Vol.59, No. 2 JOURNALOFVIROLOGY, Aug. 1986, p. 341-353
0022-538X/86/080341-13$02.00/0
Copyright (C 1986,American Society forMicrobiology
Structure and Transforming
Function of Transduced
Mutant
Alleles
of the Chicken
c-myc
Gene
TILO PATSCHINSKY,' HANS W.
JANSEN,1t
HELMUTBLOCKER,2
RONALD FRANK,2 AND KLAUSBISTER1*
Otto-Warburg-Laboratoriium, Max-Planck-Institutfiir Molekulare Genetik, D-1000Berlini33 (Dahlem),' antdDNA-Synthese-Gruppe, Gesellschaft fur Biotechnologische Forschung mnbH, D-3300Braunschweig,2 Federal
Republic ofGermany
Received 6 January 1986/Accepted 7 April 1986
Asmall retroviral vectorcarryinganoncogenicmycallelewasisolated as aspontaneous variant (MH2E21)
of avian oncovirus MH2. The MH2E21 genome, measuringonly 2.3 kilobases, can be replicated like larger
retroviralgenomesand hence containsall cis-acting sequenceelements essentialfor encapsidation andreverse transcription of retroviral RNAorforintegration and transcription of proviralDNA. The MH2E21 genome contains5' and3' noncoding retroviralvectorelements andacoding region comprising the first six codons of the viralgaggeneand 417v-myccodons. Thegag-mycjunction corresponds preciselytothe presumed splice
junctiononsubgenomicMH2v-mycmRNA,thepossible origin of MH2E21.Among thev-myccodons, thefirst 5arederivedfrom the noncoding 5' terminus ofthe secondc-myc exon,and412 codons correspondtothec-myc coding region.Thepredictedsequenceof the MH2E21 proteinproductdiffersfrom thatofthe chickenc-myc protein by11additional amino-terminal residuesand by25amino acid substitutions andadeletion of 4 residues withinthe shareddomains. Toinvestigatethefunctional significance ofthese structural changes, the MH2E21 genome was modified in vitro. The gag translational initiation codon was inactivated by oligonucleotide-directed mutagenesis. Furthermore, all but two of the missense mutations were reverted, and the deleted
sequences wererestored by replacing mostof theMH2E21 v-mycallele by the correspondingsegmentofthe
CMIIv-mycallele which isisogenictoc-mycinthatregion. Theremainingtwomutations havenotbeen found
inthev-mycallelesof avianoncovirusesMC29, CMII,andOK10. Like MH2 andMH2E21,modified MH2E21
(MH2E21m1cI) transformsavianembryo cells. Likec-myc,itencodesa416-amino-acidprotein initiatedatthe myctranslational initiation codon.We conclude thatneither majorstructuralchanges, suchasin-framefusion withvirion genes orinternal deletions, norspecific,ifany,missense mutationsofthec-myccoding region are
necessaryforactivation of the basiconcogenicfunction of transducedmycalleles.
The transformation-specific oncogenes (v-onc genes) of
highly oncogenic retroviruses represent transduced mutant
alleles of normal cellular genes (c-onc genes or proto-oncogenes). Proto-oncogenesareobviously nononcogenicin
their normal cellularenvironment,andmostofthem
presum-ably fulfil essential physiological functions in normal cell growth and development. The transition from a normal chromsomal allele to a transduced mutant allele with
oncogenic function is always accompanied by multiple changesin genestructure and controlofgeneexpression. It islargely unknown which ofthe qualitative or quantitative changes in gene structure and expression are necessary or evensufficient foroncogenic activation (4, 5, 7, 59;K.Bister and H. W.Jansen, Adv. Cancer Res., inpress).
The chicken c-myc gene is composed of three exons and two intervening sequences (32, 47, 52, 60, 65). The open
reading frame encoding a 416-amino-acid protein extends
fromatranslational initiation codon within the secondexon to a termination codon within the third exon (65). The
corresponding protein product with an apparent molecular
weight of 58,000 was identified in extracts from normal chicken cells (2, 16). Transduced mutant alleles of the
chicken c-myc gene have been found in different genetic
contexts in the genomes of four highly oncogenic
indepen-dentretroviral isolates: MC29, CMII,OK10, andMH2(5, 6; Bister and Jansen, in press). All four v-myc alleles contain
* Correspondingauthor.
t Present address: Hoechst AG, D-6230 Frankfurt 80, Federal Republic ofGermany.
