0022-538X/07/$08.00
⫹
0
doi:10.1128/JVI.00632-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.
Proteomics Analysis of
Helicoverpa armigera
Single Nucleocapsid
Nucleopolyhedrovirus Identified Two New Occlusion-Derived
Virus-Associated Proteins, HA44 and HA100
䌤
Fei Deng,
1† Ranran Wang,
1† Minggang Fang,
1‡ Yue Jiang,
1Xushi Xu,
1Hanzhong Wang,
1Xinwen Chen,
1Basil M. Arif,
2Lin Guo,
3Hualin Wang,
1and Zhihong Hu
1*
State Key Laboratory of Virology and Joint Laboratory of Invertebrate Virology, Wuhan Institute of Virology, Chinese Academy of
Sciences, Wuhan 430071, People’s Republic of China
1; Laboratory for Molecular Virology, Great Lakes Forestry Centre,
Sault Ste. Marie, Ontario, Canada
2; and State Key Laboratory of Virology, Wuhan University and College of
Life Sciences, Wuhan 430072, People’s Republic of China
3Received 24 March 2007/Accepted 14 June 2007
Sodium dodecyl sulfate-polyacrylamide gel electrophoresis and mass spectrometry were used to analyze the
structural proteins of the occlusion-derived virus (ODV) of
Helicoverpa armigera
single nucleocapsid
nucleo-polyhedrovirus (HearNPV), a group II NPV. Twenty-three structural proteins of HearNPV ODV were
identi-fied, 21 of which have been reported previously as structural proteins or ODV-associated proteins in other
baculoviruses. These include polyhedrin, P78/83, P49, ODV-E18, ODV-EC27, ODV-E56, P74, LEF-3, HA66
(AC66), DNA polymerase, GP41, VP39, P33, E25, helicase, P6.9, ODV/BV-C42, VP80, EC43,
ODV-E66, and PIF-1. Two proteins encoded by HearNPV ORF44 (
ha44
) and ORF100 (
ha100
) were discovered as
ODV-associated proteins for the first time.
ha44
encodes a protein of 378 aa with a predicted mass of 42.8 kDa.
ha100
encodes a protein of 510 aa with a predicted mass of 58.1 kDa and is a homologue of the gene for
poly(ADP-ribose) glycohydrolase (
parg
). Western blot analysis and immunoelectron microscopy confirmed that
HA44 is associated with the nucleocapsid and HA100 is associated with both the nucleocapsid and the envelope
of HearNPV ODV. HA44 is conserved in group II NPVs and granuloviruses but does not exist in group I NPVs,
while HA100 is conserved only in group II NPVs.
The
Baculoviridae
, a diverse family of more than 600 viruses,
encompasses two genera, the nucleopolyhedroviruses (NPVs)
and the granuloviruses (GVs) (5). Baculoviruses are generally
host specific, infecting mainly insects of the orders
Lepidoptera
,
Hymenoptera
, and
Diptera
. Two progeny phenotypes are
pro-duced in the replication cycle, the budded virus (BV) and the
occlusion-derived virus (ODV). In larvae, ODVs initiate
pri-mary infections in midgut epithelial cells of susceptible hosts
and BVs spread the virus from cell to cell in the larvae (5, 30,
62). The two phenotypes are genotypically identical, but each
has characteristic structural components to accommodate their
respective functions (7, 50). Based on phylogeny, lepidopteran
NPVs are divided into group I and group II (23, 24, 70). It is
known now that the BVs of group I and group II NPVs use
different fusion proteins to enter host cells. GP64 is the
mem-brane fusion protein of group I NPVs (4, 40), while the F
protein is that of group II NPVs (27, 36, 44).
Identification of ODV structural proteins and comparisons
in different NPVs are fundamental to the functional
investiga-tion of virulence and host specificity. So far, 30 genome
se-quences of baculoviruses have been reported, including 8
group I NPVs, 12 group II NPVs, 7 GVs, 1 dipteran NPV, and
2 hymenopteran NPVs. The availability of the genome
se-quences has facilitated proteomic analysis of baculoviruses. In
2003, proteomic investigations revealed 44 proteins to be ODV
components of
Autographa californica
multiple
nucleopolyhe-drosis virus (AcMNPV), a group I NPV (11). Recent
investi-gations of a dipteran NPV,
Culex nigripalpus
NPV (CuniNPV),
identified 44 ODV-associated proteins (46). By comparison,
little is known about the structural proteins of ODVs from
group II NPVs.
The
Helicoverpa armigera
single nucleocapsid NPV (HearNPV,
also called HaSNPV) was first isolated in 1975 in the Hubei
Province of the People’s Republic of China and has been used
extensively over 25 years in China to control
H
.
armigera
in cotton
(71). Phylogenetic analysis indicated that HearNPV belongs to
the group II NPVs (12, 29). Its DNA genome is 131 kb and
contains 135 open reading frames (ORFs) that potentially encode
proteins of 50 amino acids (aa) or larger (13). Several HearNPV
genes, such as the polyhedrin gene (
polh
) (14), the ecdysteroid
UDP-glucosyltransferase gene (
egt
) (15), the late expression
fac-tor 2 gene (
lef
-
2
) (12), the basic DNA-binding protein gene (
p6
.
9
)
(61),
ha122
(37),
Ha94
(19),
chitinase
(60),
fp25K
(67),
p10
(18),
and the F-protein gene (
ha133
) (36), have been characterized.
In this report, we describe using sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and mass
spectrometry-based protein analysis techniques to study
struc-tural proteins of the ODV of HearNPV. HearNPV was chosen
to serve as a representative of the group II NPVs. ODV
proteins were separated by SDS-PAGE and analyzed by
pep-tide mass fingerprinting techniques by using matrix-assisted
laser desorption ionization–time of flight mass spectrometry
* Corresponding author. Mailing address: Wuhan Institute of
Virol-ogy, Chinese Academy of Sciences, Wuhan 430071, People’s Republic
of China. Phone and fax: 86-27-87197180. E-mail: huzh@wh.iov.cn.
† F.D. and R.W. contributed equally to this work.
‡ Present address: Department of Agroecology, University of British
Columbia, Vancouver, British Columbia, Canada V6T 1Z4.
䌤
Published ahead of print on 20 June 2007.
9377
on November 8, 2019 by guest
http://jvi.asm.org/
(MALDI-TOF MS). The resulting mass spectra were searched
against the NCBI database and the theoretical ORF database
of HearNPV. A total of 23 proteins were identified as
ODV-associated proteins. Of these 23 proteins, 21 were previously
reported as ODV-associated proteins in other baculoviruses
but 2 were hitherto unknown as ODV-associated proteins.
These two newly identified proteins, encoded by
ha44
and
ha100
, respectively, were further shown to be structural
com-ponents of the ODV by Western blot analysis and
immuno-electron microscopy (IEM).
