Nucleic Acid Binding by Mason-Pfizer Monkey Virus CA Promotes Virus Assembly and Genome Packaging

Nucleic Acid Binding by Mason-Pfizer Monkey Virus CA Promotes

Virus Assembly and Genome Packaging

Tibor Füzik,aRu˚žena Píchalová,aFlorian K. M. Schur,dKarolína Strohalmová,bIvana Krˇížová,bRomana Hadravová,b Michaela Rumlová,b,cJohn A. G. Briggs,dPavel Ulbrich,aTomáš Rumla

Department of Biochemistry and Microbiology, University of Chemistry and Technology Prague, Prague, Czech Republica

; Institute of Organic Chemistry and Biochemistry IOCB Research Centre and Gilead Sciences, Academy of Sciences of the Czech Republic, Prague, Czech Republicb

; Department of Biotechnology, University of Chemistry and Technology Prague, Prague, Czech Republicc

; Structural and Computational Biology Unit and Molecular Medicine Partnership Unit, European Molecular Biology Laboratory, Heidelberg, Germanyd

ABSTRACT

The Gag polyprotein of retroviruses drives immature virus assembly by forming hexameric protein lattices. The assembly is

pri-marily mediated by protein-protein interactions between capsid (CA) domains and by interactions between nucleocapsid (NC)

domains and RNA. Specific interactions between NC and the viral RNA are required for genome packaging. Previously reported

cryoelectron microscopy analysis of immature Mason-Pfizer monkey virus (M-PMV) particles suggested that a basic region

(res-idues RKK) in CA may serve as an additional binding site for nucleic acids. Here, we have introduced mutations into the RKK

region in both bacterial and proviral M-PMV vectors and have assessed their impact on M-PMV assembly, structure, RNA

bind-ing, budding/release, nuclear traffickbind-ing, and infectivity using

in vitro

and

in vivo

systems. Our data indicate that the RKK

gion binds and structures nucleic acid that serves to promote virus particle assembly in the cytoplasm. Moreover, the RKK

re-gion appears to be important for recruitment of viral genomic RNA into Gag particles, and this function could be linked to

changes in nuclear trafficking. Together these observations suggest that in M-PMV, direct interactions between CA and nucleic

acid play important functions in the late stages of the viral life cycle.

IMPORTANCE

Assembly of retrovirus particles is driven by the Gag polyprotein, which can self-assemble to form virus particles and interact

with RNA to recruit the viral genome into the particles. Generally, the capsid domains of Gag contribute to essential

protein-protein interactions during assembly, while the nucleocapsid domain interacts with RNA. The interactions between the

nucleo-capsid domain and RNA are important both for identifying the genome and for self-assembly of Gag molecules. Here, we show

that a region of basic residues in the capsid protein of the betaretrovirus Mason-Pfizer monkey virus (M-PMV) contributes to

interaction of Gag with nucleic acid. This interaction appears to provide a critical scaffolding function that promotes assembly of

virus particles in the cytoplasm. It is also crucial for packaging the viral genome and thus for infectivity. These data indicate that,

surprisingly, interactions between the capsid domain and RNA play an important role in the assembly of M-PMV.

T

he retroviral structural polyprotein Gag contains three

con-served domains, matrix (MA), capsid (CA), and nucleocapsid

(NC). Gag plays the primary role in immature particle assembly

and viral genomic RNA (vRNA) recruitment and packaging.

Retroviruses assemble via two different morphogenetic

path-ways; the first, historically referred to as C-type, wherein particle

assembly occurs at the cell membrane, and the second, D-type,

assembling in perinuclear regions. The pathogenic human viruses,

HIV and human T-cell lymphotropic virus assemble via C-type

intermediates, whereas M-PMV is the prototypic D-type

retrovi-rus. The Gag polyprotein of M-PMV is first transported to an

intracytoplasmic pericentriolar site, where particle assembly

oc-curs (

1–3

). This targeting requires a cytoplasmic

targeting/reten-tion signal (CTRS) localized in the MA domain that mediates the

interaction of Gag with components of dynein to transport cargo

molecules toward the minus ends of the microtubules (

4

). After

assembly, the immature D-type particles are transported to the

plasma membrane, where budding occurs.

Gag nucleation and particle assembly is promoted by

interac-tions between CA domains and also by interacinterac-tions between NC

and both cellular and viral RNA. The importance of RNA for

assembly is well documented by

in vitro

assembly studies with

various retroviruses, e.g., Rous sarcoma virus (RSV), HIV, murine

leukemia virus (MLV), and M-PMV (

5–11

). Although cellular

RNA is sufficient to promote Gag assembly (

12

), formation of an

infectious retrovirus requires specific packaging of the viral

ge-nome (vRNA) into the assembling Gag particle. It is likely that the

initial recognition of the genomic nucleic acid is mediated by a few

Gag molecules that bring the vRNA to the assembly site (

13

). It has

been well documented both in HIV and in MLV that the selection

of vRNA for packaging into retroviral particles is mediated by

specific interaction between the highly structured

Psi

sequence at

Received22 December 2015Accepted15 February 2016

Accepted manuscript posted online24 February 2016

CitationFüzik T, Píchalová R, Schur FKM, Strohalmová K, Krˇížová I, Hadravová R,

Rumlová M, Briggs JAG, Ulbrich P, Ruml T. 2016. Nucleic acid binding by Mason-Pfizer monkey virus CA promotes virus assembly and genome packaging. J Virol 90:4593– 4603.doi:10.1128/JVI.03197-15.

Editor:W. I. Sundquist

Address correspondence to Pavel Ulbrich, [email protected], or Tomáš Ruml, [email protected].

Copyright © 2016, American Society for Microbiology. All Rights Reserved.

on November 7, 2019 by guest

http://jvi.asm.org/

the 5

=

-untranslated region of unspliced vRNA and zinc-finger

motifs of the NC protein (

14–17

). Nonspecific interactions

be-tween RNA and other Gag domains such as MA may also

contrib-ute to recognition (

18

,

19

).

The current understanding is that the site at which the initial

Gag-vRNA interaction occurs is different for different

retrovi-ruses. For HIV, vRNA is exported from the nucleus by the

trans-activating factor Rev and subsequently interacts with Gag in the

cytoplasm (

20

). In RSV, it has been proposed that the primary

Gag-vRNA interaction may occur in the nucleus. This is

sup-ported by several pieces of evidence, including the presence of two

nuclear localization signals in NC and MA recognized by different

importins (

21

) and the detection of a large amount of RSV Gag in

the nuclei of cells treated with leptomycin B (LMB) (

22

), a specific

inhibitor of the karyopherin CRM1 (chromosome region

mainte-nance 1 receptor) nuclear export pathway. An RSV Gag mutant

that bypasses the nucleus packages vRNA less efficiently than the

wild type (wt), and both nuclear trafficking and vRNA packaging

is restored by the insertion of a heterologous nuclear localization

signal (

23

,

24

). It has been suggested that the formation of the RSV

Gag-vRNA complex induces a conformational change of Gag,

which leads to the exposure of the nuclear export signal, a

leucine-rich region within p10 (

25

). However, whether nuclear Gag

trig-gers the export of the full-length RSV vRNA remains an open

question, since even Gag proteins that do not enter the nucleus

generated infectious particles (

22

). The feline immunodeficiency

virus (FIV) Gag protein cycles through the nuclei of both human

and feline cells, and it has been proposed that encapsidation of FIV

vRNA may also initiate in the nucleus (

26

).

In the case of M-PMV Gag, a small proportion of Gag was

observed in nuclei of LMB-treated cells (

22

), suggesting a possible

interaction of Gag with vRNA within the nucleus. However, the

M-PMV vRNA contains a stem-loop structural motif, termed the

constitutive transport element (CTE), which can mediate nuclear

export of incompletely spliced genomic RNA (

27

,

28

) through

recognition by a cellular factor called TAP, which specifically

binds the CTE (

29

). The mode of nuclear export and the site of

Gag-vRNA interaction therefore remain unclear.

We described previously the local and global organization and

arrangements of Gag in

in vitro-assembled immature particles of

representatives of three retroviral genera, namely, HIV, RSV, and

M-PMV, using cryoelectron tomography (

30

). N-terminal

do-mains of CA were arranged into hexameric rings around large

holes with the CA domains forming dimers beneath this layer. In

HIV and RSV, strong rod-like densities formed by the spacer

pep-tide descended toward the particle center along the 6-fold axis. In

contrast, M-PMV lacks the extended rod-like densities

contrib-uted by the spacer region in other retroviruses, and the disordered

NC-RNA region is closer to CA than in other retroviruses (

31–33

).

The CA domain of M-PMV contains a stretch of three basic

resi-dues (RKK) located very close to its C terminus. Two RKK regions

provided by two neighboring CA molecules form a basic patch on

the underside of the CA layer in immature Gag arrays. We

previ-ously proposed that these residues may interact with nucleic acid,

explaining the proximity of the nucleic acid layer and CA in

M-PMV (

30

). Structural studies of

in vitro-assembled M-PMV tubes

show the presence of an extended “nucleic acid-like” filament of

density in the vicinity of these residues, suggesting that an

orga-nized nucleic acid structure interacts with this motif (

31–33

).