nontruncated and precisely fused coding regions from the second and third exon of the cellular gene, but lack any sequences from the first (noncoding) exon and various 3'
complements fromthe untranslatedregion ofthe thirdexon
(1, 17, 22, 26, 45, 56, 57, 62). The MC29, OK10, and MH2 v-myc alleles also contain sequences derived from the first
c-mye
intron. Within the coding domains, the transduced alleles differ from their common cellular progenitor by various nucleotide substitutions and, in the case of MH2 v-myc, by a small in-frame deletion. The MC29, CMII, and OK10 v-myc alleles arefused in frame with virion genes andareexpressedviagenome-sized mRNAs asgag-myc(MC29, CMII)orgag-pol-myc (OK10)hybrid proteinswith apparent
molecular weights of 110,000, 90,000, and 200,000,
respec-tively(8, 9, 11, 44). TheOK10 v-mnvc allele is alsoexpressed
via subgenomicmRNA as a60,000-molecular-weight protein
which presumably contains 11 amino-terminal amino acid
residues specified by the first six gag codons present in the leader sequence andfive codons derived from thenoncoding
5' terminus ofthe second c-inve exon in addition to amino
acid residuesencodedby sequencesderived from thec-inye coding region (2, 12, 16, 17, 42). The MH2 v-inyc allele is
expressed via subgenomic mRNA as a 59,000/61,000-molecular-weight protein whose amino terminus is
pre-sumably structured like that of the OK10
60,000-molec-ular-weight protein (16, 22, 39, 42). MH2 carries another cell-derived oncogene,
v-m71il,
which is expressed via genome-sized mRNA as agag-mil hybrid protein(19-21, 23, 25). Insummary, theprotein products ofalltransduced myc alleles differ from the c-myc protein bytheir modified amino341
on November 10, 2019 by guest
http://jvi.asm.org/
342 PATSCHINSKY ET AL.
termini and by various substitutions and (for MH2) a small deletion of amino acid residues. Recent analyses of the genetic structures and biological properties of spontaneous orconstructed mildeletion mutants of MH2 have revealed that expression of the MH2 v-myc allele is sufficient for the transformation of avian embryo cells (3, 22, 24, 66). This result demonstrated that at least for this allele, in-frame fusion with large complements of virion genes or concomi-tant expression of a second oncogene is not essential for transforming function. However, the question remained whether the amino-terminal modification and the substitu-tions and delesubstitu-tions of amino acidresidues are relevant to the function of the MH2 v-myc protein product.
Based on the molecular and biological properties of new spontaneous and constructed derivatives of MH2, we now present evidence thatneither major structural modifications nor specific, if any, missense mutations of the c-myc coding region arenecessary for oncogenic activation upon transduc-tion.
MATERIALS AND METHODS
Cells and viruses. Quail eggs were purchased from Gutsverwaltung Schomberg, Gemmingen-Schomberg, and chicken eggs were obtained from Lohmann Tierzucht, Cuxhaven. Quail and chicken embryo cells were prepared from 9-day-old embryos as described elsewhere (61). Nonproducer quail cell lines transformed by v-myc-carrying avian retroviruses OK10 or MH2 (line A103) have been described previously (11, 22). Focus and soft-agar colony assays of transformed cells were performed as described previously (8, 61). The nonproducer quail cell line E21 transformed by the MH2 derivative MH2E21 was derived from a focus picked in an assay designed to isolate nonproducer cells transformed by partial mil deletion mu-tants of MH2 (compare Results section).
Analyses of virion production and viral RNA. Viral particle production wasanalyzed by measuring reversetranscriptase activity essentially as described previously (8), except that the final reaction mixture contained 2 mM each of dATP, dCTP, and dGTP, or by dot blot hybridization analysis of viral RNA. The dot blot analyses were carried out as described elsewhere (10, 58), except that the conditions for the hybridization reactions were as described by Jansen et al. (20, 21). The molar ratio of transforming to helper viral RNAs inpseudotype virus stocks was determined by RNA dot blot analysis with gene-specific (gag and myc) hybrid-ization probes (see below).
Molecular cloning and structural analysis of proviral DNA. Preparation ofhigh-molecular-weight DNA from E21 cells, digestion with restriction enzymes, separation of DNA frag-ments by agarose gel electrophoresis, transfer of DNA to nitrocellulose sheets, and hybridization to DNA probes radioactively labeled by nick translation were performed essentially as described previously (20-23, 62). The follow-ing plasmid clones were used as hybridization probes: pMC29-SB, containing a1.1-kilobase-pair (kbp)SalI-BamHI
fragment ofMC29 proviral DNA representing the 3' half of v-myc (22); pMH2-B, containing a 1.4-kbpBamHI fragment from the MH2 gag sequences (22); and pRAV-LTR, con-taining the entire provirus ofRous-associated virus type 1 (RAV-1) (provided by B. Vennstrom).
