denoted. (B) Bone marrow (BM) cells were immunostained as above; the boxes highlight pre-B and mature B cells, and the respective percentages within those regions are denoted.

on November 9, 2019 by guest

http://jvi.asm.org/

with

Kpn

I, only products from Tg

⌬

ITAM1 and Tg

⌬

ITAM2

were digested to produce two smaller products of 197 and 173

bp; PCR products from TgE remained undigested (Fig. 1B).

These data show that the Tg

⌬

ITAM1 and Tg

⌬

ITAM2 animals

contain the expected

Kpn

I site engineered into the transgene.

Sequence analysis of OL129-OL131 PCR products from each

line confirmed the presence of the expected sequence in each

line (data not shown).

LMP2A sequence was detected in

Bam

HI-digested genomic

tail DNAs from Tg

⌬

ITAM1, Tg

⌬

ITAM2, TgE, and WT

litter-mate control animals by Southern blot analysis (Fig. 1C). Each

transgenic sample hybridizes to LMP2A-specific bands,

indi-cating the presence of the transgenes in each line. These

hy-bridization patterns have been stable for over four generations

(data not shown).

LMP2A is expressed similarly in LMP2A ITAM mutant

transgenic lines and nonmutated LMP2A transgenic mice.

B-cell transgene expression was detected in Tg

⌬

ITAM1 and

Tg

⌬

ITAM2 splenocytes by immunoblot analysis. Whole spleen

lysates from age-matched 4- to 8-week-old Tg

⌬

ITAM1,

Tg

⌬

ITAM2, TgE, Tg6, and WT control animals were

immu-noblotted using an anti-LMP2A antibody (14B7-1-1) and an

antibody against the p85 subunit of PI-3K, to control for

load-ing. Tg

⌬

ITAM1 and Tg

⌬

ITAM2 express LMP2A to similar

levels as both TgE and Tg6 animals (Fig. 2). A higher

nonspe-cific band is consistently seen in all mouse samples tested but

not in the human LCL positive control lane, presumably due to

cross-reactivity of the secondary goat anti-rat HRP-labeled

antibody with mouse proteins. Blots were stripped and

immu-noblotted against PI-3K to show that protein loading was

roughly equivalent in all lanes. No obvious differences in onset

of transgene expression or in the general pattern described

above were observed when expression was tested in young

animals (data not shown).

LMP2A ITAM mutant transgenic mice display no B-cell

developmental alteration.

Spleen and bone marrow samples

from Tg

⌬

ITAM1 and Tg

⌬

ITAM2 were analyzed by flow

cy-tometry to determine whether LMP2A ITAM mutant mice

display a B-cell developmental phenotype similar to that seen

in previously described nonmutated LMP2A lines TgE and

Tg6. Spleen and bone marrow samples from each transgenic

line as well as WT littermate controls were analyzed by flow

cytometry for mouse sIgM (IgM-FITC) and the pan-B-cell

marker CD19 (CD19-PE) (Fig. 3). WT animals displayed

nor-mal levels of CD19

⫹

IgM

⫹

B cells in the spleen (52%) and

bone marrow (20%). In contrast, TgE animals displayed the

previously reported developmental alteration, characterized by

a severe reduction in the numbers of CD19

⫹

IgM

⫹

B cells in

the spleen (5%) and bone marrow (1%). Similarly, Tg6

ani-mals showed the previously reported phenotype of slight

de-creases in the numbers of CD19

⫹

, IgM

⫹

B-cell numbers in the

spleen (30%) and bone marrow (9%). Both Tg

⌬

ITAM1 and

Tg

⌬

ITAM2 mice displayed no B-cell developmental defects

and had no significant differences in the spleen (58 and 50%

versus 52%, respectively) or bone marrow (20 and 19% versus

20%, respectively) compared to WT littermate controls. No

defects were observable in any T-cell compartment in either

LMP2A

⌬

ITAM mutant or nonmutated LMP2A transgenic

mice (data not shown).

LMP2A ITAM mutant mice cannot support development or

survival in the RAG

ⴚ/ⴚ

background.

Previous reports have

divided LMP2A transgenic animals into E

␮

LMP2A

BCR⫺

and

E

␮

LMP2A

BCR⫹

classes (6, 7). E

␮

LMP2A

BCR⫺

transgenic

mice can be clearly distinguished by loss of IgM expression on

their B cells when analyzed by flow cytometry. However, the

E

␮

LMP2A

BCR⫹

transgenic B cells appear similar to their WT

littermate controls by the same analysis. When both classes of

LMP2A transgenics are bred into the RAG

⫺/⫺

background,

both have a readily observable phenotype. RAG

⫺/⫺

animals

are unable to rearrange Ig genes to form Ig, the key protein of

the BCR, thus blocking B-cell development at the pre-B cell

stage. This results in a complete absence of mature B cells in

RAG

⫺/⫺

animal bone marrow and peripheral lymphoid

or-gans. When bred into the RAG

⫺/⫺

background, both classes of

LMP2A transgenic animals generate a greater number of

CD19

⫹

B cells in the bone marrow and peripheral lymphoid

organs. These data indicate that LMP2A imparts a

develop-mental and survival signal in all classes of LMP2A transgenic

animals.