Here, we have explored the effects of mutating the RKK to AAA or

GPG on assembly, nucleic acid incorporation, structure, and virus

production.

MATERIALS AND METHODS

Plasmids and viral constructs.All DNA manipulations were carried out according to standard subcloning techniques, and all plasmids were prop-agated inEscherichia coliDH5␣. All newly created DNA constructs were verified by DNA sequencing. Forin vitroassembly assays, the RKK muta-tions were introduced into pSIT⌬ProCANC M-PMV plasmid, which carries the gene for an M-PMV capsid and nucleocapsid fusion protein lacking the N-terminal proline (34) under the T7 promoter. The 201_RKK203_{to AAA or GPG mutations in pSIT⌬ProCANC M-PMV} were made by SLIM mutagenesis (35). To introduce mutations in the M-PMV proviral vector pSARM4 (36), we first used a helper vector (MHelppUC19) encoding M-PMV SacI-Eco72I fragment, which was prepared as described previously (37, 38). Mutations RKK/AAA and RKK/GPG were created by two-step PCR mutagenesis using primers car-rying appropriate mutations and suitable NotI and XmaI restriction sites, respectively. The obtained PCR products were digested with SacI-NotI/ NotI-Eco72I or SacI-XmaI/XmaI-Eco72I, and both fragments were li-gated into the MHelppUC19. After sequence verification, the mutated SacI-Eco72I fragments of the MHelppUC19, carrying the appropriate mutation, were inserted into pSARM4 or pSARM-EGFP. For the single-round infectivity assay, the M-PMV Env expression vector pTMO (39) and the pSARM-EGFP vector in which EGFP (enhanced green fluorescent protein) replaces theenvgene (40) were used. Further details of the clon-ing strategy and the full sequences of all PCR primers can be obtained from the authors upon request.

Cell growth and virus production.HEK 293T cells were grown in Dulbecco modified Eagle medium (DMEM; Sigma) supplemented with 10% fetal bovine serum (Gibco) and 1%L-glutamine (PAA Laboratories). Transfection of the HEK 293T cells was performed using FuGene HD transfection reagent (Roche Molecular Biochemicals) according to the manufacturer’s instructions. At 24 or 48 h posttransfection, virions in the culture media were harvested, filtered through a 0.45-␮m-pore-size filter, and centrifuged through a 20% sucrose cushion at 200,000⫻gfor 1 h in a Beckman SW41Ti rotor. M-PMV proteins were detected by Western blotting with a rabbit anti-M-PMV CA polyclonal antibody (41).

Bacterial expression and purification of⌬ProCANC, AAA, and GPG mutants.Luria-Bertani medium supplemented with ampicillin (100␮g/ ml) was inoculated with a 0.1% (vol/vol) overnight culture ofE. coli

BL21(DE3) carrying pSIT⌬ProCANC M-PMV or an AAA or a GPG mutant plasmid. The cells were cultivated at 37°C and 250 rpm until the culture reached the exponential growth phase (i.e., an optical density at 600 nm of 0.4 to 0.6). Protein expression was induced by the addition of 0.4 mM (final concentration) IPTG (isopropyl-␤-D -thiogalactopyrano-side). The cells were harvested at 4 h postinduction by centrifugation at 5,000⫻gand stored at⫺20°C.

The purification of the proteins was performed according to previ-ously published protocols (5,42). Briefly, a high-salt containing buffer extraction was used to solubilize and release the protein from the cell lysate pellet. The extracted protein was subsequently purified by immobi-lized metal affinity chromatography on a Zn2⫹_{-charged column, followed}

by ion-exchange chromatography on a phosphocellulose column, to re-move contaminating nucleic acids. Finally, the protein was dialyzed against storage buffer (50 mM phosphate, 500 mM NaCl, 1␮M ZnSO4, 0.05% mercaptoethanol [pH 7.5]), concentrated using ultrafiltration on Amicon Ultra-15 Ultracel 10K (Millipore, Ireland) concentrators to⬃1 mg/ml, and stored at⫺20°C. The protein concentration was determined by using a Bradford protein assay.

Analysis of VLP formation inE. coli.To determine whether the viral protein assembled inside the bacterial cells during the induced expression process, 1 ml of the cell culture at 4 h postinduction was pelleted, and the cells were resuspended in 350␮l of lysis buffer (50 mM Tris, 100 mM NaCl, 1% [wt/vol] octylthioglucoside, 1 mg/ml lysozyme [pH 8.0]). The

on November 7, 2019 by guest

http://jvi.asm.org/

suspension was incubated on a rotation mixer for 10 min at room tem-perature. Using this mild lysis process, the intact virus-like particles (VLPs) were released into the lysate and were subsequently analyzed using transmission electron microscopy (TEM) after negative staining.

In vitroassembly of purified⌬ProCANC proteins.Thein vitro as-sembly of purified wild-type and mutant⌬ProCANC M-PMV proteins was performed as previously described (5). Briefly, 60␮g of purified pro-tein in storage buffer was mixed with either MS2 phage genomic RNA or

␭phage genomic DNA at a 10:1 or 5:1 (wt/wt) ratio in 100␮l of total reaction volume. This mixture was dialyzed against the assembly buffer (50 mM Tris, 100 mM NaCl, 1␮M ZnSO₄[pH 8.0]) for 2 h at room temperature. When the effect of reducing conditions on the assembly process was studied, the assembly mixture contained 60 mM dithiothre-itol (DTT), and the concentration of DTT in the dialysis buffer was 20 mM.

Gradient centrifugation.Thein vitroparticle assembly efficiency was determined by gradient centrifugation, followed by sodium dodecyl sul-fate-polyacrylamide gel electrophoresis (SDS-PAGE). The dialyzed as-sembly mixture was loaded on top of 10 to 55% linear OptiPrep (Axis-Shield, Oslo, Norway) gradient and centrifuged for 40 min at 215,000⫻g. The gradient was fractionated, and the individual fractions were analyzed by SDS-PAGE (12% gel). The gels were blue silver stained (43) and digi-tized using Uvitec Alliance 4.7 (Uvitec, United Kingdom), and the assem-bly efficiency was assessed by densitometric analysis of the lanes using the Fiji (ImageJ) software package (44). The protein content in the topmost fraction of the gradient represented the unassembled protein, whereas the protein content in fractions with an OptiPrep density of around 1.15 to 1.27 g/ml (wt/vol), i.e., fractions 6 to 9, represented the assembled VLPs (5,6,45).

EMSA.For the electrophoretic mobility shift assay (EMSA), 5 or 1.7

␮g of studied protein was mixed with 165 ng of 1-kb DNA ladder (Pro-mega, USA) in 10␮l of total volume of buffered environment (25 mM Tris, 250 mM NaCl, 0.5␮M ZnSO4[pH 8.0]), corresponding to a protein/ nucleic acid ratios of 30:1 (wt/wt) and 10:1 (wt/wt), respectively. The EMSAs were performed under reducing conditions, where the sample reaction mixture contained 60 mM DTT. The samples were incubated 45 min at room temperature. To prove that the nucleic acid shift was caused by the protein nucleic acid interaction, an equivalent reaction mixture was treated with proteinase K (5␮g/reaction) for 45 min at 37°C. All of the samples were analyzed by agarose gel electrophoresis (1% gel) at 8 V/cm. The gels were stained by ethidium bromide and digitized by UVIdoc HD2 (Uvitec).

Protein expression, radioactive labeling, and quantification of par-ticle release.The HEK 293T cells transfected with the appropriate DNA construct were grown for 48 h posttransfection, starved for 30 min in methionine- and cysteine-deficient DMEM (Sigma), and then pulse-la-beled for 30 min with Tran35_{S-label (M.G.P., Czech Republic) at 125}

␮Ci/ml. The labeled cells were then chased in complete DMEM for 16 h. The cells from pulse and pulse-chase experiments were washed with phos-phate-buffered saline (PBS), lysed in 1 ml of lysis buffer (1% Triton X-100, 1% sodium deoxycholate, 0.05 M NaCl, 25 mM Tris [pH 8.0]) on ice for 30 min, and clarified by centrifugation at 14,000⫻gfor 2 min. The culture medium of the chased cells was filtered through a 0.45-␮ m-pore-size filter, and SDS was added to a final concentration of 0.1%. Viral proteins were immunoprecipitated from the cell lysates and culture media with a polyclonal rabbit anti-M-PMV CA antibody (1:1,000 dilution) and separated by SDS-PAGE. Radiolabeled proteins were visualized using a Typhoon 9410 phosphorimager (Amersham Biosciences).

To quantify the particle release, the radiolabeled protein bands of35 S-pulse-labeled Gag (Pr78) and pulse-chase-labeled virion-associated CA (p27) were quantified using ImageQuant TL (Amersham Biosciences). The released viral proteins are shown as relative concentrations of CA correlated to the levels of intracellular Gag in individual samples.