Molecular cloning of integrated proviral DNA from E21 cells was performed essentially by the method described previously (22). Briefly, a partial pBR322 recombinant li-brary of E21 cellular DNA was prepared asfollows. A 2-,ug
sample of the 2- to 3-kbp fraction of EcoRI-digested E21 DNA was ligated with 0.4 FLg of EcoRI-digested and
dephosphorylated pBR322 DNA, and the ligation mixture wasusedtotransform competent bacteria. A total of 2 x 105
independent recombinants was obtained. Colony screening
with the 3' myc-specific probe led to the isolation ofplasmid
clonepMH2E21-E containingthe2.3-kbp EcoRI fragment of MH2E21 proviral DNA. Procedures for the subcloning of
proviral DNA fragments have been described previously (62). Plasmid clones pMH2 (formerly termed pMH2-E),
containing
the entire MH2 proviral genome, and pCMII-E, containing most of the CMII proviral genome, have beenisolated and characterized previously (21, 23, 24, 62). Nucleotide sequenceanalysis by the dideoxy chain termi-nation method (48) with the M13 vectors mpl8 and mpl9 and
35S-labeled dATP-S (650 Ci/mmol; Amersham Buchler
GmbH, Braunschweig, Federal Republic ofGermany) was
carried out as described previously (19, 37, 62). The
se-quencing strategyemploying forced cloning of defined
frag-ments ofproviral DNAis outlined in the Results section. Oligonucleotide-directed mutagenesis. The hexadeca-nucleotide 5'-d(GCTTCCAGGCTTGATC)-3' was
synthe-sized by the segmental solid-support approach and phosphorylated asdescribed previously (14). In vitro
muta-genesis was carried out by the gapped-duplex-DNA proce-dure(29, 37). The 0.6-kbp EcoRI-PstI fragment of MH2E21
proviral DNA containing the gag ATG initiation codon as
the targetsite was cloned into M13mpl8am. This vectorwas
constructed by ligating a 0.7-kbp EcoRI-BglII fragment of M13mpl8 DNA containing the multiplecloning site with the large EcoRI-BglII fragment of M13mp8 DNA carrying the amber mutations. Viral plus-strand M13mpl8am DNA
con-tainingthe insert DNA was annealed with denatured DNA of the large EcoRI-PstI fragment of wild-type M13mpl8 replicative form DNA. The gapped duplex containing single-stranded insert DNA was annealed with the synthetic oligo-nucleotide, and remaining gaps on the minus-strand DNA were filled and sealed enzymatically by incubation with DNA polymerase I (large fragment) and T4 DNA ligase, respectively (29). The heteroduplex DNA was used to
trans-form Escherichia coli BMH71-18mutS, which suppresses amber mutations and is deficient in DNA mismatch repair (29). Clones containing the synthetic marker were selected
fromthephage progeny by plating on strain MK30-3, which does not suppress ambermutations (29). Themutation in the
0.6-kbp EcoRI-PstI fragment was confirmed by nucleotide sequencing, and the fragment was reinserted into MH2E21 proviral DNA.
DNA transfection. Transfection of cloned proviral DNAs onto quail embryo cells was performed as described previ-ously (62), except thathelper virus was providedby
cotrans-fection with pRAV-LTR DNA rather thanby superinfection. A total of 10 ,ug of DNA (including the amount of proviral DNA specified in the Results section and quail embryo cell DNA as carrier) was transfected onto each 6-cm dish of recipient cells. Focus formation of transformed cells was
then assayed by two different protocols described in the Results section.
Analysis of proteins. Subconfluent cell cultures were la-beledfor 2 h with 200,uCiof[35S]methionine (1,000Ci/mmol;
Amersham Buchler GmbH) per ml ofmethionine-free mini-mumessential medium (GIBCO Europe GmbH, Karlsruhe,
Federal Republic of Germany) supplemented with 5% dia-lyzed calf serum. Labeling was done with a total of 200,400, or600,uCi for culture dishes with diameters of3.5, 6, or 10
cm, respectively. Heat- and sodium dodecyl
sulfate-J. VIROL.
on November 10, 2019 by guest
http://jvi.asm.org/
ONCOGENIC myc ALLELES 343
denatured lysateswerepreparedasdescribed elsewhere (13, 22, 41). Briefly, cells were scraped into 0.1, 0.2, or 0.6 ml
(depending on the size of the dish) of 10 mM sodium phosphate (pH
7.2)-0.5%
sodium dodecyl sulfate-1%tra-sylol-1 mM dithiothreitol. Lysates were boiled for 2 min,
cooled on ice, and diluted with 4 volumes of a buffer containing 10 mM sodium phosphate (pH 7.2), 150 mM
NaCl, 1% sodium deoxycholate, 1% Nonidet P-40, 1% trasylol, and 1 mMdithiothreitol. Proteinswereprecipitated from portions of clarified lysates with rabbit antisera raised against whole disrupted virions ofRous sarcomavirus(RSV) (8, 21)oragainstasynthetic peptide
specific
forthecarboxyl
terminus of myc-encoded proteins (42). Theappropriate
amountofserum wasappliedas adilutionin 200 ,ulof10 mM
sodium phosphate (pH
7.2)-150
mM NaCl-0.1% sodium dodecyl sulfate-1% sodiumdeoxycholate-1%
Nonidet P-40-1% trasylol-2 mg of bovine serum albumin per ml(RIPA/BSA).
Immunecomplexes
were collectedby
theaddition of 200,ul ofa1%
(wt/vol)
suspension (in
RIPA/BSA)
of fixed Staphylococcus aureus cells(Pansorbin;
Calbio-chemGmbH,
Frankfurt,
FederalRepublic
ofGermany)
which had been pretreated byboiling
in 10 mM sodium phosphate (pH7.2)-150
mMNaCl-3%
sodiumdodecyl
sulfate-10%mercaptoethanol (46).
Polyacrylamide-sodium
dodecyl sulfate gel electrophoresis and
fluorography
wereperformed as describedelsewhere
(21, 22, 41,
42).
RESULTS
Origin and genetic structure ofMH2E21. We have
previ-ously described the in vitro construction of a
partial
mildeletion mutant of MH2
(24).
In a focus assay ofquail
embryo
cells infected with a stock of that mutant, atrans-formed cell clone was isolated and
developed
into anonproducer line (E21).
Analysis
ofvirus-specific
protein
synthesis
showed that E21 cells contained a v-mycprotein
product of
59,000/61,000
molecularweight
indistinguishable
fromthatofwild-type MH2, but no
proteins precipitable
by
antiserumagainst
virion structuralproteins (Fig.