To determine whether the Tg

⌬

ITAM1 and Tg

⌬

ITAM2

pro-teins could provide B cells with developmental or survival

signals in the absence of RAG-1, both lines were bred into the

RAG

⫺/⫺

background. Spleen and bone marrow samples were

prepared from RAG

⫺/⫺

Tg

⌬

ITAM1, RAG

⫺/⫺

Tg

⌬

ITAM2,

RAG

⫺/⫺

TgE, RAG

⫺/⫺

Tg6, and RAG

⫺/⫺

control animals for

analysis by flow cytometry. Both RAG

⫺/⫺

TgE and RAG

⫺/⫺

Tg6 animals show enhanced survival of B cells, as indicated by

the accumulation of CD19

hi⫹

B cells in the spleen (25 and 2%,

respectively) as well as an increase in CD19 expression in the

bone marrow (Fig. 4). In contrast to these results, neither

RAG

⫺/⫺

Tg

⌬

ITAM1 nor RAG

⫺/⫺

Tg

⌬

ITAM2 animals show

any enhancement of CD19 expression or B-cell survival in

the spleen or bone marrow and are indistinguishable from

RAG

⫺/⫺

littermate controls.

LMP2A ITAM mutant transgenic bone marrow cells grow

comparably to WT littermate controls in methylcellulose

con-taining IL-7.

Growth of bone marrow cells in methylcellulose

medium containing IL-7 has allowed for an additional measure

of the developmental effect of LMP2A on B cells. When bone

marrow cells from Tg

⌬

ITAM1, Tg

⌬

ITAM2, TgE, Tg6, and

WT littermates were cultured for 7 days in methylcellulose

medium, each line produced B-cell colonies (Fig. 5A). Cells

collected from methylcellulose cultures from each transgenic

line were subjected to flow cytometry analysis (Fig. 5B). The

B-cell outgrowths from these cultures reflect the general trend

observed in bone marrow samples in vivo. TgE methylcellulose

cultures are predominantly (98%) CD19

⫹

IgM

⫺

, while Tg6

methylcellulose cultures show a slight reduction in the number

of CD19

⫹

IgM

⫹

cells (11% versus 30%) and an increase in the

number of CD19

⫹

IgM

⫺

(88% versus 68%) compared to WT

controls. In contrast, both Tg

⌬

ITAM1 and Tg

⌬

ITAM2

meth-ylcellulose cultures contain similar percentages of CD19

⫹

IgM

⫹

(31 and 26% versus 30%, respectively) and CD19

⫹

IgM

⫺

(65 and 70% versus 68%, respectively) cells compared to

WT cultures (Fig. 5B). The number of B-cell colonies formed

in each plate correlates with the strength of the developmental

and survival signal that LMP2A imparts. TgE bone marrow

produces nearly twice as many colonies on average (Student’s

t

test,

P

⫽

0.0017) compared to Tg

⌬

ITAM1, Tg

⌬

ITAM2, and

WT littermate controls (Fig. 5C). These data represent counts

collected from four separate experiments in which Tg6 bone

marrow was not cultured and is therefore not represented

in the graph. These results indicate that Tg

⌬

ITAM1 and

Tg

⌬

ITAM2 mutant LMP2A protein does not provide any

colony-forming enhancement signal as seen in nonmutated

LMP2A transgenic bone marrow when cultured in vitro.

In the RAG

ⴚ/ⴚ

background, the LMP2A ITAM mutant

transgene is unable to support development or survival of

bone marrow cells in methylcellulose.

When bone marrow

from any RAG

⫺/⫺

LMP2A transgenic mouse is cultured in

methylcellulose media, a substantial enhancement of

col-ony number can be observed (6, 7). Therefore, RAG

⫺/⫺

V

OL

. 74, 2000

LMP2A

⌬ITAM TRANSGENIC MICE

9119

on November 9, 2019 by guest

http://jvi.asm.org/

Tg

⌬

ITAM1, RAG

⫺/⫺

Tg

⌬

ITAM2, RAG

⫺/⫺

TgE, RAG

⫺/⫺

Tg6, and RAG

⫺/⫺

littermate control bone marrow samples

were cultured in IL-7-containing methylcellulose. As

ex-pected, both RAG

⫺/⫺

TgE and RAG

⫺/⫺

Tg6 bone marrow

cultures generated significant numbers of colonies in

methyl-cellulose (Fig. 5D). Both RAG

⫺/⫺

Tg

⌬

ITAM1 and RAG

⫺/⫺

Tg

⌬

ITAM2 did not form any significant numbers of colonies,

similar to their RAG

⫺/⫺

littermate control animals. Flow

cy-tometry analysis of recovered RAG

⫺/⫺

TgE and RAG

⫺/⫺

Tg6

bone marrow cells showed that nearly all were CD19

⫹

IgM

⫺

as

expected (data not shown). Too few cells were recovered from

RAG

⫺/⫺

Tg

⌬

ITAM1, RAG

⫺/⫺

Tg

⌬

ITAM2, and RAG

⫺/⫺

an-imals to determine surface marker phenotype. These results

show that Tg

⌬

ITAM1 and Tg

⌬

ITAM2 animals lack any

LMP2A-derived developmental or survival signal.