MATERIALS AND METHODS
Insects, cells, and virus.A culture ofH.armigerainsects was maintained as described by Sun et al. (55). An in vivo-cloned strain of HearNPV
(HearNPV-G4) (13, 55) was used as the wild-type virus and propagated inH.armigera. Cells
of theHeliothis zeaHzAM1 line (39) were used for producing BV of HearNPV.
Purification of HearNPV BV and ODV.BV was purified from the cell culture supernatant of infected HzAM1 cells (72 h postinfection) as described by Brau-nagel and Summers (7). Larvae were homogenized in 0.1% SDS, followed by a few rounds of differential and rate zonal centrifugation in sucrose gradients. All solutions were supplemented with 0.1% SDS (56). Protease inactivation of the
purified occlusion bodies was performed by HgCl2and hot water treatment (54).
ODVs were released by alkaline treatment (pH 10.9) (7) and purified on con-tinuous sucrose gradients. Purified BV and ODV were further fractionated into envelope and nucleocapsid components (28).
Protein separation, reduction, alkylation, and digestion.Proteins from puri-fied HearNPV ODV were separated by 12% SDS-PAGE and stained with a colloidal blue staining kit (Invitrogen). Protein bands were excised from the one-dimensional polyacrylamide electrophoresis gel and destained by washing
with a mixture of 200 mM NH4HCO3–acetonitrile (1:1). Proteins were reduced
with dithiothreitol, alkylated with iodoacetamide, and digested in gel with trypsin (Promega, Madison, WI) as previously described (53). The peptide mixtures obtained were further desalted by ZipTipC18 (Millipore) and eluted in 50% acetonitrile–0.1% trifluoroacetic acid buffer before MS analysis.
MALDI-TOF MS.A saturated solution of␣-cyano-4-hydroxycinnamic acid in 0.1% trifluoroacetic acid and 50% acetonitrile was used as the matrix. The sample and the matrix (1:1, vol/vol) were spotted onto a target plate. MALDI-TOF spectra of the peptides were obtained with a Voyager DE STR MALDI-TOF work station mass spectrometer (Applied Biosystems Inc.). The analysis was performed in posi-tive-ion reflector mode with an accelerating voltage of 20 kV and a delayed extrac-tion of 150 ns. Typically, 200 scans were averaged. Data mining was performed with MS-Fit software (http://prospector.ucsf.edu/ucsfhtml4.0/msfit.htm) and Mascot soft-ware (http://www.matrixscience.com/search_form_select.html) against the NCBI da-tabase and the theoretical ORF dada-tabase of HearNPV.
Sequence analysis ofha44andha100.The sequence data were compiled and analyzed with DNASTAR software. Homologues in the GenBank and EMBL databanks were explored with the PSI-BLAST search tool (1). Amino acid sequence alignment was performed with Clustal X and T coffee software (42, 58). GeneDoc software (version 1.1.1004) was used for similarity shading and scoring of alignment. MEGA3.1 (33) was used for generating the phylogenetic trees by the neighbor-joining method, with bootstrap replications. A phylogenetic tree was visualized with the Treeview program.
Preparation of antibodies against HA44 and HA100.The entireha44coding
region and a truncated fragment of theha100gene were amplified with
synthe-sized primers Ha44a/Ha44b (Ha44a, 5⬘-GAATTCATGAGCAATCCCAGCAA
ACAATC-3⬘; Ha44b, 5⬘-GAATTCTCAATAGCGCAAACGAGTTTCG-3⬘) and
Ha100f/Ha100r (Ha100f, 5⬘GCCGGATCCATGACTTTGTCGCGTTTAGATT
GCG-3⬘; Ha100r, 5⬘-GGCTCTAGATTAATAAACCATATTGTAATCGGCAA
C-3⬘), respectively (the sequences in italics are restriction enzyme digestion sites.
The PCR product ofha44was first cloned into pGEM-T-Easy (Promega) and
then into the expression vector pET28a (Novagen) in whichha44was fused in
frame with a six-His tag at the C terminus. The PCR product ofha100was first
cloned into pGEM-T-Easy (Promega) and then into the expression vector
pGEX-KG (22) in whichha100was fused in frame with the gene for glutathione
S-transferase at the C terminus. HA44 expressed inEscherichia coliwas purified
with Ni-nitrilotriacetic acid agarose (QIAGEN), and HA100 was purified by glutathione-agarose beads (Sigma). The purified proteins were used to generate specific antibodies against HA44 and HA100.
Purified HA44 and HA100 (200g) were used to immunize rabbits.
Preim-mune sera were withdrawn prior to inoculation. After 3 weeks, the rabbits
received a booster with the same amount of the antigens. Two weeks later, the
antisera were collected and stored at⫺80°C until use. The specificities of the
antisera were tested by Western blot analysis.
Western blot analysis.Purified BVs and ODVs, as well as their nucleocapsid and envelope fractions, were separated by 12% SDS-PAGE and transferred onto Hybond-N membranes (Amersham) by semidry electrophoresis transfer (2). HA44- and HA100-specific antisera and alkaline phosphatase-conjugated immu-noglobulin G (SABC, China) were used as the primary and secondary antibodies,
respectively. The signal was detected with a 5-bromo-4-chloro-3-indolyl--D
-galactopyranoside (BCIP)–nitroblue tetrazolium kit (SABC, China). Polyclonal anti-VP80, anti-ODV-E56, and anti-HaF1 antibodies were used as controls for nucleocapsid-, ODV envelope-, and BV envelope-specific proteins, respectively.
IEM.Purified ODVs were added to carbon-coated nickel grids (150 mesh) and
[image:2.585.310.530.71.527.2]blocked with 5% bovine serum albumin. The primary antibodies were 1:100 dilutions of anti-HA44 and anti-HA100 antisera. Preimmune sera were used as
FIG. 1. SDS-PAGE profile and MS results of purified HearNPV
ODV. ODV proteins were separated by 12% SDS-PAGE and stained
with colloidal blue. The ODV bands (numbered in the middle) were
subjected to MALDI-TOF MS, and their identities are listed on the right.
9378
DENG ET AL.