1).
Trans-forming retrovirus
(MH2E21)
could be rescuedefficiently
from E21 nonproducer cells
by
superinfection
withhelper
virus. MH2E21pseudotype virusstockswere alsoobtained by cotransfection of cloned MH2E21 and
helper
proviral
DNAs onto quail embryo cells (see
below).
Viruswas thenharvested from
completely
transformed cultures obtained afterrepeated
passaging
of therecipient
cells. The titer offocus-forming
units(FFU)
in thesepseudotype
virus stocks (approximately0.5 x 103FFU/ml)
was about20- to30-fold lower than that ofwild-type
MH2 stocksgenerated by
thesame
procedure
with the samehelper
virus(RAV-1).
Theanalyses of viral
particle
production
and of viral RNAcomposition
in theseparticles
arelargely
inagreement withthe observed differences in the titersof
transforming
virus. As determined by both reversetranscriptase
assays andRNA dot blot analyses, MH2-transformed
quail
cells coinfected withhelper
virus(RAV-1)
released about threetimes morevirus
particles
permilliliter of culture fluid thanMH2E21-transformed cells coinfected with the same
helper
virus.Furthermore,the molarratioof
transforming
tohelper
viral RNAs determinedby dot blot
analysis
with myc- andgag-specific probes
wasabout three timeshigher
inpseudo-type
particles
releasedby
MH2-transformed cells(approxi-mately 0.6)than in those released
by
MH2E21-transformedcultures
(approximately
0.2).Together,
these resultswouldaccountforan
approximately
10-foldreduction in the titer oftransforming virus in infectious MH2E21 stocks
compared
with MH2 stocks.
1 2 3 4 5 6 7 8
100
gag-mitf
-
~~~p59/61
FIG. 1. Proteins encodedbyMH2andMH2E21.Cultures of the
nonproducerquailcell linesE21(lanes 1, 2, 5,and6)orA103(lanes
3, 4, 7,and8)transformed
by
MH2E21orMH2,respectively,
were labeled with [35S]methionine, and heat- anddetergent-denatured
proteins in cellularlysates
wereimmunoprecipitated.
Eachprecip-itatewaspreparedfrom the
lysate
of 1.8x101
E21 cells(containing
107cpm) orof 0.9 x 105A103 cells(containing
107cpm),
respec-tively,with1 ,ulof either
preimmune
rabbitserum(lanes1and3)or rabbitserumagainstwholedisrupted
RSV(lanes
2 and4).Precipi-tates with 20
p.g
of the totalimmunoglobulin
G fractionofarabbit serumagainst
acarboxy-terminal
myc-specific
synthetic peptide
(lanes5 and7)orwith thesameamountofserum
preadsorbed
tothepeptide (1
,ug/,ug
ofimmunoglobulin
G; lanes6and8)wereobtained fromlysates
of cells labeled ina separateexperiment.
Theprecipi-tates werepreparedfromthe
lysate
of 2.8x 105 cells(containing
1.2 x 107 cpm) ofthe E21 orA103 line, respectively.Equal
portions
(20%)
of allprecipitates
wereanalyzed by
electrophoresis
on12.5%polyacrylamide-sodium
dodecyl
sulfategels.
Thefluorographs
wereexposed
for 19 h(lanes1through
4)or6days
(lanes5through
8).To
identify
MH2E21proviral
DNA,
high-molecular-weight
DNAfrom E21nonproducer
cells wasdigested
withEcoRI,
andelectrophoretically
separated digestion products
weretransferredtoanitrocellulosefilter and
hybridized
witha
myc-specific probe
(pMC29-SB).
Inadditiontotheendog-enous
quail
c-myc DNAfragment,
asingle
fragment
of2.3kbp
hybridized
with the mycprobe
(Fig.
2A).
The sameDNA
fragment
alsohybridized
with acomplete
helper
proviral probe (pRAV-LTR),
but not with an internalgag-specific
probe (pMH2-B)
(not
shown).
The2.3-kbp
EcoRIfragment
wasmolecularly
cloned,
anditsrestrictionenzymecleavage
site map(Fig.
2B)
and entire nucleotide sequence(Fig. 3)
were determined. The termini of thefragment
correspond
toEcoRIcleavage
sites within the U3regions
of the 5' and 3'long
terminalrepeat
(LTR)
sequences ofMH2E21
proviral
DNA. Between the 5' and 3'noncoding
sequences, the
proviral
DNA contains acoding
region
composed
of the very 5' six codonsofthegag genefused in frame with v-myccoding
sequences(417 codons).