DISCUSSION

Both in vitro and in vivo systems have been used to

deter-mine the function of LMP2A in EBV latency. In vitro studies

using EBV-transformed LCLs have shown that LMP2A is

highly tyrosine phosphorylated and forms aggregates in the

plasma membrane of latently infected cells. Associated with

LMP2A are the Src family PTKs, the Syk PTK, and Nedd4

family ubiquitin ligases (24, 25, 37, 57). Of particular interest to

these studies is the specific association of the LMP2A ITAM

with the Syk PTK (24). In vitro, these LMP2A protein

com-plexes result in a complete block in BCR-mediated signal

transduction (24, 25, 57, 58). In vivo studies have provided

additional information into LMP2A function. In transgenic

mice, LMP2A provides both developmental and survival

sig-nals to B lymphocytes (6, 7).

This study was designed to determine the importance of the

LMP2A ITAM in the LMP2A-mediated developmental and

survival signal observed in the previously described LMP2A

transgenic mice (6, 7). Comparing ITAM defective LMP2A

transgenic mice with the previously constructed LMP2A

trans-genic lines, we demonstrate the importance of the LMP2A

ITAM in providing the LMP2A-mediated developmental and

survival signal. Previous studies have described two distinct

LMP2A transgenic phenotypes. Two of five genetically distinct

LMP2A lines have a dramatic phenotype (LMP2A

BCR⫺

)

char-acterized by the development and survival of B lymphocytes

lacking a BCR in an immunocompetent murine background

(7). Three other lines exhibit a more subtle phenotype

(LMP2A

BCR⫹

) when analyzed in an immunocompetent

back-ground. However, when all LMP2A transgenic animals are

bred into the RAG-null background, LMP2A allows for both

the developmental and survival of B lymphocytes in peripheral

immune organs (6, 7).

[image:6.612.60.547.70.294.2]

In this study, we analyzed two different LMP2A ITAM

mu-tant transgenic lines, both of which were unable to promote

B-cell development or survival in either an

immunocompe-tent or RAG-null background. Although it is possible that

these ITAM-defective LMP2A lines may not express enough

LMP2A to generate the previously characterized LMP2A

phe-notypes, this seems unlikely for two reasons. First, as

demon-strated, both ITAM-defective lines generated in this study

ex-press approximately equal levels of LMP2A protein in B

lymphocytes compared to the previously described LMP2A

transgenic lines. Second, of the five nonmutated LMP2A

trans-genic lines analyzed to date, all have the developmental and

survival phenotype when bred into the RAG-null background.

The requirement for an intact LMP2A ITAM to provide B

cells with a developmental and survival signal in vivo implicates

Syk as being a major target for LMP2A. Many studies have

demonstrated a vital role for Syk in B-cell development and

activation (13, 73, 76). Syk

⫺/⫺

mice display perinatal lethality,

indicating that Syk plays a vital role in organismal development

(13, 76). However, when irradiated WT mice are reconstituted

with fetal liver cells from Syk

⫺/⫺

mice, the reconstituted

lym-phoid cells exhibit a severe B-cell developmental phenotype.

These mice are characterized by a block of B-cell development

at the pro-B-to-pre-B cell transition, resulting in a lack of

FIG. 4. LMP2A ITAM mutant mice do not impart a survival signal to RAG⫺/⫺_{B cells. (A) Spleen (SP) tissues were immunostained with CD19-PE and IgM-FITC}

antibodies; flow cytometry dot plots are shown. Two distinct cell types are highlighted with boxes in the plots, and the respective percentages of gated cells within those

regions are denoted. (B) Bone marrow (BM) cells were immunostained as above; the boxed inset shows the percentage of CD19⫹_{cells arising in the bone marrow,}

and the respective percentages of gated cells within those regions are denoted.

on November 9, 2019 by guest

http://jvi.asm.org/

FIG. 5. LMP2A ITAM mutant bone marrow B cells grow similarly to WT cells in methylcellulose media and are incapable of enhancing survival or development of RAG ⫺ / ⫺ B cells. (A) Tg ⌬ ITAM1, Tg ⌬ ITAM2, WT, TgE, and Tg6 bone marrow cells were cultured in methylcellulose medium containing IL-7 for 7 days; pictures of typical resulting colonies are shown. (B) Methylcellulose-cultured bone marrow cells were immunostained with CD19-PE and IgM-FITC antibodies; flow cytometry dot plots are shown. Two distinct cell types are highlighted with boxes, and the respective percentages of gated cells within those regions are denoted. (C) The colonies arising in Tg ⌬ ITAM1, Tg ⌬ ITAM2, WT, and TgE bone marrow methylcellulose cultures were counted and plotted in a histogram. The increase in colony number seen in TgE bone marrow cultures is statistically significant (Student’s t test, P ⫽ 0.0017). (D) RAG ⫺ / ⫺ Tg ⌬ ITAM1, RAG ⫺ / ⫺ Tg ⌬ ITAM2, RAG ⫺ / ⫺ , RAG ⫺ / ⫺ TgE, and RAG ⫺ / ⫺ Tg6 bone marrow cells were cultured in methylcellulose medium containing IL-7 for 7 days; pictures of typical resulting colonies are shown.