J. V
IROL.
on November 8, 2019 by guest
http://jvi.asm.org/
Band Size (kDa) from SDS-PAGE
HearNPV ORF
AcMNPV
ORF Protein
Predicted size (kDa)
Sequence
coverage (%) Function Reference(s)
1 110 ha73 ac80 GP41 36.6 43 Tegument main protein 63, 64
2 103 ha73 ac80 GP41 36.6 28 Tegument main protein 63, 64
3 100 ha66 ac66 HA66 88.9 37 ODV-associated protein 11
4 83 ha92 ac104 VP80 69.7 37 Nucleocapsid 38, 41
5 78 ha20 ac138 P74 78.4 25 Oral infectivity 21, 34, 68
6 73 ha73 ac80 GP41 36.6 58 Tegument main protein 63, 64
7 65 ha96 ac46 ODV-E66 76.1 35 ODV envelope 26
8 60 ha100 HA100 58.1 26 Nucleocapsid- and ODV
envelope-associated protein
This study
9 58 ha1 ac8 Polyhedrin 28.8 40 Polyhedron main protein 49
ha96 ac46 ODV-E66 76.1 12 ODV envelope 26
10 56 ha111 ac119 PIF-1 60.3 19 Oral infectivity 31
ha1 ac8 Polyhedrin 28.8 40 Polyhedron main protein 49
11 54 ha2 ac9 P78/83 45.9 49 Nucleocapsid 47, 52
12 50 ha96 ac46 ODV-E66 76.1 25 ODV envelope 26
13 48 ha9 ac142 P49 55.3 36 ODV-associated protein 11
14 45 ha44 Ha44 42.8 29 Nucleocapsid-associated protein This study
15 44 ha44 Ha44 42.8 32 Nucleocapsid-associated protein This study
ha89 ac101 C42 42.6 20 Nucleocapsid 10
16 42 ha96 ac46 ODV-E66 76.1 15 ODV envelope 26
ha89 ac101 C42 42.6 18 Nucleocapsid 10
17 39 ha94 ac109 ODV-EC43 41.5 45 ODV envelope and nucleocapsid 19
18 38 ha94 ac109 ODV-EC43 41.5 51 ODV envelope and nucleocapsid 19
ha84 ac95 Helicase 146 10 DNA replication essential 11, 32
19 36 ha15 ac148 ODV-E56 38.9 24 ODV envelope 8
20 35 ha9 ac142 p49 55.3 29 ODV-associated protein 11
ha78 ac89 VP39 33.4 35 Nucleocapsid 45
21 34 ha73 ac80 GP41 36.6 58 Tegument main protein 63, 64
22 33 ha1 ac8 Polyhedrin 28.8 38 Polyhedron main protein 49
23 32 ha78 ac89 VP39 33.4 50 Nucleocapsid 45
ha11 ac144 ODV-EC27 33.3 32 ODV envelope and nucleocapsid 3, 9
24 30 ha78 ac89 VP39 33.4 42 Nucleocapsid 45
ha1 ac8 Polyhedrin 28.8 34 Polyhedron main protein 49
25 29 ha78 ac89 VP39 33.4 57 Nucleocapsid 45
26 28 ha82 ac94 ODV-E25 25.9 41 ODV envelope 51
27 27 ha78 ac89 VP39 33.4 56 Nucleocapsid 45
ha80 ac92 P33 30.8 34 Stimulation of P53-induced apoptosis 48
28 26 ha80 ac92 P33 30.8 44 Stimulation of P53-induced apoptosis 48
29 25 ha78 ac89 VP39 33.4 45 Nucleocapsid 45
ha15 ac148 ODV-E56 38.9 24 ODV envelope 8
31 23.5 ha80 ac92 P33 30.8 32 Stimulation of P53-induced apoptosis 48
32 22 ha1 ac8 Polyhedrin 28.8 28 Polyhedron main protein 49
ha67 ac65 DNA polymerase 119.3 11 DNA replication essential 11, 32
34 20 ha1 ac8 Polyhedrin 28.8 28 Polyhedron main protein 49
35 19 ha82 ac94 ODV-E25 25.9 45 ODV envelope 51
36 18.5 ha78 ac89 VP39 33.4 40 Nucleocapsid 45
ha9 ac142 P49 55.3 18 ODV-associated protein 11
37 18 ha88 ac100 P6.9 11.5 35 DNA binding protein 65, 66
38 15 ha10 ac143 ODV-E18 8.8 45 ODV envelope 9
39 14 ha10 ac143 ODV-E18 8.8 45 ODV envelope 9
41 12 ha82 ac94 ODV-E25 25.9 40 ODV envelope 51
ha65 ac67 LEF-3 44 20 DNA replication essential 11, 32
a
The order of the bands was the same as that in Fig. 1. MALDI-TOF MS was repeated once.
9379
on November 8, 2019 by guest
http://jvi.asm.org/
[image:3.585.45.537.63.712.2]the negative controls. Twelve-nanometer Colloidal Gold-AffiniPure goat anti-rabbit immunoglobulin G (Jackson ImmunoResearch) was used as the secondary antibody for hybridization. The grids were then negatively stained with 2% sodium phosphotungstate and examined with a transmission electron microscope (H-7000 FA; Hitachi).
RESULTS
MS identification of HearNPV ODV proteins.
HearNPV
ODVs were purified, and the proteins were separated by 12%
SDS-PAGE. More than 40 bands ranging from 11 to 110 kDa
were made visible by colloidal blue staining (Fig. 1). Forty-one
bands were excised from the gel, reduced, alkylated, and
di-gested with trypsin, and the peptides were analyzed by
[image:4.585.42.546.66.489.2]MALDI-TOF MS. Peak lists of tryptic peptide masses were
generated and subjected to an NCBI database and HearNPV
ORF database search with MS-Fit and the Mascot search
en-gine. The SDS-PAGE and MALDI-TOF MS analyses were
performed twice. Reliable gene DNA matches from the
theo-retical HearNPV ORFs were obtained and are summarized in
Table 1. Twenty-three ORFs were identified, including
ha1
(
polh
),
ha2
(
p78
/
83
),
ha9
(
p49
),
ha10
(
odv
-
e18
),
ha11
(
odv
-ec27
),
ha15
(
odv
-
e56
),
ha20
(
p74
),
ha44
,
ha65
(
lef
-
3
),
ha66
(
Ac66
),
ha67
(
dna
-
pol
),
ha73
(
gp41
),
ha78
(
vp39
),
ha80
(
p33
),
ha82
(
odv
-
e25
),
ha84
(
helicase
),
ha88
(
p6
.
9
),
ha89
(
odv
/
bv
-C42
),
ha92
(
vp80
),
ha94
(
odv
-
EC43
),
ha96
(
odv
-
e66
),
ha100
,
and
ha111
(
pif
-
1
).
FIG. 2. Alignment of the amino acid sequences of HA44 and its homologues among the group II NPVs. Three shading levels were set, black
for 100% identity, dark gray for 80% identity, and light gray for 60% identity. The NCBI accession numbers are NP_818692 for AdhoNPV45,
YP_529786 for ORF116 of
Agrotis segetum
NPV (AgseNPV116), YP_249646 for ORF42 of
Chrysodeixis chalcites
NPV (ChchNPV42), NP_075113
for HA44, NP_542668 for ORF45 of HzSNPV45, NP_047691 for ORF55 of
Lymantria dispar
NPV (LdMNPV55), NP_613219 for ORF136 of
Mamestra configurata
NPV A (MacoA136), NP_689309 for ORF135 of
Mamestra configurata
NPV B (MacoB135), NP_037867 for ORF107 of
Spodoptera exigua
NPV (SeMNPV107), NP_258314 for ORF44 of
Spodoptera litura
NPV (SpliNPV44), and YP_308929 for ORF39 of
Trichoplusia
ni
NPV (TnSNPV39).