Single-round infectivity assay.Infectivity of M-PMV wt and CA-CTD mutants was determined as described earlier (37,46). Briefly, HEK

293T cells were cotransfected with either wt or RKK/AAA mutant pSARM-EGFP expression vector, together with the glycoprotein expres-sion vector pTMO. At 48 h posttransfection, the culture supernatants were collected and filtered through a 0.45-␮m-pore-size filter, and each sample was normalized for capsid protein content by quantitative West-ern blotting (37). The volume of culture supernatant used to infect HEK 293T cells was adjusted to 4 ml with complete DMEM, and the cells were incubated for an additional 48 h. The cells were fixed with 4% formalde-hyde, and the number of GFP-positive cells was determined using flow cytometry (BD FACSAria).

Viral RNA isolation and quantitative RT-PCR.Reverse transcrip-tion-PCR (RT-PCR) was performed as described previously (37). Briefly, the HEK 293T cells were transfected with wt or RKK/AAA mutant proviral construct. At 48 h posttransfection, the virus-containing medium was filtered and centrifuged, and the M-PMV CA content in the viral pellets was normalized by semiquantitative Western blot analysis. Encapsidated RNA was isolated using the QIAamp viral RNA minikit (Qiagen) accord-ing to the manufacturer’s instructions. The amount of isolated RNA was quantified by measuring theA260. To specifically quantitate the genomic RNA, RT using RevertAid H Minus M-MuLV reverse transcriptase (Fer-mentas) of isolated total RNA (of the CA-normalized amount) was per-formed. Subsequently, 2␮l of each RT product was used for real-time PCR using a Light Cycler 480 II Real-Time PCR system (Roche) and DyNAmo Hot Start SYBR green mix (Finnzymes). Three pairs of MPMV-CA derived primers—CA1ss (GTGGAATCTGTAGCGGACAA) and CA1as (ATTACCGGCTTGTTGGTTTC), CA2ss (GAAACCAACAA GCCGGTAAT) and CA2as (GAGCAAACAATCCTGGATCA), and CA3ss (TATTGGGCCCTCTTATCAGC) and CA3as GCAACACCCTCC TTTCTCTT—were used for each wt and RKK/AAA sample. Three con-trol samples containing (i) total RNA isolated from wt and RKK/AAA mutant, (ii) cDNA prepared from mock-infected cells, and (iii) water were used for real-time quantitative PCR. The viral genomic RNA content in individual samples was determined in three independent experiments. Nucleus isolation.HEK 293T cells transiently expressing the wild-type or RKK/AAA mutant M-PMV proviral constructs grown in 100-mm plastic dishes were incubated with leptomycin B (LMB; final concentra-tion, 20 nM) at 24 h posttransfection for 30, 60, and 120 min. The cells were then washed with PBS, and nuclear and cytosolic fractions were isolated using a Nuclei EZ Prep Nuclei Isolation kit (Sigma-Aldrich) ac-cording to the manufacturer’s protocol. Individual samples of total cell lysate, and nuclear and cytosolic fractions were then analyzed by Western blotting with the following antibodies: rabbit anti-M-PMV CA (the pres-ent study), rabbit anti-lamin A (L1293; Sigma-Aldrich), rabbit anti-cyclo-philin A (sc-20360; Santa Cruz), and monoclonal anti-␤-actin (clone AC-74; Sigma-Aldrich).

TEM sample preparation and analysis.HEK 293T cells transiently expressing the wild-type or mutant M-PMV proviral constructs grown in 100-mm plastic dishes were washed with PBS, scraped into a microtube, and prefixed with freshly prepared 2.5% glutaraldehyde in 0.1 M cacody-late buffer (pH 7.5). After a washing step with 0.1 M cacodycacody-late buffer (pH 7.5), the cells were postfixed in 1% osmium tetroxide, dehydrated in an ethanol series (30, 50, 70, 80, 90, and 100%), and embedded in fresh Agar 100 epoxy resin. Ultrathin sections (70 nm) of cells were cut with a dia-mond knife on a Leica UC6 ultramicrotome (Leica Microsystems, Wet-zlar, Germany). The thin sections were collected on Parlodion-coated microscopy grids and contrasted using saturated uranyl acetate and lead citrate. For each sample, we analyzed approximately 30 infected cells.

In vitro-assembled VLPs were deposited on carbon-coated copper grids for 3 to 6 min. The grid was washed twice on a drop of deionized water for 20 s and stained with sodium silicotungstic acid (4%, pH 7.4) for 30 s. The excess stain was wicked off using a filtration paper, and the samples were dried in air and analyzed using a JEM-1010 transmission electron microscope (Jeol, Japan) operated at 80 kV and equipped with a Megaview III CCD (charge-coupled device) camera. The images were processed using the AnalySIS software suit (Olympus, Japan).

on November 7, 2019 by guest

http://jvi.asm.org/

Cryoelectron tomography and subtomogram averaging.In vitro -as-sembled mutant⌬ProCANC M-PMV RKK/AAA was diluted in PBS con-taining 10-nm colloidal gold and transferred to glow-discharged C-Flat 2/2 Holey carbon grids in a high-humidity chamber. Cryogrid prepara-tion was performed using a manual plunging device (EMBL, Heidelberg, Germany). Grids were blotted from the back, frozen in liquid ethane, and then stored under liquid nitrogen conditions until imaging.

Data acquisition and image processing were performed as previously described (32). In brief, tilt series were imaged on a FEI Titan Krios elec-tron microscope operated at 200 keV, with a GIF2002 post-column energy filter (using a slit width of 20 eV) and a 2k⫻2k Gatan Multiscan 795 CCD camera. Low-magnification montages for search and navigation were ac-quired using SerialEM (47). Tilt series were then acquired at appropriate positions using FEI tomography software version 4 in automated batch mode. The nominal magnification was 33,000, giving a calibrated pixel size of 2.87 Å. The tilt range was from⫺45° to⫹60° in 3° steps, collecting first from 0° to⫺45° and then from 3° to 60°, with a total dose of⬃40 e Å⫺2_{being applied to each tilt series. Defoci ranged between⫺1.5 and}

⫺3.5␮m. Tomograms were reconstructed using the IMOD software suite (48).

Subtomogram averaging was performed as described previously (32) using MATLAB scripts derived from the TOM (49) and AV3 (50) pack-ages. The Dynamo software package was used for generation of masks and for FSC (Fourier shell correlation) calculations (51). Initial alignment was performed on 3⫻binned data. Processing was carried out entirely inde-pendent for two half data sets. Each half data set contained roughly the same number of tubes and an equal distribution of defoci. To obtain an initial structure, one tomogram with a defocus of⫺3.5␮m was chosen for each half-data set. Extracted subtomograms from this tomogram were assigned initial angles based only upon the geometry of the tubes and were averaged to generate a smooth starting reference. The subtomograms from this tomogram were then iteratively aligned and averaged in six dimensions against the reference as described previously (50). After the structure stabilized it was used as starting reference for its respective half-data set. Subsequently, all subtomograms within each half-half-data set were aligned and averaged against their respective independent starting refer-ence for six iterations. After the first two iterations, a cross-correlation-based cleaning was performed to remove subtomograms that contained no density corresponding to the M-PMV⌬ProCANC protein layer. No symmetry was applied in the alignments performed with binned, non-CTF-corrected data.

The defocus of each tomogram was measured by fitting theoretical contrast transfer function (CTF) curves to averaged power spectra from 512 square pixel tiles generated from all images in a tilt series using MATLAB scripts. CTF correction was performed using the program “CTF phase flip” implemented in IMOD (52).

Subvolumes with a size of 310 Å3_{were extracted from unbinned,} CTF-corrected tomograms at the positions determined in the 3⫻binned

align-ments. The subtomograms were subjected to two further alignment iter-ations in which an additional 2-fold symmetry was applied. The two final references were aligned, averaged, and multiplied with a Gaussian filtered mask. Subsequent comparison of the two final references (averaged from 52,566 and 53,038 asymmetric units in each of the half-data sets, respec-tively) by FSC indicated a resolution of 10.9 Å. The final structure was sharpened applying a negative B-factor of⫺1,500 Å2_{, while filtering to the} resolution determined at the 0.143 FSC threshold. The wt M-PMV

⌬ProCANC tube structure used for comparison was EMD-2089 (31). Visualization of tomograms or electron microscopy density maps was performed using either IMOD (48), UCSF chimera (53), or Amira4 (FEI Visualization Sciences Group) with the electron microscopy toolbox (54).

RESULTS

To study the role of the basic RKK region, we prepared mutants in

which the RKK amino acids were replaced either by a triple alanine

(RKK/AAA mutant), or by a GPG (RKK/GPG mutant) sequence.

The reason for selecting the latter mutation was that in HIV-1 CA

the GPG sequence is located at a position corresponding to that of

RKK in M-PMV and thus could have the same functional role.