V

OL

. 74, 2000

LMP2A

⌬ITAM TRANSGENIC MICE

9121

on November 9, 2019 by guest

http://jvi.asm.org/

mature B cells as well as a partial impairment of T-cell

devel-opment.

Syk has been firmly established as a critical factor for the

generation of both the Ca

2⫹

influx and mitogen-activated

pro-tein kinase (MAPK) signals that follow BCR cross-linking (for

reviews, see references 8, 41, and 42). For production of the

Ca

2⫹

response, Syk is critical for phosphorylation and

activa-tion of a number of downstream targets, including PI-3K,

BLNK, and phospholipase

␥

2 (PLC-

␥

2) (10, 26, 38, 73).

Following sIg cross-linking, Syk phosphorylates and activates

PI-3K, which initiates the production of biologically active

phos-phoinositides that act as second messengers (16, 21).

Interest-ingly, activation of PI-3K is also critical for activation of the

antiapoptotic protein Akt, which may be a target for LMP2A in

enhancing cell survival (17, 29). Btk associates with the PI-3K

product phosphatidylinositol-3,4,5-trisphosphate [PI(3,4,5)P

3

],

allowing for autophosphorylation and activation (47, 69, 78).

Phosphorylated BLNK has been shown to provide docking

sites for downstream signaling molecules, thus allowing

them to aggregate and become activated (26). BLNK binds

both activated Btk and PLC-

␥

2, thus allowing Btk and Syk to

phosphorylate and activate PLC-

␥

2 (19, 33, 38, 72). Once

ac-tivated, PLC-

␥

2 mediates the production of diacylglycerol and

inositol trisphosphate from the PI-3K product PI(4,5)P

2

(34).

Diacylglycerol is critical for activation of protein kinase C,

whereas inositol trisphosphate causes a release of Ca

2⫹

from

intracellular stores (56, 62). Influx of Ca

2⫹

leads to activation

of the calmodulin-dependent protein kinase II and the

calm-odulin-activated serine/theonine phosphatase calcineurin (70,

77). One of the factors activated by an influx of calcium is the

transcription factor NF-AT, which is important for

upregula-tion of a number of cytokines and immune effector molecules

(15, 79).

A more direct generation of MAPK signals by Syk

down-stream of the BCR has also been well established. BLNK

phosphorylation by Syk leads to binding of guanine nucleotide

exchange factors Vav and the Grb2 and Nck adapter proteins

through SH2-phosphotyrosine associations (26). Docking of

these effectors to BLNK allow for activation of the Ras and

Rac GTPases (5, 9, 18, 46). Phosphorylation cascades though

the ERK, JNK, and p38 arms of the MAPK pathways result in

activation of a number of transcription factors such as Fos, Jun,

and members of the Ets family (14, 30, 60, 75). Studies using

Syk-null DT40 chicken B cells have shown that Syk is critical

for activation of the ERK1 and JNK1 arms of the MAPK

family (39).

The LMP2A ITAM mutant mouse data suggest that LMP2A

may be manipulating Syk to direct the activation of a

MAPK-and/or a Ca

2⫹

-mediated signal in order to enhance B-cell

sur-vival and maintain latency. In so doing, LMP2A may be

mim-icking a constitutively active BCR or a docking protein, such as

BLNK, thus directing signals away from the actual BCR while

replacing the essential signals normally arising from a

func-tional BCR with LMP2A-derived survival signals. Future

stud-ies will map the pathways downstream of the LMP2A

ITAM-Syk interaction critical for LMP2A to block BCR signal

transduction and produce survival signals. Of particular

inter-est are pathways that lead to activation or upregulation of

antiapoptotic proteins such as Akt. Other signaling proteins

acting downstream of Syk that are important for B-cell

devel-opment, such as Btk and BLNK, also clearly warrant further

study using our transgenic mouse models. These studies should

provide a clearer understanding of the transmission of LMP2A

signals and how these signals affect B-cell development,

sur-vival, and EBV latency.

ACKNOWLEDGMENTS

R.L. is supported by Public Health Service grants CA62234 and

CA73507 from the National Cancer Institute and DE13127 from the

National Institute of Dental and Craniofacial Research. R.L. is a

Scholar of the Leukemia Society of America.

We are grateful for the contributions from members of the

Long-necker and Spear laboratories at Northwestern University.

REFERENCES

1.Babcock, G. J., L. L. Decker, M. Volk, and D. A. Thorley-Lawson.1998. EBV persistence in memory B cells in vivo. Immunity9:395–404.

2.Begin, L. R., J. Eskandari, J. Joncas, and L. Panasci.1987. Epstein-Barr virus related lymphoepithelioma-like carcinoma of lung. J. Surg. Oncol.

36:280–283.

3.Bonnet, M., J. M. Guinebretiere, E. Kremmer, V. Grunewald, E. Benhamou, G. Contesso, and I. Joab.1999. Detection of Epstein-Barr virus in invasive breast cancers. J. Natl. Cancer Inst.91:1376–1381.