9380
DENG ET AL.
J. V
IROL.
on November 8, 2019 by guest
http://jvi.asm.org/
Of these 23 proteins, VP39 (57), P78/83 (59), VP80 (38, 41),
and ODV/BV-C42 (10) have been reported previously as
nu-cleocapsid proteins of both BV and ODV. P6.9 is the main
basic DNA-binding protein located in the nucleocapsid (65,
66). GP41 is defined as the tegument protein of ODVs (63, 64).
ODV-E18 (9), ODV-E25 (51), ODV-E56 (8), and ODV-E66
(26), as well as oral infectivity-related proteins P74 (21, 34, 68)
and PIF-1 (31), were reported to be the ODV envelope
pro-teins. ODV-EC27 (5, 9) and ODV-EC43 (19) were reported as
structural proteins of the ODV nucleocapsid and envelope.
P33 (48), P49, AC66, helicase, LEF-3, DNA polymerase, and
polyhedrin were reported as ODV-associated proteins (11).
Two proteins, HA44 and HA100, have not been reported
be-fore and therebe-fore are being described in more detail here.
Peptide mass fingerprinting data interpretation by the
MS-Fit program revealed that 11 experimentally derived tryptic
peptide masses were found to match the predicted peptide
masses of the HA44 protein (error,
⬍
100 ppm), covering 29%
of its amino acid sequence. For HA100, 10 experimentally
derived peptide masses were found to match the predicted
peptide masses of the HA100 protein (error,
⬍
100 ppm),
cov-ering 26% of its amino acid sequence. By using Mascot
soft-ware for database searches (25), high Mascot score were
re-vealed when matched with HA44 and HA100, respectively
(
⬎
67).
Sequence and phylogeny analysis of
ha44
and
ha100
.
Se-quence analysis indicated that
ha44
contains 1,134 nucleotides
(nt) and potentially encodes a protein of 378 aa with a
pre-dicted molecular mass of 42.8 kDa. A baculovirus late
tran-scription motif, TAAG, was found 76 nt upstream of the initial
ATG of
ha44
, suggesting that it is a late gene. No
polyadenyl-ation signal was found within 500 nt downstream of the stop
codon.
Searches of databases with all of the available genomes of
baculoviruses showed that homologues of HA44 were found in all
group II NPVs and GVs but not in group I NPVs or in the
dipteran and hymenopteran NPVs. The size of the HA44
homo-logue varies, ranging from the 255 aa of ORF45 of
Adoxophyes
honmai
NPV (AdhoNPV45) to the 422 aa of ORF46 of
Spodopt-era litura
NPV (SpliNPV46), although most of the homologues
have a size of 311 to 378 aa. Pairwise comparisons revealed that
three proteins were very similar to their counterparts. The amino
acid identities were 98%, 83%, and 75% for HA44/HzSNPV45,
ChchNPV42/TnSNPV39, and MacoA136/MacoB135,
respec-tively (for definitions of abbreviations, see the legend to Fig. 2). In
contrast, the amino acid identity for the rest of the pairwise results
was lower than 50%. The alignment of HA44 homologues from
group II NPVs is presented in Fig. 2. The protein is mostly
conserved at the C terminus (Fig. 2). The N-terminal sequence of
HA44 is rich in basic residues (K/R) and serine, and this is a
common feature of most of the HA44 homologues. The
isoelec-tric point (pI) of the N-terminal 64 aa of HA44 is 10.79. Only 12
aa were absolutely conserved in the alignment, which included
N236, N264, V265, Y267, F281, N283, L322, N327, L333, K340,
T342, and V369 (Fig. 2). These amino acids might be important
in the function of HA44. Phylogenetic analysis indicated that the
HA44 homologues have a common ancestor and then diverged
into the cluster of group II NPVs and that of GVs (Fig. 3).
[image:5.585.132.461.72.300.2]The
Ha100
ORF is 1,530 nt and encodes a protein of 510 aa
with a predicted molecular mass of 58 kDa. No consensus early
transcription initiation motifs were found upstream of the
ini-tial ATG, but a TAAG motif was found at
⫺
34 nt, suggesting
FIG. 3. Neighbor-joining tree derived from HA44 and its homologues among NPVs and GVs. Bootstrap values (1,000 replicates, nodes
supported with more than 50%) are on the branch lines. The accession numbers for NPVs are as described in the legend to Fig. 3. The additional
ones are NP_872567 for ORF113 of
Adoxophyes orana
GV (AdorGV113), YP_006220 for ORF124 of
Agrotis segetum
GV (AgseGV124),
NP_891969 for ORF122 of
Cryptophlebia leucotreta
GV (CrleGV122), NP_148919 for ORF135 of
Cydia pomonella
GV (CpGV135), NP_663288
for ORF123 of
Phthorimaea operculella
GV (PhopGV123), NP_068332 for ORF113 of
Plutella xylostella
GV (PlxyGV113), and NP_059320 for
ORF172 of
Xestia c
-
nigrum
GV (XecnGV172).
on November 8, 2019 by guest
http://jvi.asm.org/
that
ha100
may also be a late gene. A polyadenylation signal
(AATAAA) was found at 22 to 27 nt downstream of the stop
codon.
HA100 has homology to poly(ADP-ribose) glycohydrolase
(PARG), a ubiquitously expressed exo- and
endoglycohydro-lase in eukaryotic cells. PARG mediates oxidative and
excito-toxic neuronal death and is involved in the breakdown and
recruitment of polyribose for nuclear functions such as DNA
replication and repair (17, 69). The vertebrate PARGs contain
four domains, A, B, C, and D (43). Domain A is a putative
regulatory domain, while B, C, and D form catalytic fragments.
Homologues of HA100 are conserved in all of the group II
NPVs sequenced so far. A comparison of PARGs from a range
of organisms and from group II NPVs is shown in Fig. 4.
Similar to the PARG of
Drosophila melanogaster
, the
PARG-like proteins of group II NPVs contain a catalytic fragment but
lack the putative regulatory A domain (Fig. 4). Alignment of
HA100 homologues from baculoviruses and PARGs from
se-lected eukaryotes reveals that although the sequence similarity
is not high, there were 7 aa absolutely conserved, including
F662, K676, Y683, G745, E756, P764, and E765, with respect
to the bovine PARG sequence (data not shown). All of the
conserved amino acids are located in the conserved catalytic
domain, which spans residues 610 to 795 in bovine PARG (43).
Localization of HA44 and HA100 in viral structures.
Anti-HA44 and anti-HA100 antisera were generated as described in
Materials and Methods and were used in Western blot analysis
and IEM. Western blot analyses were performed to identify
the localization of HA44 and HA100 in BV and ODV (Fig. 5).
The results showed that HA44 is located in the nucleocapsid
but not in the envelope of ODV and BV. HA100 was detected
in the nucleocapsid and envelope of ODV, as well as in the
nucleocapsid of BV (Fig. 5). The sizes of HA44 and HA100
were 44 kDa and 60 kDa, respectively, which are in agreement
with the predicted sizes deduced from their nucleotide
se-quences.