The RKK/AAA and RKK/GPG mutations were introduced into

both bacterial expression and M-PMV proviral vectors.

Mutation of the RKK region influences assembly

in vitro

.

We

first used a bacterial system to study the role of the RKK basic

region in the assembly of immature particles. The RKK/AAA and

RKK/GPG mutations were introduced into truncated M-PMV

Gag (

⌬

ProCANC), and its ability to assemble in bacterial cells was

assessed using TEM. In contrast to wt

⌬

ProCANC protein that

forms tubular and spherical VLPs in

E. coli

cells, none of the RKK

mutant proteins formed any particles, indicating that the RKK

sequence is important for the assembly of VLPs in bacterial cells.

We next purified the expressed proteins and studied their

abil-ity to assemble into VLPs

in vitro

using TEM. Our previous results

showed that the wt

⌬

ProCANC of M-PMV could form

in vitro

either spherical (

5

) or tubular (

31

) particles, depending on the

assembly conditions. The RKK/GPG

⌬

ProCANC mutant protein

did not assemble into any particles

in vitro

under any assembly

conditions tried (see Materials and Methods). In the presence of

␭

phage DNA at reducing conditions, the RKK/AAA mutant of

⌬

ProCANC protein formed tubular VLPs that were similar to

those formed by the wt protein (

Fig. 1

) but were typically longer

(up to several microns) than those of the wt protein. This mutant

assembled also in the presence of MS2 phage RNA, although at

both reducing and nonreducing conditions it formed only a few

regular spherical particles (as seen in

Fig. 2C

), alongside fragments

D

C

B

A

wt

AAA

FIG 1TEM analysis of negatively stainedin vitroassembled M-PMV particles. wt⌬ProCANC (A and B) and RKK/AAA mutant⌬ProCANC (C and D) particles assembledin vitrounder reducing conditions in the presence of␭phage DNA. Scale bars: A and C, 2␮m; B and D, 100 nm.

on November 7, 2019 by guest

http://jvi.asm.org/

of particles and aggregated protein. Particle assembly was

depen-dent on the presence of nucleic acid, an observation consistent

with our previous finding that the efficiency of wt

⌬

ProCANC

VLP assembly is significantly facilitated by the presence of nucleic

acids (

5

).

To assess the efficiency of

in vitro

VLP assembly, we performed

OptiPrep gradient ultracentrifugation of particles assembled

un-der reducing conditions from both wt and mutant

⌬

ProCANC

proteins in the presence of either MS2 RNA or

␭

phage DNA,

followed by SDS-PAGE analysis of individual fractions and by

densitometric analysis of the bands (

Fig. 2

). All VLPs assembly

reactions, together with ultracentrifugations and protein

quanti-tation analyses, were performed in triplicate from independent

protein isolations. Independent of the type of added nucleic acid,

the

in vitro

assembly of wt

⌬

ProCANC protein proceeded

effi-ciently. The proportion of the assembled protein ranged between

ca. 60% and ca. 50% in the presence MS2 RNA and

␭

DNA,

re-spectively (

Fig. 2A

). For the RKK/GPG mutant, for which no

par-ticles were observed by TEM, the assembly efficiency was

negligi-ble, and no visible bands corresponding to assembled particles

were observed in the SDS-PAGE gel. The yield of the RKK/AAA

mutant particles was significantly lower than that of wild type

under both conditions (i.e., with MS2 RNA or

␭

DNA) and, unlike

the wild-type particles, it was more dependent on the amount of

nucleic acid added. Increasing the amount of MS2 RNA in the

assembly mixture from 6 to 12

␮

g enhanced the VLP assembly

efficiency of RKK/AAA mutant from 6.4% to 21% while the wt

protein assembled most efficiently when 6

␮

g of MS2 RNA was

added (

Fig. 2A

). On the other hand, increased concentration of

the

␭

DNA slightly reduced the assembly efficiency of the RKK/

AAA mutant from ca. 21%

⫾

1% to ca. 16%

⫾

2% (

Fig. 2A

),

which presumably reflects the redistribution of particles in the

gradient as a result of aggregation. We inspected the gradient

frac-tions using TEM to confirm the presence of assembled particles in

the relevant fractions (

Fig. 2B

to

E

). As expected, spherical or

tubular assembled particles were observed in fractions 6 to 9.

Structure of

in vitro

-assembled RKK/AAA VLPs.

We next

assessed whether the RKK/AAA mutation affects the structure of

the assembled tubular particles.

⌬

ProCANC M-PMV RKK/AAA

tubes assembled

in vitro

under reducing conditions in the

pres-ence of

␭

DNA were subjected to cryoelectron tomography.

Con-sistent with the negative-stain electron microscopy results, long

tubular arrays were observed (

Fig. 3A

). Along the surface of the

tubes hexagonal patches were visible, similar to those observed in

cryoelectron tomograms of wt

⌬

ProCANC tubes (

32

). We

per-formed subtomogram averaging and obtained an

⬃

11-Å

resolu-tion structure (

Fig. 3B

). We compared the mutant structure with

the available wt

⌬

ProCANC tube structure (

31

). No differences

were seen in the capsid region (

Fig. 3B

), indicating that the RKK/

AAA mutation does not influence the tertiary or quaternary

struc-ture of the capsid domains. Differences were observed in the

re-gion underlying the C-terminal part of capsid (

Fig. 3B

and

C

),

where the nucleocapsid and nucleic acids are located. Here, the

RKK/AAA mutant lacks a filamentous density that was present in

the wt tube (

Fig. 3B

, yellow). The dimensions of this density are

approximately that of a nucleic acid double helix. We previously

suggested that this density was nucleic acid recruited by the RKK

motif in M-PMV that is not present in the HIV CA sequence nor

in the cryoelectron microscopy structure (

30

,

31

). The absence of

this structure in the RKK/AAA mutant strongly supports this

hy-pothesis.

The RKK region plays role in nucleic acid binding.

The

ob-servations presented so far suggest a role for the RKK basic region

in binding of nucleic acids. To investigate whether the RKK/GPG

and RKK/AAA mutations alter nucleic acid binding, we mixed the

studied proteins with a 1-kb DNA ladder in two different ratios

(protein/DNA ratios of 30:1 [wt/wt] and 10:1 [wt/wt]) and

per-formed an EMSA. The ratios of protein to nucleic acid were based

on the optimization of reaction conditions, where the DNA was

bound efficiently to wt and mutant protein. None of the tested

proteins (wt, RKK/AAA, or RKK/GPG) showed any traces of

con-taminating nucleic acids (

Fig. 4

, lanes PC), and no shifts were

observed when the equivalent reaction mixtures were also treated

with proteinase K (

Fig. 4

, lane Pr), indicating that any observed

shifts are caused exclusively by the interaction of the protein with

added nucleic acid. At a protein/DNA ratio of 30:1 the wt protein

1 2 3 4 5 6 7 8 9 10 11 12

15% 55%

12 μg

61±5%

6 μg

64±4%

6 μg

6±4%

12 μg

21±5%

12 μg

47±5%

6 μg

50±7%

6 μg

21±1%

12 μg

16±2%

wt unassembled 0%

λ DNA

MS2 RNA

wt

AAA

wt

AAA

A

B

C

D

E

FIG 2SDS-PAGE and TEM analysis of OptiPrep gradient fractions. (A) A dialyzed assembly mixture was ultracentrifuged through a 15 to 55% OptiPrep equilibrium gradient, and collected fractions were analyzed by SDS-PAGE. The amount of proteins in the lanes was assessed densitometrically. The percentage (means with standard deviations,n⫽3) represents the relative amounts of wt and RKK/AAA mutant proteins assembled into particles (fractions 6 to 9) in the presence of either MS2 phage RNA or␭phage DNA. (B, C, D, and E) TEM analysis of OptiPrep gradient fractions 7 containing wt and RKK/AAA mutant protein particles assembled in the presence of 12␮g of MS2 RNA (B and C, respectively) and wt and RKK/AAA mutant protein particles assembled in the presence of 6

␮g of␭DNA (D and E, respectively). Scale bars, 100 nm.

on November 7, 2019 by guest

http://jvi.asm.org/

quantitatively bound DNA content from the reaction mixture

(

Fig. 4

, left panel, wt lane P), whereas at a protein/DNA ratio of

10:1 some DNA was not bound by the protein and remained free

in the solution (

Fig. 4

, right panel, wt, lane P). The RKK/AAA and

RKK/GPG mutants showed a much lower ability to bind DNA at

both ratios (

Fig. 4

, AAA and GPG, lanes P), the reduction was

particularly severe for the RKK/GPG mutant. The

higher-molec-ular-weight fragments from the 1-kb ladder showed greater

reten-tion than those of the lower-molecular-weight fragments

(com-pare

Fig. 4

, lanes P). The EMSA indicates that mutations in the

RKK region indeed lead to reduced DNA binding that correlates

with a reduced efficiency of particle assembly.

The RKK region regulates the efficiency of intracytoplasmic

particle assembly.