4.Bouzid, M., D. Djennaoui, J. Dubreuil, A. Bouguermouh, D. Ellouz, J. Abdelwahab, G. Decaussin, and T. Ooka.1994. Epstein-Barr virus genotypes in NPC biopsies from North Africa. Int. J. Cancer56:468–473.

5.Buday, L., S. E. Egan, V. P. Rodriguez, D. A. Cantrell, and J. Downward.

1994. A complex of Grb2 adaptor protein, Sos exchange factor, and a 36-kDa membrane-bound tyrosine phosphoprotein is implicated in ras activation in T cells. J. Biol. Chem.269:9019–9023.

6.Caldwell, R. G., R. C. Brown, and R. Longnecker.2000. Epstein-Barr virus LMP2A-induced B-cell survival in two unique classes of E␮LMP2A trans-genic mice. J. Virol.74:1101–1113.

7.Caldwell, R. G., J. B. Wilson, S. J. Anderson, and R. Longnecker.1998. Epstein-Barr virus LMP2A drives B cell development and survival in the absence of normal B cell receptor signals. Immunity9:405–411.

8.Campbell, K. S.1999. Signal transduction from the B cell antigen-receptor. Curr. Opin. Immunol.11:256–264.

9.Cantrell, D.1998. Lymphocyte signalling: a coordinating role for Vav? Curr. Biol.8:R535–R538.

10. Carter, R. H., D. J. Park, S. G. Rhee, and D. T. Fearon.1991. Tyrosine phosphorylation of phospholipase C induced by membrane immunoglobulin in B lymphocytes. Proc. Natl. Acad. Sci. USA88:2745–2749.

11. Chan, J. K., T. T. Yip, W. Y. Tsang, Y. F. Poon, C. S. Wong, and V. W. Ma.

1994. Specific association of Epstein-Barr virus with lymphoepithelial carci-noma among tumors and tumorlike lesions of the salivary gland. Arch. Pathol. Lab. Med.118:994–997.

12. Chen, F., J. Z. Zou, and L. di Renzo.1995. A subpopulation of normal B cells latently infected with Epstein-Barr virus resembles Burkitt lymphoma cells in expressing EBNA-1 but not EBNA-2 or LMP1. J. Virol.69:3752–3758. 13. Cheng, A. M., B. Rowley, W. Pao, A. Hayday, J. B. Bolen, and T. Pawson.

1995. Syk tyrosine kinase required for mouse viability and B-cell develop-ment. Nature378:303–306.

14. Chiles, T. C., J. L. Liu, and T. L. Rothstein.1991. Cross-linking of surface Ig receptors on murine B lymphocytes stimulates the expression of nuclear tetradecanoyl phorbol acetate-response element-binding proteins. J. Immu-nol.146:1730–1735.

15. Choi, M., R. D. Brines, M. J. Holman, G. G. Klaus.1994. Induction of NF-AT in normal B lymphocytes by anti-immunoglobulin or CD40 ligand in conjunction with IL-4. Immunity1:179–187.

16. Corvera, S., and M. P. Czech.1998. Direct targets of phosphoinositide 3-kinase products in membrane traffic and signal transduction. Trends Cell Biol.8:442–446.

17. Craxton, A., A. Jiang, T. Kurosaki, and E. A. Clark.1999. Syk and Bruton’s tyrosine kinase are required for B cell antigen receptor-mediated activation of the kinase Akt. J. Biol. Chem.274:30644–30650.

18. Crespo, P., X. R. Bustelo, D. S. Aaronson, O. A. Coso, M. Lopez-Barahona, M. Barbacid, and J. S. Gutkind.1996. Rac-1 dependent stimulation of the JNK/SAPK signaling pathway by Vav. Oncogene13:455–460.

19. DeBell, K. E., B. A. Stoica, M. C. Veri, A. Di Baldassarre, S. Miscia, L. J. Graham, B. L. Rellahan, M. Ishiai, T. Kurosaki, and E. Bonvini.1999. Functional independence and interdependence of the Src homology domains of phospholipase C-␥1 in B-cell receptor signal transduction. Mol. Cell. Biol.

19:7388–7398.

20. Decker, L. L., L. D. Klaman, and D. A. Thorley-Lawson.1996. Detection of the latent form of Epstein-Barr virus DNA in the peripheral blood of healthy individuals. J. Virol.70:3286–3286.

21. Duronio, V., M. P. Scheid, and S. Ettinger.1998. Downstream signalling events regulated by phosphatidylinositol 3-kinase activity. Cell Signal.10:

233–233.

22. Fruehling, S., R. Caldwell, and R. Longnecker.1997. LMP2 function in EBV Latency. EBV Rep.4:141–159.

23. Fruehling, S., S. K. Lee, R. Herrold, B. Frech, G. Laux, E. Kremmer, F. A. Grasser, and R. Longnecker.1996. Identification of latent membrane pro-tein 2A (LMP2A) domains essential for the LMP2A dominant-negative effect on B-lymphocyte surface immunoglobulin signal transduction. J. Virol.