The IEM results showed that HA44 was located in the
nu-cleocapsid of ODV but not detected in the envelopes of the
intact ODV (Fig. 6A). HA100 was detected in intact ODVs, as
well as in the nucleocapsids of ODV (Fig. 6B). The IEM
results confirmed that HA44 is a nucleocapsid protein of
HearNPV ODV, while HA100 is a structural protein of both
the nucleocapsid and the envelope of the ODV.
DISCUSSION
In this study, we identified 23 HearNPV genes that encode
ODV structural proteins by SDS-PAGE and MS methods.
This is the first such report for a group II NPV.
[image:6.585.136.444.67.244.2]Braunagel et al. (11) were able to identify 44
ODV-associ-ated proteins of AcMNPV by using multiple techniques,
in-cluding MALDI-TOF, multidimensional protein identification
technology-tandem MS, library exploring, and Western
blot-ting. Perera et al. (46) identified 44 polypeptides in CuniNPV
ODV by MALDI-TOF and gel electrophoresis-liquid
chroma-tography-tandem MS. Comparison of the ODV-associated
proteins of AcMNPV, CuniNPV, and HearNPV shows that
nine proteins are shared by these viruses and are also
con-served in the baculoviruses sequenced so far. AcMNPV and
CuniNPV ODVs shared another five conserved baculovirus
proteins, i.e., PIF2, F protein, VP1054, VLF-1, and VP91,
which were not detected in HearNPV by MS. However, PIF2
was identified as a HearNPV ODV structural protein by
West-ern blot analysis (20). Therefore, at least 10 conserved
bacu-lovirus proteins are shared by ODVs of AcMNPV, CuniNPV,
and HearNPV, including P49, ODV-EC27, ODV-E56, P74,
GP41, VP39, P33, P6.9, ODV-EC43, and PIF-2. Another
pro-tein conserved in baculoviruses, PIF1, was identified as an
FIG. 4. Comparison of PARGs from a wide range of organisms and from group II NPVs. A, putative regulatory domain; B, C, and D, catalytic
fragments; C, PARG catalytic domain. Percent conservation is indicated in each block with respect to the bovine PARG. The amino acid positions
of bovine PARG domains and the lengths of PARGs are indicated. The accession numbers of PARGs are NP_776563 for
Bos taurus
, AAH52966
for
Homo sapiens
, NP_036090 for
Mus musculus
, NP_112629 for
Rattus norvegicus
, NP_477321 for
Drosophila melanogaster
, NP_501508 for
Caenorhabditis elegans
, NP_075169 for HA100, NP_818756 for AdhoNPV, YP_529728 for AgseNPV, YP_249712 for ChchNPV, NP_542726 for
HzSNPV, NP_047778 for LdMNPV, NP_613153 for MacoNPV A, NP_689244 for MacoNPV B, NP_037812 for SeMNPV, NP_258370
for SpliNPV, and YP_308992 for TnSNPV.
9382
DENG ET AL.
J. V
IROL.
on November 8, 2019 by guest
http://jvi.asm.org/
ODV component in HearNPV in our study and was also
re-ported as an ODV-associated protein in CuniNPV (46) but
was not identified by multiple approaches in AcMNPV (13).
DNA polymerase and helicase are conserved baculovirus
pro-teins shared by the ODVs of both AcMNPV and HearNPV,
but they were not detected in the CuniNPV ODV (46). The
identification of common structural proteins is essential to
elucidate the core structure of baculoviruses. Of the 10
con-served proteins, ODV-EC27, ODV-E56, GP41, VP39, P6.9,
and ODV-EC43 are known to be structural proteins. It is
interesting that P74 and PIF-2, which are essential for oral
infection, are also associated with the ODV. With more data
derived from different viruses becoming available, the
impor-tance and functions of these proteins can be further revealed.
In this study, approximately 41 ODV protein bands
sepa-rated by SDS-PAGE were subjected to MALDI-TOF MS
anal-ysis; 38 bands had matches to viral ORFs, while 3 bands did not
produce significant matches and were not identified by this
technique (Fig. 1 and Table 1). The finding of unmatched
bands suggested that additional host proteins may be present.
In vaccinia virus, MS techniques revealed 23 virion-associated
host proteins in addition to the 75 viral proteins (16). Our
HearNPV ODV data have not matched any host proteins; this
may be due to the lack of genetic information about or a
database for
H
.
armigera
. Some proteins of HearNPV ODV
were not identified, possibly because of their low molar content
in ODVs and/or resistance to staining or because some
pro-teins may not be amenable to MALDI-TOF MS. For example,
HA122 and PIF-2 have already been identified and located in
the HearNPV ODV (37, 20) but we were not able to detect
them in this study.
The degradation or losses of proteins during virus
purifica-tion could also affect protein detecpurifica-tion. Although HgCl
2 [image:7.585.122.462.68.275.2]treat-ment, heat inactivation of proteases, and a protease inhibitor
cocktail were used during the purification of virions, multiple
[image:7.585.44.286.354.679.2]FIG. 6. IEM of HA44 and HA100 and localization in HearNPV
ODVs and nucleocapsids (NC) of ODVs. A 1:100 dilution of
anti-HA44 or anti-HA100 antiserum was used as the primary antibody.
Preimmune serum was used as a negative control. A, IEM of HA44; B,
IEM of HA100. Bars, 100 nm.
FIG. 5. Western blot analysis of the HearNPV ODV/BV nucleocapsid (NC) and envelope (E) fractions with anti-HA44 and anti-HA100
antibodies. Healthy HzAM1 cells (H) and virus-infected cells (I) were loaded as negative and positive controls. VP80, ODV-E56, and the F protein
were detected by their specific antibodies for illustrating the NC-specific protein, ODV E-specific protein, and BV E-specific protein, respectively.
M, molecular size markers.
on November 8, 2019 by guest
http://jvi.asm.org/
bands of a single protein were still present in the gel, including
those of polyhedrin, VP39, GP41, P49, P33, E66,
ODV-E56, and ODV-E25 (Fig. 1 and Table 1). Similar results were
observed for a single protein during an investigation of the
CuniNPV ODV (46). Various factors can be responsible for
the fragility of some proteins, including the refractory profile
of alkaline proteases and the different methods used in virus
purification (11, 54); however, we cannot exclude the
possibil-ity of some protein degradation during the experimental
pro-cedures. On the other hand, there may be polymorphisms,
oligomerization, and posttranslational modification of the gene
products in the matrix of ODVs.