To investigate whether the effect of mutations

in the RKK region on nucleic acid binding and particle assembly

observed

in vitro

are reflected in changes in the viral life cycle, HEK

293T cells were transfected with proviral wt pSARM4 plasmid and

the corresponding RKK/AAA and RKK/GPG mutants.

Transfec-tion with all of the constructs led to the expression of similar

amounts of Gag, Gag-Pro, and Gag-Pro-Pol polyproteins,

indi-cating that the level of expression was not affected by the

muta-tions (

Fig. 5A

). At 48 h posttransfection, the expression and

processing of the wt and mutant M-PMVs were assessed by

pulse-chase assay and Western blot analysis of transfected cells.

We measured the amount of protein in the supernatant (after a

16-h chase) relative to the amount of cell-associated proteins

(be-fore chase) in order to estimate the amount of virus released (

Fig.

5C

). The efficiency of release for the RKK/AAA mutant was only

ca. 45% that of the wt. Both the wt and the RKK/AAA virions

contained processed CA protein, indicating that proteolytic

pro-cessing of capsid was not affected by the RKK/AAA mutation (

Fig.

5B

). In the RKK/GPG mutant the ratio of CA protein detected in

the medium was

⬍

20% that of the wt.

To analyze the assembly pathway of the virions, we performed

TEM analysis of thin sections of transfected HEK 293T cells (

Fig.

6

). We inspected about 30 infected cells of each wt or mutant

viruses and semiquantitatively assessed the virus particle

morpho-genetic types. Transfection with wt M-PMV gives rise to large

numbers of intracellularly assembled D-type particles in the

peri-centriolar region. We counted approximately 100 intracellular

FIG 3Cryoelectron tomography and subtomogram averaging analysis of M-PMV⌬ProCANC RKK/AAA tubes. (A, left) Slice through a cryoelec-tron tomogram containing a⌬ProCANC RKK/AAA tube. The protein den-sity is black. Scale bar, 50 nm. (A, right) Corresponding subtomogram averaging output lattice map to the tube represented in panel A. Hexagons are placed on the positions determined during alignment, resolving the orientations of the hexameric unit cells of the proteins along the tube. Hexagon colors denote cross-correlation of the respective subtomogram with the reference (green, high; red, low). (B) Comparison of the structures in wt⌬ProCANC (left) (EMD-2089) and ⌬ProCANC RKK/AAA tubes (right). Isosurface representations of the two structures, both filtered to 11 Å, are shown from the outside (top), from a horizontal view (middle), and from the inside of the tube (bottom). The filamentous densities present only in wt tubes are colored yellow. Yellow asterisks mark the approximate positions of the RKK sequences in the central hexamer. Scale bar, 50 Å. (C) Slices through the electron density, indicating the positions of the protein domains in an orientation corresponding to the middle panel in panel B. The protein density is white.

1kbPC P Prwt PC P PrAAA PC P PrGPG 30 : 1

1kbPC P Prwt PCAAAP PrPC P PrGPG 10 : 1

250 500 750 1000 1500 2000 3000 10 000 5000 bp

FIG 4EMSA results for wt⌬ProCANC and RKK/AAA and RKK/GPG mutant proteins. The EMSAs were performed at 30:1 (wt/wt) and 10:1 (wt/wt) pro-tein/DNA ratios under reducing conditions. PC, protein control (no nucleic acid added); 1kb, 1-kbp DNA ladder; P, protein-DNA interaction mixture; Pr, Proteinase K-treated protein-DNA interaction mixture.

on November 7, 2019 by guest

http://jvi.asm.org/

particles which were exclusively D-type. In the case of the RKK/

AAA mutant, we observed not only D-type pericentriolar

assem-bly but also a considerable amount of particles assembling at the

plasma membrane (C-type assembly) (

Fig. 6B

and

C

,

respec-tively). In 30 cells we counted 58 intracellular D-type particles and

29 partially assembled C-type particles budding from the plasma

membrane. The intracellular RKK/AAA M-PMV particles had a

spherical shape similar to that of the wt M-PMV (compare

Fig. 6A

and

B

). Released virions were also observed. The GPG mutant

failed to form immature particles inside the cells; however, a large

amount of electron-dense material (presumably Gag)

accumu-lated underneath the cell plasma membrane (

Fig. 6D

) (

55

). This

compact layer on the membrane did not form any released virus

particles or budding structures. Based on this analysis (see further

discussion below), we concluded that the CA protein detected in

the medium of the RKK/GPG mutant most likely represents free

protein and not virus particles.

The infectivity of the released particles was tested by

single-round infectivity assay (

Fig. 7A

). The infectivity of the RKK

mu-tants was below the detection limit (

⬍

1%) compared to that of the

wt M-PMV, indicating that the mutation affected some key step of

the infectivity process.

The above-mentioned results of particle release and TEM

anal-ysis (

Fig. 5C

and

6

, respectively) indicate that mutation of the RKK

motif leads to a reduction in particle release efficiency and to a

partial relocalization of the assembly site from the pericentriolar

region to the plasma membrane. The mutant particles are released

from the cells but show severely abolished infectivity.

The RKK region is important for genomic RNA

incorpora-tion.

To assess whether mutation of the RKK motif influences

nucleic acid incorporation in infected cells, we determined the

total RNA and the genomic RNA content of the released particles.

We found that the total amounts of RNA (measured

spectropho-tometrically at

A

) incorporated into the mutant and wt virions

were comparable (wt [100%

⫾

5%] and RKK/AAA mutant [118%

⫾

18%]). To quantify genomic RNA incorporated into released

M-PMV particles, the isolated total RNA from the wt and RKK/AAA

mutant was reverse transcribed and analyzed by real-time qPCR

using three various CA-specific primer pairs. No positive signals

(i.e., threshold cycle [C

]

⬎

38) were determined in the control

samples in which cDNA isolated from mock-infected HEK 293T

cells, isolated total RNA, or water were used as a template for

real-time quantitative PCR. Surprisingly, significant differences

between the RKK/AAA mutant and the wt particles were observed

by specific quantification (quantitative RT-PCR) of the genomic

RNA (

Fig. 7B

). The RKK/AAA mutant particles contained only

mock wt AAA GPG mock wt AAA GPG

CA Gag

Gag-P ro Gag-P

ro-P ol

pulse cells chase virions

A

B

C

FIG 5Synthesis, release, and processing of M-PMV wild-type and RKK mutants. The HEK 293T cells were transfected with wt, RKK/AAA, and RKK/GPG mutant proviral DNAs. Viral proteins were metabolically labeled with [35_{S]cysteine-methionine mix for 30 min and then chased for 16 h. (A) M-PMV CA}

(p27)-related polyproteins Gag (Pr78), Gag-Pro (Pr95), and Gag-Pro-Pol (Pr180) were then immunoprecipitated from the cells by rabbit anti-M-PMV CA antibody, separated by SDS-PAGE, and analyzed by using a Typhoon phosphorimager. (B) Released M-PMV CA (p27) was immunoprecipitated from the culture medium by rabbit anti-M-PMV CA antibody at 16 h after the chase, separated by SDS-PAGE, and analyzed by using a Typhoon phosphorimager. (C) Quantification of M-PMV wt and RKK mutants release. The band intensities of35_{S-pulse-labeled Gag (Pr78) and released CA (p27) were calculated. The relative}

percentage of CA released into the culture media was corrected for intracellular expression of individual samples. The released viral proteins are shown as the average relative concentration of CA correlated to the level of intracellular Gag in individual samples. Error bars represent standard errors of the mean calculated from two independent experiments.

A

wt

C

AAA

D

GPG

B

AAA

FIG 6TEM analysis of thin sections of M-PMV-infected HEK 293T cells. (A) wt virus. The virus assembled inside the cytoplasm (D-type particles). (B and C) RKK/AAA mutant. The particles were assembled in the cytoplasm (D-type) and also on the cell membrane (C-type); the particles are marked with arrows. (D) RKK/GPG mutant. Large amounts of protein, presumably Gag, accumu-lated at the cell membrane (indicated by arrows). Scale bars, 200 nm.

on November 7, 2019 by guest

http://jvi.asm.org/

about 9% (

⫾

1.5%) of genomic RNA in comparison to the wt. The

data represent three independent transfections, where the wt

val-ues were arbitrarily assigned as 100%.

The RKK region influences nuclear trafficking of Gag.

It was

previously observed that mutation of basic amino acid patches in

the pp24 domain of M-PMV Gag affects its localization to nuclear

pores (

56

). We therefore next assessed whether the genome

pack-aging defect observed in the RKK/AAA mutant might also relate to

altered nuclear trafficking of Gag. To delay fast export of proteins

from the nucleus, we treated the cells at 24 h posttransfection with

LMB. This inhibitor of CRM1-dependent nuclear export was

se-lected because it was suggested to affect M-PMV Gag exit from the

nucleus (

22

). Analysis of LMB-treated cells thus should reveal

even transient presence of Gag inside the nuclei. Nuclear and

cy-tosolic fractions of cells transfected with wt or RKK/AAA mutant

M-PMV vector were analyzed for the presence of Gag (

Fig. 8

).