70:6216–6226.

on November 9, 2019 by guest

http://jvi.asm.org/

24.Fruehling, S., and R. Longnecker.1997. The immunoreceptor tyrosine-based activation motif of Epstein-Barr virus LMP2A is essential for blocking BCR-mediated signal transduction. Virology235:241–251.

25. Fruehling, S., R. Swart, K. M. Dolwick, E. Kremmer, and R. Longnecker.

1998. Tyrosine 112 of latent membrane protein 2A is essential for protein tyrosine kinase loading and regulation of Epstein-Barr virus latency. J. Virol.

72:7796–7806.

26. Fu, C., C. W. Turck, T. Kurosaki, and A. C. Chan.1998. BLNK: a central linker protein in B cell activation. Immunity9:93–103.

27. Fukayama, M., Y. Hayashi, Y. Iwasaki, J. Chong, T. Ooba, T. Takizawa, M. Koike, S. Mizutani, M. Miyaki, and K. Hirai.1994. Epstein-Barr virus-associated gastric carcinoma and Epstein-Barr virus infection of the stom-ach. Lab. Investig.71:73–81.

28. Ghaffari-Tabrizi, N., B. Bauer, A. Villunger, G. Baier-Bitterlich, A. Altman, G. Utermann, F. Uberall, and G. Baier.1999. Protein kinase C␪, a selective upstream regulator of JNK/SAPK and IL-2 promoter activation in Jurkat T cells. Eur. J. Immunol.29:132–142.

29. Gold, M., M. P. Scheid, L. Santos, M. Dang-Lawson, R. A. Roth, L. Mat-suuchi, V. Duronio, and D. L. Krebs.1999. The B cell antigen receptor activates the Akt (protein kinase B)/glycogen synthase kinase-3 signaling pathway via phosphatidylinositol 3-kinase. J. Immunol.163:1894–1905. 30. Grant, P. A., C. B. Thompson, and S. Pettersson. 1995. IgM

receptor-mediated transactivation of the IgH 3⬘enhancer couples a novel Elf-1-AP-1 protein complex to the developmental control of enhancer function. EMBO J.14:4501–4513.

31. Gulley, M. L., D. R. Pulitzer, P. A. Eagan, and B. G. Schneider.1996. Epstein-Barr virus infection is an early event in gastric carcinogenesis and is independent of bcl-2 expression and p53 accumulation. Hum. Pathol.27:20– 27.

32. Harn, H. J., L. I. Ho, W. H. Chung, J. J. Lin, H. S. Lee, and W. H. Lee.1995. Epstein-Barr virus-associated typical gastric carcinoma detected by in situ hybridization and polymerase chain reaction. J. Clin. Gastroenterol.20:253– 254.

33. Hashimoto, S., A. Iwamatsu, M. Ishiai, K. Okawa, T. Yamadori, M. Mat-sushita, Y. Baba, T. Kishimoto, T. Kurosaki, and S. Tsukada.1999. Identi-fication of the SH2 domain binding protein of Bruton’s tyrosine kinase as BLNK—functional significance of Btk-SH2 domain in B-cell antigen recep-tor-coupled calcium signaling. Blood94:2357–2364.

34. Hempel, W. M., R. C. Schatzman, and A. L. DeFranco. 1992. Tyrosine phosphorylation of phospholipase C-gamma 2 upon cross-linking of mem-brane Ig on murine B lymphocytes. J. Immunol.148:3021–3027.

35. Hitt, M. M., M. J. Allday, T. Hara, L. Karran, M. D. Jones, P. Busson, T. Tursz, I. Ernberg, and B. E. Griffin.1989. EBV gene expression in an NPC-related tumour. EMBO J.8:2639–2651.

36. Hogan, B., R. Beddington, F. Constantini, and E. Lacy.1994. Manipulating the mouse embryo, a laboratory manual, 2nd ed. Cold Spring Harbor Lab-oratory Press, Cold Spring Harbor, N.Y.

37. Ikeda, M., A. Ikeda, L. C. Longan, and R. Longnecker.2000. The Epstein-Barr virus (EBV) latent membrane protein 2A (LMP2A) PY motif recruits WW domain-containing ubiquitin-protein ligases. Virology268:178–191. 38. Ishiai, M., M. Kurosaki, R. Pappu, K. Okawa, I. Ronko, C. Fu, M. Shibata,

A. Iwamatsu, A. C. Chan, and T. Kurosaki.1999. BLNK required for cou-pling Syk to PLC gamma 2 and Rac1-JNK in B cells. Immunity10:117–125. 39. Jiang, A., A. Craxton, T. Kurosaki, E. A. Clark.1998. Different protein tyrosine kinases are required for B cell antigen receptor-mediated activation of extracellular signal-regulated kinase, c-Jun NH2-terminal kinase 1, and p38 mitogen-activated protein kinase. J. Exp. Med.188:1297–1306. 40. Kieff, E.1996. Epstein-Barr virus and its replication, p. 1109–1162.InB. N.

Fields, D. M. Knipe, and P. M. Howley (ed.), Fundamental virology, Lip-pincott-Raven, Philadelphia, Pa.