The gag-mycjunction corresponds
precisely
to the standardsplice
donor site within the gag gene of avian sarcoma-VOL.59,1986on November 10, 2019 by guest
http://jvi.asm.org/
344 PATSCHINSKY ET AL.
A
kbp
23.13 --- 9.42-- 656-4.36
--L232 2
03-B
1 2 U3 RU5
TT
Agag v-myc
ATE41T
U3 RU5
-..-TAG
5 C:V10 N }1.5 ctC Ct cLoup
C0.5 1 G 1 5 2.D
~~~~~~~~~kbp
0.56-FIG. 2. Genetic structureof MH2E21. (A)High-molecular-weight DNAs (15 ,ugeach)fromuninfectedquail embryo cells (lane 1) or from cells of the MH2E21-transformed nonproducer quail cell line E21 (lane 2) were digested with EcoRI, and the digests were separatedby electrophoresis through a 0.8% agarose gel with fragments of X DNA digested with HindIII as molecular weight markers. DNA was transferred to a nitrocellulose filter and hybridized with nick-translated DNA (2 x 106 cpm of 32P) of a 3' myc-specific probe. The autoradiograph wasexposedfor3 days. (B) Aplasmidclone, pMH2E21-E, containingthe 2.3-kbpDNAfragmenthybridizingwith themyc probewasisolated fromapBR322library ofthe 2- to3-kbp fractionofEcoRI-digestedDNAfrom the E21 cell line. Thegeneticstructureof MH2E21proviralDNAwasdeduced fromtherestrictionmap, fromhybridizationwithgene-specific probes(notshown),andfromcomplete nucleotide sequence analysis (compare Fig.3). Thestrategyforsequencing fragmentsofproviral DNAcloned intoM13mpl8/19is shown belowthe restrictionmap. Theopenreading frameonthe MH2E21 genome isindicatedbytheposition of the translational initiationcodon ofthe partial.gaggenecomplementandbytheposition oftheterminationcodonwithinv-mnvc(stippled box).Theposition ofthefirst ATG codon withinthe transduced invcsequences is also shown (compare Fig. 5).
leukosis viruses (15, 49) and to the splice acceptor site for the second
c-myc
exon which is conserved in the MH2v-inyc allele (22, 26, 65). Except for the lack of5' intron-derived sequences, the MH2E21 v-myc allele is nearly
isogenic with that of MH2. Of the 27 missense mutations reported for the MH2 v-myc allele in comparison to the chicken
c-inyc
gene(26), 24werealsofound in the MH2E21 v-mycallele, and one codon isdifferent from the homologous counterparts in both c-mvyc and MH2 v-myc. Furthermore,the MH2E21 and MH2 v-mnyc alleles share thesamedeletion
of fourconsecutive codons incomparisontoc-mnyc(Fig. 3). The nucleotide sequence of the 3' noncoding region of MH2E21 proviral DNA between the 3' terminus ofv-myc
and the 5' terminus of U3 is nearly identical with that reported for the corresponding region of the MH2 provirus
(26,57). This regionshows extensive sequence homologyto
corresponding sequence elements in the genomes of avian
sarcomaviruses Y73 and RSV SR-A, but itis less related to
the corresponding regionof the RSV PR-C genome (49, 57). On the other hand, theR, U5, U3, and 5' leader sequences of the MH2E21 genomeare closely relatedtothose of RSV PR-C, but have some distinctive features (Fig. 4). The
alignments in Fig. 4 show that sequence duplications and
triplications have occurred in the 5' leader sequence and in the U3 region, respectively. The sequence which is tripli-cated in the U3region of the MH2E21genome and present
onlyonce in the RSV PR-C U3 regionis presumablypartof the transcriptional enhancing region of the LTR sequences (30, 33). Essentially the same unusual structural features have recently been reported for the U3 region and5' leader sequences of ring-necked pheasant virus (RPV) (53), a
nondefective weakly oncogenic avian retrovirus often used
as ahelpervirus. Sinceourwild-typeMH2and spontaneous and constructed mutant derivatives werefrequently propa-gated with RPVas ahelper virus (22), it appears verylikely
that MH2E21 was derived from a parental MH2 virus that had recombined withRPV. Thispossibility is also consistent with theobservation that the U3 regions of both MH2E21
(Fig. 2 and 3) and RPV proviral DNAs (53) contain EcoRI cleavage sites,whereas the U3region ofouroriginal clone of MH2proviral DNA contained KpnI cleavage sites (21,
23).
The overall genetic design of the MH2E21 genome is
strik-ingly similar to the one proposed for subgenomic v-myc
mRNA of MH2(22, 26, 39) and provides direct evidence that the presumed splicing signals on MH2 genome-sized RNA
are actually utilized. The genesis of the transmissible MH2E21 retroviruspresumably involved encapsidation and
reverse transcription ofsubgenomicv-myc mRNA. MH2E21 derivatives designed in vitro. The open reading
frame on the MH2E21 genome encodes a 423-amino-acid protein which is distinguished from the cellular c-myc
pro-tein by the additional amino acid residues at the amino terminus and by the substitutions and deletions of residues within the shared domains (Fig. 3 and SA). To assess the functional significance of these structural changes, wehave constructed derivatives of MH2E21 proviral DNAencoding
protein products whichareprogressivelymoresimilar tothe c-mnyc protein. Thegagtranslationalinitiation codon
(ATG)
was modified to CTG by using the synthetic anticoding hexadecanucleotide 5'-d(GCTTCCAGGCTTGATC)-3' (the
substituted nucleotide is underlined)formutagenesis(Fig.5;
compare Materials and Methods). The mutated MH2E21 derivative, termed MH2E21ml, encodes a 412-amino-acid protein whose synthesis would start atthe firsttranslational initiation codon within the myc sequences (Fig. SB). This codon corresponds to the presumed c-myc translational initiation codon nearthe 5'terminus of the second exon(32, 52, 65). A second derivative, MH2E21c1, was constructed by replacing most of the MH2E21 v-myc allele, i.e., the 1.0-kbpPstl-Rsal fragment (compare Fig. 2B), by the cor-J. VIROL.
on November 10, 2019 by guest
http://jvi.asm.org/
ONCOGENIC mvc ALLELES 345
:~~
3.