The level of wt M-PMV Gag in the nuclear fractions gradually

increased with increasing length of LMB treatment over a 120-min

time frame. For the RKK/AAA mutant, the initial amount of Gag

in the nucleus was notably higher than for the wt but did not

increase during longer incubations. These results are consistent

with a reduced rate of nuclear export for the RKK/AAA mutant of

Gag. A reduced export rate would lead to increased

accumula-tion of RKK/AAA Gag during the 24-h period of

posttransfec-tion before LMB treatment. Upon reaching saturaposttransfec-tion, no

in-crease in nuclear RKK/AAA was observed when export was

inhibited by LMB.

Another remarkable observation is the difference in the

pres-ence of the wt and RKK/AAA mutant CA proteins inside the cell

nucleus (

Fig. 8

). Although nuclear localization is not surprising

for the wt CA protein since it was also reported for the HIV-1 CA

protein in primary human macrophages and HeLa cells at the

early stages of infection (

57

,

58

), the AAA mutation of the RKK

motif in the M-PMV CA protein almost completely abolished the

import of the CA protein into the nucleus (

Fig. 8

). The detectable

amounts of M-PMV CA in the nucleus may originate from CA

present in a preintegration complex in cells newly infected by the

released particles. The absence of CA in the nuclei of cells

trans-fected with the RKK mutant is consistent with the fact that the

RKK/AAA mutant virus lacking the vRNA is noninfectious and

thus unable to introduce mature CA into the cells.

A

B

FIG 7Relative infectivity and genomic RNA incorporation into M-PMV wt and RKK mutant viruses. (A) The relative infectivity of RKK mutants was determined by a single-round assay. HEK 293T cells were cotransfected with wild-type or RKK mutant pSARM-EGFP and pTMO vectors. At 48 h post-transfection, the virus particles from the culture medium were filtered and normalized for CA (p27) by quantitative Western blotting. Equivalent amounts of virions were used to infect fresh HEK 293T cells. At 48 h postin-fection, the cells were harvested, and the numbers of GFP-positive cells were determined by flow cytometry (BD FACSAria). The mean percentage of three independent infectivity measurements (with calculated standard deviations) for each mutant relative to the wild-type is shown. (B) Mean relative RNA contents with standard deviations (n⫽3) of the wt and RKK/AAA mutant viruses are shown. Viral RNA was isolated from purified viral particles released into the culture media at 48 h posttransfection. After reverse transcription of normalized samples (see Materials and Methods), real-time PCR was used to quantify the amount of incorporated RNA.

time (min.) of LMB treatment

β-actin Gag

CA 80

58 46

30

23 kDa

0 30 60 120 0 30 60 120 mock

wt AAA

lysate

time (min.) of LMB treatment

cytoplasm

80 58 46

30

23 kDa

Gag

CA 0 30 60 120 0 30 60 120 mock

wt AAA

lamin A CypA time (min.) of

LMB treatment

nucleus

lamin A 80

58 46

30

23 kDa

Gag

CA 0 30 60 120 0 30 60 120 mock

wt AAA

CypA

FIG 8Western blot analysis of LMB-treated transfected HEK 293T cells. At 24 h posttransfection of the HEK 293T cells with the wild-type or RKK/AAA mutant M-PMV proviral constructs, LMB at a final concentration of 20 nM was added to the cells. Incubation proceeded for 30, 60, and 120 min, and then nuclear and cytosolic fractions were isolated. Individual samples of total cell lysate and nuclear and cytosolic fractions were then analyzed by Western blot-ting with the following antibodies: rabbit M-PMV CA, rabbit anti-lamin-A, rabbit anti-cyclophilin A (CypA), and mouse monoclonal anti-␤ -actin.

on November 7, 2019 by guest

http://jvi.asm.org/

DISCUSSION

Role of RKK in nucleic acid binding and virus assembly.

The

mutation of the RKK region to either AAA or GPG had

wide-ranging effects on Gag assembly, nucleic acid incorporation, and

virus production. In the case of mutation to GPG, assembly,

nu-cleic acid incorporation and virus production were essentially

abolished. We speculate that the insertion of a proline residue in

this region may cause structural defects in CA which interfere with

its proper function.

Mutation of RKK to AAA was still permissive for

in vitro

as-sembly. This allowed us to test our previous hypothesis—that the

extended filament of density underlying CA in

in vitro-assembled

⌬

ProCANC tubes represents an ordered nucleic acid structure

bound to the basic RKK region (

30

). Indeed, structural analysis

showed that this filament is lost in the RKK/AAA mutant,

indicat-ing that the nucleic acid is either absent in the particles or is no

longer bound to the RKK motif. Consistent with this observation,

the efficiency of nucleic acid binding by the mutant protein is

reduced. We observed that the mutation also leads to significantly

reduced efficiency of Gag assembly, suggesting that the

interac-tions between RKK and nucleic acid may facilitate the assembly.

This could be achieved either by promoting CA dimerization or

further oligomerization into a hexameric lattice. Since the wt

⌬

ProCANC assembles into particles of similar morphology both

in

E. coli

and

in vitro, the failure of the

⌬

ProCANC RKK/AAA

mutant to assemble in

E. coli

suggests that RKK-mediated CA

oligomerization may be particularly important in crowded

cellu-lar environments. Together, these observations are consistent

with a model in which nucleic acid binding by the RKK motif

creates a scaffold promoting Gag assembly.

When placed in the context of the infectious virus, the RKK/

AAA mutation leads to a ca. 50% drop in virus particle release,

which is consistent with the assembly defect observed

in vitro.

Strikingly, the mutation also influences the site of assembly:

whereas wild-type M-PMV assembles D-type particles in the

peri-centriolar region (

1

,

59

), in the AAA mutant, approximately

one-third of the observed particles appeared as C-type particles

assem-bling at the plasma membrane. In the GPG mutant, dense layers of

accumulated protein are seen underlying the plasma membrane,

which are not seen in noninfected cells. Based on the thickness of

these layers, and because similar structures have previously been

shown to be formed by assembly-incompetent Gag polyproteins

(

55

,

60

,

61

), we presume that these extra layers observed under the

plasma membrane are formed by accumulated mutant Gag

pro-tein.

Trafficking of M-PMV Gag to the pericentriolar assembly site

is dependent on the interaction between a CTRS signal in MA with

the Tctex-1 component of dynein (

4

). We consider it unlikely that

mutation of RKK influences this interaction because the MA site is

distal to CA. We prefer the following alternative explanation for

the relocation of assembly. The assembly of C-type retroviruses at

the plasma membrane is promoted by CA-CA interactions,

NC-RNA-NC interactions, and MA-membrane-MA interactions. In

the case of M-PMV, a D-type retrovirus, assembly in the

cyto-plasm is promoted by CA-CA, NC-RNA-NC, and

nu-cleic acid-CA(RKK) interactions. In the case where the

CA(RKK)-nucleic acid-CA(RKK) interaction is abolished by mutation of the

RKK, the cytosolic assembly efficiency is reduced, and part of Gag

is transported to the PM, where MA-membrane-MA interactions

promote C-type assembly.

Role of RKK in genome packaging and nuclear transport.

Surprisingly, while the RKK/AAA mutation does not affect the

total amount of RNA being incorporated into virus particles, it

dramatically reduces the packaging of genomic RNA. This is most

likely the cause of the observed reduced infectivity. Specific

pack-aging of genomic RNA in retroviruses is typically mediated by NC

(

62–64

). While some studies have indicated that interactions

be-tween MA and nucleic acid may modulate this effect (

18

,

19

), a

role for CA in genome packaging has not been described. We

cannot rule out that the RKK motif influences packaging by direct

interaction with sequences in the genomic RNA, but this seems

unlikely. A number of other hypotheses seem more likely. The

RKK motif may help to stabilize the Gag-vRNA complex, or it may

contribute to a structural arrangement of the NC region which is

required for packaging. The reduction in genome packaging may

be a secondary effect resulting from the relocalization of viral

as-sembly from the pericentriolar region to the plasma membrane.

Alternatively, packaging may be hindered by a change in the

nu-clear transport of Gag.

Nuclear trafficking of Gag has previously been shown to be

important for genomic RNA incorporation for RSV (

24

,

25

). In

the case of M-PMV, Gag associates with nuclear pores (

56

) and

may enter the nucleus (

22

). We found both RKK/AAA and

wild-type Gag in the nucleus. The phenowild-type we observed for the RKK/

AAA Gag is consistent with reduced efficiency of nuclear export.

Because the RSV nuclear export signal consists mainly of nonpolar

amino acids in the p10 domain (

65

), we expect that the export of

Gag from the nucleus is not directly inhibited by the mutation of

the polar RKK region, but it is rather mediated by the Gag-vRNA

interactions and their simultaneous export from the nucleus. This

could lead to a reduction in genomic RNA export and packaging

into virus particles. Alternatively, if nuclear export is promoted by

a Gag-vRNA complex, then reduced export might result indirectly

from the RKK/AAA mutation interfering with genomic RNA

binding. In either case, the reduction in genomic RNA

incorpora-tion and the altered nuclear trafficking would be related

pheno-types.