41. Kurosaki, T.1999. Genetic analysis of B cell antigen receptor signaling. Annu. Rev. Immunol.17:555–592.

42. Kurosaki, T.1998. Molecular dissection of B cell antigen receptor signaling. Bioorg. Med. Chem. Lett.1:515–527.

43. Labrecque, L. G., D. M. Barnes, I. S. Fentiman, and B. E. Griffin.1995. Epstein-Barr virus in epithelial cell tumors: a breast cancer study. Cancer Res.55:39–45.

44. Lam, K., R. Kuhn, and K. Rajewsky.1997. In vivo ablation of surface immunoglobulin on mature B cells by inducible gene targeting results in rapid cell death. Cell90:1073–1083.

45. Lanier, A. P., S. R. Clift, G. Bornkamm, W. Henle, H. Goepfert, and N. Raab Traub.1991. Epstein-Barr virus and malignant lymphoepithelial lesions of the salivary gland. Arctic Med. Res.50:55–61.

46. Li, N., A. Batzer, R. Daly, V. Yajnik, E. Skolnik, P. Chardin, S. D. Bar, B. Margolis, and J. Schlessinger.1993. Guanine-nucleotide-releasing factor hSos1 binds to Grb2 and links receptor tyrosine kinases to Ras signalling. Nature363:85–88.

47. Li, Z., M. I. Wahl, A. Eguinoa, L. R. Stephens, P. T. Hawkins, and O. N. Witte. 1997. Phosphatidylinositol 3-kinase-gamma activates Bruton’s ty-rosine kinase in concert with Src family kinases. Proc. Natl. Acad. Sci. USA

94:13820–13825.

48. Longnecker, R.1994. Biochemical and genetic studies of Epstein-Barr virus

latent membrane protein 2. Leukemia8:S46–S50.

49. Longnecker, R.1998. Molecular biology of Epstein-Barr virus, p. 133–172.In Dennis McCance (ed.), Human tumor viruses, American Society for Micro-biology, Washington, D.C.

50. Longnecker, R., B. Druker, T. M. Roberts, and E. Kieff.1991. An Epstein-Barr virus protein associated with cell growth transformation interacts with a tyrosine kinase. J. Virol.65:3681–3692.

51. Longnecker, R., and E. Kieff.1990. A second Epstein-Barr virus membrane protein (LMP2) is expressed in latent infection and colocalizes with LMP1. J. Virol.64:2319–2326.

52. Longnecker, R., and C. L. Miller.1996. Regulation of Epstein-Barr virus latency by latent membrane protein 2. Trends Microbiol.4:38–42. 53. Longnecker, R., C. L. Miller, X.-Q. Miao, A. Marchini, and E. Kieff.1992.

The only domain which distinguishes Epstein-Barr virus latent membrane 2A (LMP2A) from LMP2B is dispensable for lymphocyte infection and growth transformation in vitro, and LMP2A is therefore nonessential. J. Vi-rol.66:6461–6469.

54. Longnecker, R., C. L. Miller, X. Q. Miao, B. Tomkinson, and E. Kieff.1993. The last seven transmembrane and carboxy-terminal cytoplasmic domains of Epstein-Barr virus latent membrane protein 2 (LMP2) are dispensable for lymphocyte infection and growth transformation in vitro. J. Virol.67:2006– 2013.

55. Longnecker, R., C. L. Miller, B. Tomkinson, X. Q. Miao, and E. Kieff.1993. Deletion of DNA encoding the first five transmembrane domains of Epstein-Barr virus latent membrane proteins 2A and 2B. J. Virol.67:5068–5074. 56. McConnell, F. M., S. B. Shears, P. J. Lane, M. S. Scheibel, and E. A. Clark.

1992. Relationships between the degree of cross-linking of surface immuno-globulin and the associated inositol 1,4,5-trisphosphate and Ca2⫹_{signals in} human B cells. Biochem. J.284:447–455.

57. Miller, C. L., A. L. Burkhardt, J. H. Lee, B. Stealey, R. Longnecker, J. B. Bolen, and E. Kieff.1995. Integral membrane protein 2 of Epstein-Barr virus regulates reactivation from latency through dominant negative effects on protein-tyrosine kinases. Immunity2:155–166.

58. Miller, C. L., J. H. Lee, E. Kieff, and R. Longnecker.1994. An integral membrane protein (LMP2) blocks reactivation of Epstein-Barr virus from latency following surface immunoglobulin crosslinking. Proc. Natl. Acad. Sci. USA91:772–776.

59. Miller, C. L., R. Longnecker, and E. Kieff.1993. Epstein-Barr virus latent membrane protein 2A blocks calcium mobilization in B lymphocytes. J. Vi-rol.67:3087–3094.

60. Mittlestadt, P. R., and A. L. DeFranco.1993. Induction of early response genes by cross-linking membrane Ig on B lymphocytes. J. Immunol.150:

4822–4832.

61. Miyashita, E. M., B. Yang, G. J. Babcock, and D. A. Thorley-Lawson.1997. Identification of the site of Epstein-Barr virus persistence in vivo as a resting B cell. J. Virol.71:4882–4891.

62. Padeh, S., A. Levitzki, A. Gazit, G. B. Mills, and C. M. Roifman.1991. Activation of phospholipase C in human B cells is dependent on tyrosine phosphorylation. J. Clin. Investig.87:1114–1118.