~ ~ ~ ~. ~~~~~~~
RAATTCC6CATT6CA6A6ATATT6TATTTAAGT6CCTA6CTC6ATACAATA A TTT 6(0
R, T :U5
6ACCATTCACcAcATTG6TGGCACCTG66TTGATG6CC66ACCGTT6ATTCCCTGACGA 120 U5
""-I
CTAC6AGCACAI6CATGAAGCAGAA66CTTCATTTGGT6ACCCC6ACGTGATCGTTAGGG 180
AATA6TGGTCGGCCACAS6CGGC6T6GCGATCCTGTCCTCATCCGTCTCGCTTATTCGGG 240
GAGCG6ACGATGACCCTAGTAGAGGGGGCTGCG6CTTAG6AGGGCAGAAGCTGAGTGACG 300
TCGGA6GGA6CTCCACG6CCGGGGGCCAAGATACCCTACC6AGAACTCAGAGAGTCGTTG 36(1
GAAGACG6GAA6AAAGCCCGACGACTGAGCGGTCCACCCCAGGCGT6ATTCCGGTTGCTC 420 g
9?
g myc
TGCGTGATTCCGGTCGCCCG6TGAA'CAA6CAT6GAAGCC6TCATAAAGGCA6CAGCCGC 480 Het6luAlaVa&lleLvsAlaAlaAlaAla 10
C *
C6C6ATGCC6CTCA6CGTCAGCCTCCCCAGCAAGAACTACGATTAC6ACTAC6ACTCGGT 540 AlaMetProLeuSerValSerLeuProSerLysAsnTyrAspTyrAspTyrAspSerVal 30
Ala
6CA6CCCTACTTCTACTTCGA66AG6AGGAGGA6AACTTCTACCT6GCGGCGCAGCAGCG 600 GlnProTyrPheTyrPhe6luSluGlu6luGluAsnPheTyrLeuAlaAlaGInG6nArg 50
G :C
6AGCABC6A6CTGCA6CCTCCA6CCCCGTCC6A66ACATCT6GAAGAAGTTTGA6CTCCT b60
SerSer6luLeu6InProProAlaProSerGluAsplIeTrpLysLysPheGluLeuLeu 70 GlY
A C: G
GCCCGCGCC6CCCCTCTCGCCCAGCTGCCGCTCCAACCTGGCCGCCGCCTCCTGCTTCCC 720 ProAlaProProLeuSerProSerCysArgSerAsnLeuAlaAlaAlaSerCysPhePro 90
Thr Arg Ser
TTCCACCGCCGACCAGCTGGAGATGGTGACGGAGCTGCTCG66GGGGACATGGTCAACCA 780
SerThrAlaAsoGlnLeu6luMetValThr6luLeuLeu6ly6lyAspMletValAsn6ln 110
T A
6A6CTCCATCTGCGACCC66AC6AC6AATCCTTCSTCAAATCCATCATCATCCGGGACT6 840
SerSerlleCysAspProAspAspGluSerPheValLysSerllellelleArgAspCys 130
Phe Gin
CATT66A6C6GCTTCTCCGCCGCC6CCAAGCT66AGAAGGTSStc6TCAGAASCTCGC 900
MetTrpSerGlyPheSerAlaAlaAlaLysLeu6luLysVaIlValSer6luLysLeuAla 150
C:
CACCTACAAAGCCTCCCGCC66SAG6GGGCCCCGCC6CCGCCTCCCGACCCGGCCCGCC 960
ThrTyrLpsAlaSerArgArg6lu6ly6lyProAlaAlaAlaSerArgProGlyProPro 170
G1n
GCCCTCGGGGCCGCCGCCTCCTCCCSCCGGCCCCGCCGCCTCGGCCGGCCTCTACCTGCA 1020 ProSer6lyProProProProProAla6lyProAlaAlaSerAlalyLeuTyrLeuHlis 190
: AA AC : A
C6ACCTGS6AGCCGCG6CC6CCGGCT6CATC66CTCCTCGTGGTCTTCCCCTSCCCGCT 1090
AspLeuGlyAlaAlaAlaAlaGlyCys5leGlySerSerValValPheProCysProLeu 210
Asp AspPro Tyr
A 6A AA : : A
CGGCAGGC6CGGCtCGCCCGGC&CCGGCCCCGCGGCTCTGCTGGGGGTCGACGCGCCGCC 114(1
51vArqArg6ql
ProProSlyAlaGIyProAlaAlaLeuLeuGlyValAspAlaProPro 230SerGlu Ali Asn Thr
'ProArqA!aAla
A A :A A :A
CAC66CC66C66C66CTCGGA6GAAGAACAAGAA6AA6ATGA6GAAATCGATGTC6TTAC 1200 ThrAlaIlyGlySlySer6luBluSlu61nGluSluAsp6luSlulleAspValValThr 250
ThrSerSerAsp
ATTAGCTGAAGC6AACGAGTCTGAATCCA6CACA6AGTCCA6CACA6AAGCATCA6A66A 1260 LeuAlaSluAlIAsn6luSer6luSerSerThr6luSerSerThr6luAlaSer6luSlu 270