In summary, our data suggest that the RKK region of CA

mod-ulates interactions between Gag and the viral genomic RNA in a

manner that is also accompanied with changes in nuclear

traffick-ing. The nucleic acid recruited by RKK serves a scaffolding

func-tion that promotes Gag assembly. We speculate that D-type

ret-roviruses such as M-PMV may require an additional assembly

scaffold to replace the function of the plasma membrane in the

assembly of C-type retroviruses.

ACKNOWLEDGMENTS

This study was supported by the Grant Agency of the Czech Republic (14-15326S), by the LH12011 project and NPU I sustainability projects LO1302 and LO1304 from the Czech Ministry of Education, and by Deut-sche Forschungsgemeinschaft grant BR 3635/2-1 to J.A.G.B.

We thank Tanmay Bharat for preparation of the cryoelectron mi-croscopy grids and Wim Hagen for assistance with cryoelectron to-mography.

This study was technically supported by Frank Thommen and EMBL IT-services.

on November 7, 2019 by guest

http://jvi.asm.org/

FUNDING INFORMATION

Work in the laboratory of John A. G. Briggs was funded by Deutsche Forschungsgemeinschaft (DFG) (BR 3635/2-1). This work, including the efforts of Tomas Ruml, was funded by the Grant Agency of the Czech Republic (14-15326S) and the Czech Ministry of Education (NPU I sus-tainability projects LO1302 and LO1304).

REFERENCES

1.Choi G, Park S, Choi B, Hong S, Lee J, Hunter E, Rhee SS. 1999. Identification of a cytoplasmic targeting/retention signal in a retroviral Gag polyprotein. J Virol73:5431–5437.

2.Sfakianos JN, Hunter E.2003. M-PMV capsid transport is mediated by Env/Gag interactions at the pericentriolar recycling endosome. Traffic

4:671– 680.http://dx.doi.org/10.1034/j.1600-0854.2003.00126.x. 3.Sakalian M, Hunter E.1999. Separate assembly and transport domains

within the Gag precursor of Mason-Pfizer monkey virus. J Virol73:8073– 8082.

4.Vlach J, Lipov J, Rumlová M, Veverka V, Lang J, Srb P, Knejzlík Z, Pichová I, Hunter E, Hrabal R, Ruml T.2008. D-retrovirus morphoge-netic switch driven by the targeting signal accessibility to Tctex-1 of dy-nein. Proc Natl Acad Sci U S A105:10565–10570.http://dx.doi.org/10 .1073/pnas.0801765105.

5.Ulbrich P, Haubova S, Nermut MV, Hunter E, Rumlova M, Ruml T.

2006. Distinct roles for nucleic acid in in vitro assembly of purified Mason-Pfizer monkey virus CANC proteins. J Virol80:7089 –7099.http://dx.doi .org/10.1128/JVI.02694-05.

6.Campbell S, Vogt VM.1997. In vitro assembly of virus-like particles with Rous sarcoma virus Gag deletion mutants: identification of the p10 do-main as a morphological determinant in the formation of spherical parti-cles. J Virol71:4425– 4435.

7.Gross I, Hohenberg H, Kräusslich HG.1997. In vitro assembly proper-ties of purified bacterially expressed capsid proteins of human immuno-deficiency virus. Eur J Biochem249:592– 600.http://dx.doi.org/10.1111/j .1432-1033.1997.t01-1-00592.x.

8.Hadravová R, de Marco A, Ulbrich P, Stokrová J, Dolezal M, Pichová I, Ruml T, Briggs JAG, Rumlová M.2012. In vitro assembly of virus-like particles of a gammaretrovirus, the murine leukemia virus XMRV. J Virol

86:1297–1306.http://dx.doi.org/10.1128/JVI.05564-11.

9.Ma YM, Vogt VM.2004. Nucleic acid binding-induced Gag dimerization in the assembly of Rous sarcoma virus particles in vitro. J Virol78:52– 60.

http://dx.doi.org/10.1128/JVI.78.1.52-60.2004.

10. Pastré D, Hamon L, Landousy F, Sorel I, David M-O, Zozime A, Le Cam E, Piétrement O.2006. Anionic polyelectrolyte adsorption on mica mediated by multivalent cations: a solution to DNA imaging by atomic force microscopy under high ionic strengths. Langmuir22:6651– 6660.

http://dx.doi.org/10.1021/la053387y.

11. Datta SAK, Zuo X, Clark PK, Campbell SJ, Wang Y-X, Rein A.2011. Solution properties of murine leukemia virus gag protein: differences from HIV-1 gag. J Virol85:12733–12741.http://dx.doi.org/10.1128/JVI .05889-11.

12. Rulli SJ, Hibbert CS, Mirro J, Pederson T, Biswal S, Rein A. 2007. Selective and nonselective packaging of cellular RNAs in retrovirus parti-cles. J Virol81:6623– 6631.http://dx.doi.org/10.1128/JVI.02833-06. 13. Jouvenet N, Simon SM, Bieniasz PD.2009. Imaging the interaction of

HIV-1 genomes and Gag during assembly of individual viral particles. Proc Natl Acad Sci U S A106:19114 –19119.http://dx.doi.org/10.1073 /pnas.0907364106.

14. Dorfman T, Luban J, Goff SP, Haseltine WA, Göttlinger HG.1993. Mapping of functionally important residues of a cysteine-histidine box in the human immunodeficiency virus type 1 nucleocapsid protein. J Virol

67:6159 – 6169.

15. Dannull J, Surovoy A, Jung G, Moelling K.1994. Specific binding of HIV-1 nucleocapsid protein to PSI RNA in vitro requires N-terminal zinc finger and flanking basic amino acid residues. EMBO J13:1525–1533. 16. Aldovini A, Young RA.1990. Mutations of RNA and protein sequences

involved in human immunodeficiency virus type 1 packaging result in production of noninfectious virus. J Virol64:1920 –1926.

17. Gorelick RJ, Henderson LE, Hanser JP, Rein A.1988. Point mutants of Moloney murine leukemia virus that fail to package viral RNA: evidence for specific RNA recognition by a “zinc finger-like” protein sequence. Proc Natl Acad Sci U S A85:8420 – 8424.http://dx.doi.org/10.1073/pnas.85.22 .8420.

18. Alfadhli A, Still A, Barklis E.2009. Analysis of human immunodeficiency virus type 1 matrix binding to membranes and nucleic acids. J Virol83:

12196 –12203.http://dx.doi.org/10.1128/JVI.01197-09.

19. Ott DE, Coren LV, Gagliardi TD.2005. Redundant roles for nucleocap-sid and matrix RNA-binding sequences in human immunodeficiency vi-rus type 1 assembly. J Virol79:13839 –13847.http://dx.doi.org/10.1128 /JVI.79.22.13839-13847.2005.

20. Fritz CC, Green MR.1996. HIV Rev uses a conserved cellular protein export pathway for the nucleocytoplasmic transport of viral RNAs. Curr Biol6:848 – 854.http://dx.doi.org/10.1016/S0960-9822(02)00608-5. 21. Butterfield-Gerson KL, Scheifele LZ, Ryan EP, Hopper AK, Parent LJ.

2006. Importin-beta family members mediate alpharetrovirus gag nuclear entry via interactions with matrix and nucleocapsid. J Virol80:1798 – 1806.http://dx.doi.org/10.1128/JVI.80.4.1798-1806.2006.

22. Baluyot MF, Grosse SA, Lyddon TD, Janaka SK, Johnson MC.2012. CRM1-dependent trafficking of retroviral Gag proteins revisited. J Virol

86:4696 – 4700.http://dx.doi.org/10.1128/JVI.07199-11.

23. Lochmann TL, Bann DV, Ryan EP, Beyer AR, Mao A, Cochrane A, Parent LJ.2013. NC-mediated nucleolar localization of retroviral gag proteins. Virus Res 171:304 –318. http://dx.doi.org/10.1016/j.virusres .2012.09.011.

24. Garbitt-Hirst R, Kenney SP, Parent LJ.2009. Genetic evidence for a connection between Rous sarcoma virus gag nuclear trafficking and genomic RNA packaging. J Virol 83:6790 – 6797.http://dx.doi.org/10 .1128/JVI.00101-09.

25. Gudleski N, Flanagan JM, Ryan EP, Bewley MC, Parent LJ. 2010. Directionality of nucleocytoplasmic transport of the retroviral Gag pro-tein depends on sequential binding of karyopherins and viral RNA. Proc Natl Acad Sci U S A 107:9358 –9363. http://dx.doi.org/10.1073/pnas .1000304107.