63. Raab-Traub, N.1992. Epstein-Barr virus and nasopharyngeal carcinoma. Semin. Cancer Biol.3:297–307.

64. Raab-Traub, N., P. Rajadurai, K. Flynn, and A. P. Lanier.1991. Epstein-Barr virus infection in carcinoma of the salivary gland. J. Virol.65:7032– 7036.

65. Rickinson, A. B., and E. Kieff.1996. Epstein-Barr virus, p. 2397–446.InB. N. Fields, D. M. Knipe, and P. M. Howley (ed.), Fields virology. Lippincott-Raven Publishers, Philadelphia, Pa.

66. Riddler, S. A., M. C. Breinig, and J. L. McKnight.1994. Increased levels of circulating Epstein-Barr virus (EBV)-infected lymphocytes and decreased EBV nuclear antigen antibody responses are associated with the develop-ment of posttransplant lymphoproliferative disease in solid-organ transplant recipients. Blood84:972–984.

67. Sakata, N., H. Kawasome, N. Terada, P. Gerwins, G. L. Johnson, E. W. Gelfand.1999. Differential activation and regulation of mitogen-activated protein kinases through the antigen receptor and CD40 in human B cells. Eur. J. Immunol.29:2999–3008.

68. Sample, J., D. Liebowitz, and E. Kieff.1989. Two related Epstein-Barr virus membrane proteins are encoded by separate genes. J. Virol.63:933–937. 69. Scharenberg, A., and J. P. Kinet.1998. PtdIns-3,4,5-P3: a regulatory nexus

between tyrosine kinases and sustained calcium signals. Cell94:5–8. 70. Schreiber, S. L., and G. R. Crabtree.1992. The mechanism of action of

cyclosporin A and FK506. Immunol. Today13:136–142.

71. Sugihara, K., H. Reupke, A. Schmidt Westhausen, H. D. Pohle, H. R. Gelder-blom, and P. A. Reichart.1990. Negative staining EM for the detection of Epstein-Barr virus in oral hairy leukoplakia. J. Oral Pathol. Med.19:367– 370.

72. Takata, M., and T. Kurosaki.1996. A role for Bruton’s tyrosine kinase in B cell antigen receptor-mediated activation of phospholipase C-gamma 2. J. Exp. Med.184:31–40.

73. Takata, M., H. Sabe, A. Hata, T. Inazu, Y. Homma, T. Nukada, H. Yamamura, and T. Kurosaki.1994. Tyrosine kinases Lyn and Syk regulate B

V

OL

. 74, 2000

LMP2A

⌬ITAM TRANSGENIC MICE

9123

on November 9, 2019 by guest

http://jvi.asm.org/

cell receptor-coupled Ca2⫹_{mobilization through distinct pathways. EMBO} J.13:1341–1349.

74.Tierney, R. J., N. Steven, L. S. Young, and A. B. Rickinson.1994. Epstein-Barr virus latency in blood mononuclear cells: analysis of viral gene tran-scription during primary infection and in the carrier state. J. Virol.68:7374– 7385.

75.Tilzey, J. F., T. C. Chiles, and T. L. Rothstein.1991. Jun-B gene expression mediated by the surface immunoglobulin receptor of primary B lymphocytes. Biochem. Biophys. Res. Commun.175:77–83.

76.Turner, M., P. J. Mee, P. S. Costello, O. Williams, A. A. Price, L. P. Duddy, M. T. Furlong, R. L. Geahlen, and V. L. Tybulewicz.1995. Perinatal lethality and blocked B-cell development in mice lacking the tyrosine kinase Syk. Nature378:298–302.

77. Valentine, M. A., A. J. Czernik, N. Rachie, H. Hidaka, C. L. Fisher, J. C. Cambier, and K. Bomsztyk.1995. Anti-immunoglobulin M activates nuclear

calcium/calmodulin-dependent protein kinase II in human B lymphocytes. J. Exp. Med.182:1943–1949.

78. Varnai, P., K. I. Rother, and T. Balla.1999. Phosphatidylinositol 3-kinase-dependent membrane association of the Bruton’s tyrosine kinase pleckstrin homology domain visualized in single living cells. J. Biol. Chem.274:10983– 10989.

79. Venkataraman, L., D. A. Francis, Z. Wang, J. Liu, T. L. Rothstein, and R. Sen.1994. Cyclosporin-A sensitive induction of NF-AT in murine B cells. Immunity1:189–196.

80. Yates, J. L., N. Warren, and B. Sugden.1985. Stable replication of plasmids derived from Epstein-Barr virus in various mammalian cells. Nature313:

812–815.

81. Young, L., C. Alfieri, K. Hennessy, H. Evans, C. O’Hara, K. C. Anderson, J. Ritz, R. S. Shapiro, A. Rickinson, E. Kieff, and J. I. Cohen.1989. Expression of Epstein-Barr virus transformation-associated genes in tissues of patients with EBV lymphoproliferative disease. N. Engl. J. Med.321:1080–1085.

on November 9, 2019 by guest

http://jvi.asm.org/