During data mining by MS-Fit, some peptide footprints were
matched to HearNPV ORFs but with a low MOWSE score,
such as
ha26
,
ie1
,
me53
,
bro
-
b
,
bro
-
c
,
alk
-
exo
,
pk1
,
ha133
(F-protein gene), etc. Therefore, they were not included as ODV
structural proteins in our results. Some of them, such as IE1,
Alk-exo, and the F protein, were found to be located in the
ODVs of AcMNPV (11), while the F protein and Bro were
identified in the ODVs of CuniNPV (46). The importance of
using multiple techniques to identify ODV structural proteins
has been elucidated by Braunagel et al. (11). We are using
antibodies against HearNPV ORFs to verify the protein
local-ization in the ODV by Western blot analysis and IEM.
Loca-tion of the above proteins in the ODV awaits confirmaLoca-tion
pending the preparation of specific antibodies.
Two structural proteins of HearNPV ODV, HA44 and HA100,
were newly identified here. ORF
ha44
contains a TAAG late
gene promoter motif, which is in agreement with its function as a
structural protein. Western blot analysis has confirmed that HA44
was a nucleocapsid component in both BV and ODV with a
molecular mass of 44 kDa. Homologues of HA44 were found in
all of the group II NPVs and GVs whose complete sequences
have been determined but not in group I NPVs or dipteran or
hymenopteran baculoviruses. It is generally believed that GVs
separated from the ancestor of NPVs and GVs before the
radi-ation of group I and group II NPVs (35). It is therefore likely that
the ancestor of HA44 existed in both NPV and GV but was lost
during the emergence of group I NPVs.
Western blot analysis and IEM revealed that HA100 is a
component of the nucleocapsid and the envelope of ODV.
HA100 is conserved in all group II NPVs, and it is a
homo-logue of PARG. PARG is critical for the maintenance of
steady-state poly(ADP-ribose) levels and plays important roles
in modulating chromatin structure, transcription, DNA repair,
and apoptosis (6). It is interesting that the members of NPV
group II encode a PARG-like protein as a structural protein. It
remains to be determined whether the PARG-like proteins in
group II NPVs are enzymatically functional.
With the knowledge of baculovirus ODV composition, it is
possible to study the functions of the relevant proteins and
their potential role during virus primary infection (11). In this
study, we identified two new ODV structural proteins, HA44
and HA100. Currently we are investigating the biological
func-tions of these two proteins.
ACKNOWLEDGMENTS
This work was supported by a 973 project (2003CB114202), an
NSFC key project from China (30630002), and a joint PSA project
from China and The Netherlands (2004CB720404).
We acknowledge the State Key Laboratory of Virology
Proteom-ics/MS Center (Wuhan University) and Shanghai GeneCore
Bio-Technologies Co. Ltd. for technical support. We thank Jian-Lan Yu
and Fang-Ke Huang for assistance with the experiments.
REFERENCES
1.Altschul, S. F., W. Gish, W. Miller, E. W. Meyers, and D. J. Lipman.1992.
Basic local alignment search tool. J. Mol. Biol.215:403–410.
2.Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl.1994. Current protocols in molecular biology. Greene and Wiley InterScience, New York, NY.
3.Belyavskyi, M., S. C. Braunagel, and M. D. Summers.1998. The structural protein ODV-EC27 of Autographa californica nucleopolyhedrovirus is a
multifunctional viral cyclin. Proc. Natl. Acad. Sci. USA95:11205–11210.
4.Blissard, G., and J. R. Wenz.1992. Baculovirus gp64 envelope glycoprotein
is sufficient to mediate pH-dependent membrane fusion. J. Virol.66:6829–
6835.
5.Blissard, G., B. Black, N. Crook, B. A. Keddie, R. Possee, G. Rohrmann, D. Theilmann, and L. E. Volkman.2000.Baculoviridae: taxonomic structure
and properties of the family, p. 195–202.InM. H. V. van Regenmortel, C. M.
Fauquet, D. H. L. Bishop, E. B. Carstens, M. K. Estes, S. M. Lemon, J. Maniloff, M. A. Mayo, D. J. McGeoch, C. R. Pringle, and E. B. Wickner (ed.), Virus taxonomy: classification and nomenclature of viruses. Seventh report of the International Committee on Taxonomy of Viruses. Academic Press, San Diego, CA.
6.Bonicalzi, M. E., J. F. Haince, A. Droit, and G. G. Poirier.2005. Regulation of poly(ADP-ribose) metabolism by poly(ADP-ribose) glycohydrolase:
where and when? Cell. Mol. Life Sci.62:739–750.
7.Braunagel, S. C., and M. D. Summers.1994.Autographa californicanuclear polyhedrosis virus, PDV, and ECV viral envelopes and nucleocapsids:
struc-tural proteins, antigens, lipid and fatty acid profiles. Virology202:315–328.
8.Braunagel, S. C., D. M. Elton, H. Ma, and M. D. Summers.1996.
Identifi-cation and analysis of anAutographa californicanuclear polyhedrosis virus
structural protein of the occlusion-derived virus envelope: ODV-E56.
Virol-ogy217:97–110.
9.Braunagel, S. C., H. He, P. Ramamurthy, and M. D. Summers.1996. Tran-scription, translation, and cellular localization of three Autographa califor-nica nuclear polyhedrosis virus structural proteins: ODV-E18, ODV-E35,
and ODV-EC27. Virology222:100–114.
10.Braunagel, S. C., P. A. Guidry, G. Rosas-Acosta, L. Engelking, and M. D. Summers.2001. Identification of BV/ODV-C42, an Autographa californica
nucleopolyhedrovirusorf101-encoded structural protein detected in
infected-cell complexes with ODV-EC27 and p78/83. J. Virol.75:12331–12338.
11.Braunagel, S. C., W. K. Russell, G. Rosas-Acosta, D. H. Russell, and M. D. Summers.2003. Determination of the protein composition of the
occlusion-derived virus of Autographa californicanucleopolyhedrovirus. Proc. Natl.
Acad. Sci. USA100:9797–9802.
12.Chen, X. W., W. F. J. IJkel, C. Dominy, P. M. de Andrade Zanotto, Y. Hashimoto, O. Faktor, T. Hayakawa, H. Wang, A. Premkumar, S. Matha-van, P. J. Krell, Z. Hu, and J. M. Vlak.1999. Identification, sequence analysis and phylogeny of the lef-2 gene of Helicoverpa armigera single-nucleocapsid
baculovirus. Virus Res.65:21–32.
13.Chen, X. W., W. F. J. IJkel, R. Tarchini, X. L. Sun, H. Sandbrink, H. L. Wang, S. Peters, D. Zuidema, R. K. Lankhorst, J. M. Vlak, and Z. H. Hu.
2001. The sequence of theHelicoverpa armigerasingle nucleocapsid
nucleo-polyhedrovirus genome. J. Gen. Virol.82:241–257.
14.Chen, X. W., Z. H. Hu, and J. M. Vlak.1997. Nucleotide sequence analysis
of the polyhedrin gene of Heliothis armigerasingle nucleocapsid nuclear
polyhedrosis virus. Virol. Sin.12:346–353.