GCACTGTAAGCCCCACCACAGTCCGCJ66TCCTCGA6CGGT6TCAC6TCAACATCCACCA 1320 H:sCysLysProHisHisSerProl.euValLeuGluArgCvsH:sVilAsnIleHis6ln 290
Lys
ACACAACTAC6CTGCTCCTCCCTCCACCAAGT66AATACCCA6CCGCCAA6A6GCTAAA 1380
HisAsnTyrAlaAlaProProSerThrLysVal6luTyrProAlaAlaLysArgLeuLys 310
A:
6TTGGACA6TGGCA66GTCCTCAAACAGGTCAGCAACAACC6AAAAT6CTCCAGTCCCC6 1440 LeuAspSer6lyArqValLeuLvsSlnValSerAsnAsnArgLvsCysSerSerProArg 330
lie
A:
CACGTCA6ACTCAGAGGTGAACGACAAGAGGCGAACGCACAACGTCTTGGAGCGCCAGC6 1O50(
ThrSerAspSerSluValAsnAspLysArgArgThrHKsAsnValLeuGluArg6lnArg 350
Slu
: T
AAGGAATGAGCTGAAGCT6SACTTCTTTGCCCrTC6GGACCAGATACCCGAS6TGGCCAA 1560 ArgAsn6luLeuLysLeuSerPhePheAlILeuArgAsp6lnllePro6luValAlaAsn 370
A
CAAC6A6AAG6C6CCCAAG6TT6TCATCCTGAAAA6A6CCAC66A6TAC6TTCTG6CTAT 162u
Asn6luLysAlaProLysValVallleLeuLysArgAlaThr6luTyrValLeuSerlle 3q(Q Lys
A
CCAATC66ACGA6CACA6ACT6ATC6CA6A6AAA6A6CAGTr6A66C66A66A6A6AACA 1680
61nSerAspGl uHisArgLeulleAlaG1uLysGluGlnLeuArqArgArqArg6luG1n 410
GTTGAAACACAAACTTGAGCAGCTAAGGAACTCTCGTGCATA66AACTCTTGGACATCAC
LeuLysHisLysLeuGlu61nLeuArgAsnSerArgAIa*l '
myc
q-1
TTAGAATACCCCAAACTASACTCCSTSGTATA6CT66TTGGATC6TTAATC66ACSGCTG GCACACG6AAT6TA66A66TCGCTGAGTAAGTACGAACAAAATTTAC6TlT6AATAA66T GAGGCTT6ACCIACAATTGTICAAATAATGCTTCT6TAGAAATGTTTA6CATTASSCATC TTGCGCTGCTCCGCGAT6TACGSGTCAGGTATAATSTGCA6TTTGACTGAG666ACCATG ATATGTATAGGC6AAA66CS666CTTCr66TT6TAC6C66TTA66A6CCCCTCA66ATAT
,o0-U3,
A6TASTTTCGCTTTT6CATA66SAS6SSSAAAT6TAGTCTTATGCAATACTCITTTASTC
TTGCAACATGCTTATGTAACGATGA6TTASCAACATGCCTTATAA66AAA6AAAAA6CAC
CGTGCAT6CCGATT6GT66AA6TAA6GT6GTAT6AtCGTGGTAIGATC6GTGSAT6ATCG TGCCTTATTA66AAGGCAACA6ACGSGICTAACAC66ATT66AC6AACCACTG
I1740 423
1920
1980
2040
2100
'160
22220 2273
FIG. 3. Nucleotide sequence of MH2E21proviralDNA.The sequenceof2,273 nucleotides(numberedin themargin)between theEcoRI cleavagesites within the U3regions ofthe LTRs (compareFig.2) is shown. Thepredictedsequenceof amino acid residues(numberedin the margin) of the protein product ofMH2E21 is shown below the nucleotide sequence. Within the mnvc domain, all changes in nucleotide sequenceandpredictedamino acid sequencecompared with thoseofthechicken c-myc gene(65)areindicated above and below the MH2E21 sequences,respectively.The gag-mycjunctiononthe MH2E21genomecorresponds preciselytothe standardsplicedonor site within the gag geneof avian retroviruses from the leukosis-sarcoma group(15, 49)andtothesplice acceptor site of the second exon of the chickenc-tnvc