26. Kemler I, Saenz D, Poeschla E.2012. Feline Immunodeficiency Virus Gag Is a Nuclear Shuttling Protein. J Virol86:8402– 8411.http://dx.doi .org/10.1128/JVI.00692-12.

27. Tabernero C, Zolotukhin AS, Valentin A, Pavlakis GN, Felber BK.1996. The posttranscriptional control element of the simian retrovirus type 1 forms an extensive RNA secondary structure necessary for its function. J Virol70:5998 – 6011.

28. Ernst RK, Bray M, Rekosh D, Hammarskjöld ML.1997. A structured retroviral RNA element that mediates nucleocytoplasmic export of in-tron-containing RNA. Mol Cell Biol 17:135–144. http://dx.doi.org/10 .1128/MCB.17.1.135.

29. Grüter P, Tabernero C, von Kobbe C, Schmitt C, Saavedra C, Bachi A, Wilm M, Felber BK, Izaurralde E.1998. TAP, the human homolog of Mex67p, mediates CTE-dependent RNA export from the nucleus. Mol Cell1:649 – 659.http://dx.doi.org/10.1016/S1097-2765(00)80065-9. 30. de Marco A, Davey NE, Ulbrich P, Phillips JM, Lux V, Riches JD,

Fuzik T, Ruml T, Kräusslich H-G, Vogt VM, Briggs JAG. 2010. Conserved and variable features of Gag structure and arrangement in immature retrovirus particles. J Virol84:11729 –11736.http://dx.doi .org/10.1128/JVI.01423-10.

31. Bharat TAM, Davey NE, Ulbrich P, Riches JD, de Marco A, Rumlova M, Sachse C, Ruml T, Briggs JAG. 2012. Structure of the immature retroviral capsid at 8 Å resolution by cryo-electron microscopy. Nature

487:385–389.http://dx.doi.org/10.1038/nature11169.

32. Schur FKM, Hagen WJH, de Marco A, Briggs JAG.2013. Determination of protein structure at 8.5Å resolution using cryo-electron tomography and sub-tomogram averaging. J Struct Biol184:394 – 400.http://dx.doi .org/10.1016/j.jsb.2013.10.015.

33. Schur FK, Hagen WJ, Rumlová M, Ruml T, Müller B, Kräusslich HG, Briggs JAG.2014. Structure of the immature HIV-1 capsid in intact virus particles at 8.8 Å resolution. Nature517:505–508.http://dx.doi.org/10 .1038/nature13838.

34. Rumlova-Klikova M, Hunter E, Nermut MV, Pichova I, Ruml T.2000. Analysis of Mason-Pfizer monkey virus Gag domains required for capsid assembly in bacteria: role of the N-terminal proline residue of CA in di-recting particle shape. J Virol74:8452– 8459.http://dx.doi.org/10.1128 /JVI.74.18.8452-8459.2000.

35. Chiu J, March PE, Lee R, Tillett D. 2004. Site-directed, ligase-independent mutagenesis (SLIM): a single-tube methodology approach-ing 100% efficiency in 4 h. Nucleic Acids Res32:e174.http://dx.doi.org/10 .1093/nar/gnh172.

36. Song C, Hunter E.2003. Variable sensitivity to substitutions in the N-terminal heptad repeat of Mason-Pfizer monkey virus transmembrane

on November 7, 2019 by guest

http://jvi.asm.org/

protein. J Virol77:7779 –7785.http://dx.doi.org/10.1128/JVI.77.14.7779 -7785.2003.

37. Krˇízová I, Hadravová R, Štokrová J, Günterová J, Doležal M, Ruml T, Rumlová M, Pichová I. 2012. The G-patch domain of Mason-Pfizer monkey virus is a part of reverse transcriptase. J Virol86:1988 –1998.http: //dx.doi.org/10.1128/JVI.06638-11.

38. Bohmová K, Hadravová R, Stokrová J, Tuma R, Ruml T, Pichová I, Rumlová M.2010. Effect of dimerizing domains and basic residues on in vitro and in vivo assembly of Mason-Pfizer monkey virus and human immunodeficiency virus. J Virol84:1977–1988.http://dx.doi.org/10.1128 /JVI.02022-09.

39. Brody BA, Kimball MG, Hunter E.1994. Mutations within the trans-membrane glycoprotein of Mason-Pfizer monkey virus: loss of SU-TM association and effects on infectivity. Virology202:673– 683.http://dx.doi .org/10.1006/viro.1994.1389.

40. Newman RM, Hall L, Connole M, Chen G-L, Sato S, Yuste E, Diehl W, Hunter E, Kaur A, Miller GM, Johnson WE.2006. Balancing selection and the evolution of functional polymorphism in Old World monkey TRIM5␣. Proc Natl Acad Sci U S A103:19134 –19139.http://dx.doi.org /10.1073/pnas.0605838103.

41. Rumlová M, Benedíková J, Cubínková R, Pichová I, Ruml T.2001. Comparison of classical and affinity purification techniques of Mason-Pfizer monkey virus capsid protein: the alteration of the product by an affinity tag. Protein Expr Purif23:75– 83.http://dx.doi.org/10.1006/prep .2001.1488.

42. Vorácˇková I, Suchanová S, Ulbrich P, Diehl WE, Ruml T.2011. Puri-fication of proteins containing zinc finger domains using immobilized metal ion affinity chromatography. Protein Expr Purif79:88 –95.http://dx .doi.org/10.1016/j.pep.2011.04.022.

43. Candiano G, Bruschi M, Musante L, Santucci L, Ghiggeri GM, Car-nemolla B, Orecchia P, Zardi L, Righetti PG.2004. Blue silver: a very sensitive colloidal Coomassie G-250 staining for proteome analysis. Elec-trophoresis25:1327–1333.http://dx.doi.org/10.1002/elps.200305844. 44. Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M,

Pietz-sch T, PreibiPietz-sch S, Rueden C, Saalfeld S, Schmid B, Tinevez J-Y, White DJ, Hartenstein V, Eliceiri K, Tomancak P, Cardona A.2012. Fiji: an open-source platform for biological-image analysis. Nat Methods9:676 – 682.http://dx.doi.org/10.1038/nmeth.2019.

45. Klikova M, Rhee SS, Hunter E, Ruml T.1995. Efficient in vivo and in vitro assembly of retroviral capsids from Gag precursor proteins expressed in bacteria. J Virol69:1093–1098.

46. Stansell E, Apkarian R, Haubova S, Diehl WE, Tytler EM, Hunter E.

2007. Basic residues in the Mason-Pfizer monkey virus gag matrix domain regulate intracellular trafficking and capsid-membrane interactions. J Vi-rol81:8977– 8988.http://dx.doi.org/10.1128/JVI.00657-07.

47. Mastronarde DN.2005. Automated electron microscope tomography using robust prediction of specimen movements. J Struct Biol152:36 –51.

http://dx.doi.org/10.1016/j.jsb.2005.07.007.

48. Kremer JR, Mastronarde DN, McIntosh JR.1996. Computer visualiza-tion of three-dimensional image data using IMOD. J Struct Biol116:71– 76.http://dx.doi.org/10.1006/jsbi.1996.0013.

49. Nickell S, Förster F, Linaroudis A, Del Net W, Beck F, Hegerl R, Baumeister W, Plitzko JM.2005. TOM software toolbox: acquisition and analysis for electron tomography. J Struct Biol149:227–234.http://dx.doi .org/10.1016/j.jsb.2004.10.006.

50. Förster F, Medalia O, Zauberman N, Baumeister W, Fass D. 2005. Retrovirus envelope protein complex structure in situ studied by cryo-electron tomography. Proc Natl Acad Sci U S A102:4729 – 4734.http://dx .doi.org/10.1073/pnas.0409178102.

51. Castaño-Díez D, Kudryashev M, Arheit M, Stahlberg H.2012. Dynamo: a flexible, user-friendly development tool for subtomogram averaging of cryo-EM data in high-performance computing environments. J Struct Biol178:139 –151.http://dx.doi.org/10.1016/j.jsb.2011.12.017. 52. Xiong Q, Morphew MK, Schwartz CL, Hoenger AH, Mastronarde DN.

2009. CTF determination and correction for low dose tomographic tilt series. J Struct Biol168:378 –387.http://dx.doi.org/10.1016/j.jsb.2009.08 .016.

53. Pettersen EF, Goddard TD, Huang CC, Couch GS, Greenblatt DM, Meng EC, Ferrin TE.2004. UCSF Chimera: a visualization system for exploratory research and analysis. J Comput Chem25:1605–1612.http: //dx.doi.org/10.1002/jcc.20084.

54. Pruggnaller S, Mayr M, Frangakis AS.2008. A visualization and segmen-tation toolbox for electron microscopy. J Struct Biol164:161–165.http: //dx.doi.org/10.1016/j.jsb.2008.05.003.

55. Strohalmová-Bohmová K, Spiwok V, Lepšík M, Hadravová R, Krˇížová I, Ulbrich P, Pichová I, Bednárová L, Ruml T, Rumlová M.2014. Role of Mason-Pfizer mo