15.Chen, X. W., Z. H. Hu, J. A. Jehle, and J. M. Vlak.1997. Characterization of
the ecdysteroid UDP-glucosyltransferase gene ofHeliothis armigera
single-nucleocapsid nucleopolyhedrovirus. Virus Genes15:219–225.
16.Chung, C. S., C. H. Chen, M. Y. Ho, C. Y. Huang, C. L. Liao, and W. Chang.
2006. Vaccinia virus proteome: identification of proteins in vaccinia virus
intracellular mature virion particles. J. Virol.80:2127–2140.
17.D’Amours, D., S. Desnoyers, I. D’Silva, and G. G. Poirier.1999. Poly(ADP-ribosyl)ation reactions in the regulation of nuclear functions. Biochem. J.
342:249–268.
18.Dong, C., D. Li, G. Long, F. Deng, H. Wang, and Z. Hu.2005. Identification of functional domains of HearNPV P10 for filament formation. Virology
338:112–120.
19.Fang, M. G., H. Wang, L. Yuan, X. W. Chen, J. M. Vlak, and Z. H. Hu.2003.
Open reading frame 94 ofHelicoverpa armigerasingle nucleocapsid
nucle-opolyhedrovirus encodes a novel occlusion-derived virion protein,
ODV-EC43. J. Gen. Virol.84:3021–3027.
20.Fang, M. G., Y. Nie, Q. Wang, F. Deng, R. Wang, H. Wang, H. Wang, J. M. Vlak, X. Chen, and Z. Hu.2006. Open reading frame 132 of Heliocoverpa armigera nucleopolyhedrovirus encodes a functional per os infectivity factor
(PIF-2). J. Gen. Virol.87:2563–2569.
21.Faulkner, P., J. Kuzio, G. V. Williams, and J. A. Wilson.1997. Analysis of p74, a PDV envelope protein of Autographa californica
nucleopolyhedrovi-9384
DENG ET AL.
J. V
IROL.
on November 8, 2019 by guest
http://jvi.asm.org/
rus required for occlusion body infectivity in vivo. J. Gen. Virol.78:3091– 3100.
22.Guan, K. L., and J. E. Dixon.1991. Eukaryotic proteins expressed in Esch-erichia coli: an improved thrombin cleavage and purification procedure of
fusion proteins with glutathioneS-transferase. Anal. Biochem.192:262–267.
23.Herniou, E. A., J. A. Olszewski, D. R. O’Reilly, and J. S. Cory.2004. Ancient
coevolution of baculoviruses and their insect hosts. J. Virol.78:3244–3251.
24.Herniou, E. A., J. A. Olszewski, J. S. Cory, and D. R. O’Reilly.2003. The genome sequence and evolution of baculoviruses. Annu. Rev. Entomol.
48:211–234.
25.Hirosawa, M., M. Hoshida, M. Ishikawa, and T. Toya.1993. MASCOT: multiple alignment system for protein sequences based on three-way
dy-namic programming. Comput. Appl. Biosci.9:161–167.
26.Hong, T., S. C. Braunagel, and M. D. Summers.1994. Transcription, trans-lation, and cellular localization of PDV-E66: a structural protein of the PDV
envelope ofAutographa californicanuclear polyhedrosis virus. Virology204:
210–222.
27.IJkel, W. F., M. Westenberg, R. W. Goldbach, G. W. Blissard, J. M. Vlak, and D. Zuidema.2000. A novel baculovirus envelope fusion protein with a
proprotein convertase cleavage site. Virology275:30–41.
28.IJkel, W. F., R. J. Lebbink, M. L. Op den Brouw, R. W. Goldbach, J. M. Vlak, and D. Zuidema.2001. Identification of a novel occlusion derived
virus-specific protein inSpodoptera exiguamulticapsid nucleopolyhedrovirus.
Vi-rology284:170–181.
29.Jehle, J. A., M. Lange, H. Wang, Z. Hu, Y. Wang, and R. Hauschild.2006. Molecular identification and phylogenetic analysis of baculoviruses from
Lepidoptera. Virology346:180–193.
30.Keddie, B. A., G. W. Aponte, and L. E. Volkman.1989. The pathway of
infection ofAutographa californicanuclear polyhedrosis virus in an insect
host. Science243:1728–1730.
31.Kikhno, I., S. Gutierrez, L. Croizier, G. Croizier, and M. L. Ferber.2002. Characterization of pif, a gene required for the per os infectivity of
Spo-doptera littoralis nucleopolyhedrovirus. J. Gen. Virol.83:3013–3022.
32.Kool, M., C. H. Ahrens, R. W. Goldbach, G. F. Rohrmann, and J. M. Vlak.
1994. Identification of genes involved in DNA replication of the Autographa
californica baculovirus. Proc. Natl. Acad. Sci. USA91:11212–11216.
33.Kumar, S., K. Tamura., and M. Nei.2004. MEGA3: integrated software for molecular evolutionary genetics analysis and sequence alignment. Brief.
Bioinform.5:150–163.
34.Kuzio, J., R. Jaques, and P. Faulkner.1989. Identification of p74, a gene
essential for virulence of baculovirus occlusion bodies. Virology173:759–
763.
35.Lange, M., H. Wang, Z. Hu, and J. A. Jehle.2004. Towards a molecular identification and classification system of lepidopteran-specific
baculovi-ruses. Virology325:36–47.
36.Long, G., M. Westenberg, H. L. Wang, J. M. Vlak, and Z. H. Hu.2006.
Function, oligomerization and N-linked glycosylation of theHelicoverpa
ar-migeraSNPV envelope fusion protein. J. Gen. Virol.87:839–846. 37.Long, G., X. W. Chen, D. Peters, J. M. Vlak, and Z. H. Hu.2003. Open
reading frame 122 ofHelicoverpa armigerasingle nucleocapsid
nucleopoly-hedrovirus encodes a novel structural protein of occlusion-derived virions.
J. Gen. Virol.84:115–121.
38.Lu, A., and E. B. Carstens.1992. Nucleotide sequence and transcriptional
analysis of the p80 gene ofAutographa californicanuclear polyhedrosis virus:
a homologue of the Orgyia pseudotsugata nuclear polyhedrosis virus
capsid-associated gene. Virology190:201–209.
39.McIntosh, A. H., and C. M. Ignoffo.1983. Characterization of 5 cell lines
established from species ofHeliothis. Appl. Entomol. Zool.18:262–269.
40.Monsma, S. A., A. G. Oomens, and G. W. Blissard.1996. The GP64 envelope fusion protein is an essential baculovirus protein required for cell-to-cell
transmission of infection. J. Virol.70:4607–4616.
41.Muller, R., M. N. Pearson, R. L. Russell, and G. F. Rohrmann.1990. A capsid-associated protein of the multicapsid nuclear polyhedrosis virus of
Orgyia pseudotsugata: genetic location, sequence, transcriptional mapping,
and immunocytochemical characterization. Virology176:133–144.
42.Notredame, C., D. Higgins, and J. Heringa.2000. T-Coffee: a novel method
for multiple sequence alignments. J. Mol. Biol.302:205–217.
43.Patel, C. N., D. W. Koh, M. K. Jacobson, and M. A. Oliveira.2005. Identi-fication of three critical acidic residues of poly(ADP-ribose) glycohydrolase involved in catalysis: determining the PARG catalytic domain. Biochem. J.
388:493–500.
44.Pearson, M. N., C. Groten, and G. F. Rohrmann.2000. Identification of the
Lymantria disparnucleopolyhedrovirus envelope fusion protein provides
ev-idence for a phylogenetic division of theBaculoviridae. J. Virol.74:6126–
6131.
45.Pearson, M. N., R. L. Russell, G. F. Rohrmann, and G. S. Beaudreau.1988. p39, a major baculovirus structural protein: immunocytochemical
character-ization and genetic location. Virology167:407–413.
46.Perera, O., T. B. Green, S. M. Stevens, Jr., S. White, and J. J. Becnel.2007.
Proteins associated withCulex nigripalpusnucleopolyhedrovirus occluded
virions. J. Virol.81:4585–4590.
47.Pham, D. Q., R. H. Hice, N. Sivasubramanian, and B. A. Federici.1993. The 1629-bp open reading frame of the Autographa californica multinucleocap-sid nuclear polyhedrosis virus encodes a virion structural protein. Gene
137:275–280.
48.Prikhod’ko, G. G., Y. Wang, E. Freulich, C. Prives, and L. K. Miller.1999. Baculovirus p33 binds human p53 and enhances p53-mediated apoptosis.
J. Virol.73:1227–1234.
49.Rohrmann, G. F.1986. Polyhedrin structure. J. Gen. Virol.67:1499–1513. 50.Rohrmann, G. F.1992. Baculovirus structural proteins. J. Gen. Virol.73:
749–761.
51.Russell, R. L., and G. F. Rohrmann.1993. A 25-kDa protein is associated
with the envelopes of occluded baculovirus virions. Virology195:532–540.
52.Russell, R. L., C. J. Funk, and G. F. Rohrmann.1997. Association of a
baculovirus-encoded protein with the capsid basal region. Virology227:142–
152.
53.Shevchenko, A., M. Wilm, O. Vorm, and M. Mann.1996. Mass spectrometric
sequencing of proteins silver-stained polyacrylamide gels. Anal. Chem.68:
850–858.
54.Summers, M. D., and G. E. Smith.1975.Trichoplusia nigranulosis virus
granulin: a phenol-soluble, phosphorylated protein. J. Virol.16:1108–1116.
55.Sun, X. L., G. Y. Zhang, Z. X. Zhang, Z. H. Hu, J. M. Vlak, and B. M. Arif.
1998. In vivo cloning ofHelicoverpa armigerasingle nucleocapsid nuclear
polyhedrosis virus genotypes. Virol. Sin.13:83–88.
56.Sun, X. L., and G. Y. Zhang.1994. A comparison of four wild isolates of
Heliothisnuclear polyhedrosis virus. Virol. Sin.9:309–318.
57.Thiem, S. M., and L. K. Miller.1989. Identification, sequence, and tran-scriptional mapping of the major capsid protein gene of the baculovirus
Autographa californicanuclear polyhedrosis virus. J. Virol.63:2008–2018. 58.Thompson, J. D., T. J. Gibson, F. Plewniak, F. Jeanmougin, and D. G.
Higgins.1997. The ClustalX Windows interface: flexible strategies for mul-tiple sequence alignment aided by quality analysis tools. Nucleic Acids Res.
24:4876–4882.
59.Vialard, J. E., and C. D. Richardson.1993. The 1,629-nucleotide open
reading frame located downstream of theAutographa californicanuclear
polyhedrosis virus polyhedrin gene encodes a nucleocapsid-associated
phos-phoprotein. J. Virol.67:5859–5866.
60.Wang, H., D. Wu, F. Deng, H. Peng, X. Chen, H. Lauzon, B. M. Arif, J. A. Jehle, and Z. Hu.2004. Characterization and phylogenetic analysis of the
chitinase gene from theHelicoverpa armigerasingle nucleocapsid
nucleopoly-hedrovirus. Virus Res.100:179–189.
61.Wang, H., X. W. Chen, B. M. Arif, J. M. Vlak, and Z. H. Hu.2001. Nucleotide sequence and transcriptional analysis of a putative basic DNA-binding
pro-tein ofHelicoverpa armigeranucleopolyhedrovirus. Virus Genes22:113–120.
62.Washburn, J. O., B. A. Kirkpatrick, and L. E. Volkman.1995. Comparative
pathogenesis ofAutographa californicaM nuclear polyhedrosis virus in larvae
ofTrichoplusia niandHeliothis virescens. Virology209:561–568.
63.Whitford, M., and P. Faulkner.1992. A structural polypeptide of the
bacu-lovirusAutographa californicanuclear polyhedrosis virus contains O-linked
N-acetylglucosamine. J. Virol.66:3324–3329.
64.Whitford, M., and P. Faulkner.1992. Nucleotide sequence and transcrip-tional analysis of a gene encoding gp41, a structural glycoprotein of the
baculovirusAutographa californicanuclear polyhedrosis virus. J. Virol.66:
4763–4768.
65.Wilson, M. E., and K. H. Price.1988. Association of Autographa californica nuclear polyhedrosis virus (AcMNPV) with the nuclear matrix. Virology
167:233–241.
66.Wilson, M. E., T. H. Mainprize, P. D. Friesen, and L. K. Miller.1987. Location, transcription, and sequence of a baculovirus gene encoding a small
arginine-rich polypeptide. J. Virol.61:661–666.
67.Wu, D., F. Deng, X. Sun, H. Wang, L. Yuan, J. M. Vlak, and Z. Hu.2005.
Functional analysis of FP25K ofHelicoverpa armigerasingle nucleocapsid
nucleopolyhedrovirus. J. Gen. Virol.86:2439–2444.
68.Yao, L., W. Zhou, H. Xu, Y. Zheng, and Y. Qi.2004. The Heliothis armigera single nucleocapsid nucleopolyhedrovirus envelope protein P74 is required
for infection of the host midgut. Virus Res.104:111–121.
69.Ying, W., M. B. Sevigny, Y. Chen, and R. A. Swanson.2001. Poly(ADP-ribose) glycohydrolase mediates oxidative and excitotoxic neuronal death.
Proc. Natl. Acad. Sci. USA98:12227–12232.
70.Zanotto, P. M., B. D. Kessing, and J. E. Maruniak. 1993. Phylogenetic interrelationships among baculoviruses: evolutionary rates and host
associ-ations. J. Invertebr. Pathol.62:147–164.
71.Zhang, G.1994. Research, development and application ofHeliothisviral
pesticide in China. Resour. Environ. Yangtze Valley3:1–6.
on November 8, 2019 by guest
http://jvi.asm.org/