gene(32, 52, 65). VOL.59, 1986
on November 10, 2019 by guest
http://jvi.asm.org/
346 PATSCHINSKY ET AL.
A
r-oR
R,'U5
I-,t')rf r b,,;1.. H1,rT15(-m G,1T1'3tIHf;i,ICC TI'TC ITG; 1CLC.CJi)C";rI CCl-l'Tr(Ai I C c
6HC.,-)T-rT ihCIC',TT f&, I-IC,-r J -rGGyf31G-1- 3C IT C-0GT TT ,GT-i1C2iT,CIIv(IT 1iC, frIu
U 5
CT'"AhCGCT*;P-*iC5A-iGCAC-.i';C: T'( TCiP,tiACt'"ii-iCIff'iiG'("Ir l-~TC.(-f'r"IGGc-TGf;C,C.,C: C.{; C'(",TGX,ITC,
1CT(vIC.U 1T r;,C,(-;CA C(.C,T1 G';"I;T13(iAit:;i.G.i17(iGiH(U:'T: 1T T(741 Tr11A331T 3111C'.C.C.CG;ilC; f:i TJ0
1TTtI,Si '-f-iTi ,CrUAiG TH I-`)G TI;IiGt(-IA-C r f.(IT)(,I rIi!C1)121 CTIlU I 1 1c I
r-Tl-,'G(,hG - r~i-:`lCJ r-.(-, T Ci C s i:i0:l-,CCl; r-rrf -.TC , :l TF-C,-rt-C-1*- C.i.iT TF-- C-1-rf
TT frA,(-A;-` C(- (:Cl* TC.t`(_('S'.C:o 16;-,C. C-'iC.',3:Cti-,(.( F- C.,r,-:: xC:;--n:-s- .0 t1CI(:
HTTIC Ui~ L-uHLiI(111 J 111171326 _4 qitI 41(AHiI 11(11c11i211112111
UiFF11213~6i~ IUUi.
1~11iIi'2I
I(
~iIi(II Hi tI IC2 li Ii,~
,AT ,-vc' r,,"--,i AC, C.-C I..'I I.j..
C)'iTi-, ,r r:C't. It",, Jitt1 liC.TC-i-iCr.T(, Ci..j:I ii"IC'ili J_ I-iIfTt7,; Ci,C i-t si1Cij,;_-,i(;l-C .7 t
,-IT ,'C I T ,i,l If., C ,_,) F .1 T ,)It I
IT,rI tI IITffIll1X.*=(11 i(.IIR,iiii,-lsI.--tI;:ii1 1412 :,:-2121(:::i',(! (: 1;ili
fr r,;cl -T ,rtlJT Cl,-t.tXJ-C J(,:t*,V> -fj ,i:(::;-r(:tl, fl;S
r7mU3
T1 TC,1 ,ft(.1 r ,rI ; r ; ST .f G)1,1( ,1 T1, t'G(. ( ti'T(-.tIt r -f G;T fi- T f,C
r2sc.c1
;C
1T
AU C 1'(I (i" i;i A;11(;T1idCfti1
'111C 1`iC tICC I1i(Ci;(f -JC C C.. (above) rresponding
Mf-,2Teqr312; I TTd1'it';idetsC '1
e .lSD;ini 'r TI'e iclC si'thn- F" lTtg', 'C a-f1Ct'he(-slGTcCoT
I a 1 (i A C i:*:C ;C (,('C3I T r("Gf1( r 7*`1 1i(-'I...Ot-IIrV 1C C CCr r(T C" CrrlC;-1t( I TT G tI' T r(1; I.*,( 1I
t f-) A,:9C, T j-,,TG' rfr (-( C'SG'§;: :(.'C"I A.'1-T(:.(,lC(::C:T ('.' .-i- I(,-1'i-f1'-.1-,tT'I TOAG('1'(41f;( T6i
C;i't (-r-r(:( 6f 1-,(:I-("(;i TkrU,;3C.-R ;"fT -f'C')t 1: 1'1 r[-F- ,IC R
FIG. 4. Alignmentofproviralnucleotide sequences of MH2E21(above)andRSV(below)correspondingtotheS'(A)and 3'(B)termini of the viral RNA genomes. (A)Nucleotides 54through469of the MH2E21 sequence showninFig. 3arealignedwith nucleotides 1through
397 ofthe RSV PR-C sequence(49). SDindicates thepositionof thesplicedonorsite in the RSV genome and of thesplice junctionsiteon
the MH2E21genome.(B)Nucleotides 2071through2273 and1through74 of the MH2E21sequence (Fig. 3)arealignedwith nucleotides9058
through9312 of the RSV PR-C sequence(49). Duplicationsinthe MH2E21sequenceare indicatedbybrackets. responding region of the CMII v-myc allele. For the
con-struction, the 5' 0.6-kbp EcoRI-PstI fragment and the 3'
0.7-kbp RsaI-EcoRI fragment (obtained by partial digestion) of MH2E21 proviral DNA (compare Fig. 2B) were ligated with the 1.0-kbp PstI-RsaI fragment from the v-mycregion
ofcloned CMIIproviralDNA(62).Withinthatfragment,the nucleotide sequence of the CMII v-myc allele is identical
withthat of the chicken c-mycgene(62;N.Walther, H. W.
Jansen, C. Trachmann, and K. Bister, Virology, in press).
The PstI site onMH2E21 proviralDNAmaps at nucleotide
position 611 onthe sequence shown inFig. 3, and the RsaI site is located at position 1606. Hence, the MH2E21c1
provirus has retained only twomissense mutations(5'of the PstIsite)within the v-myc allele which encodesa
427-amino-acidprotein (Fig. 5A). Bythesamestrategyaswasused for
the construction ofMH2E21c1 fromMH2E21,athird
deriv-ative, MH2E21mlcl, was constructed by replacingmost of
the MH2E21mlv-myc allelebythe corresponding segment
of the CMII v-myc allele. MH2E21mlcl proviral DNA encodes a 416-amino-acid protein (Fig. SB) which differs
from the c-myc protein product by only 2 amino acid
substitutions, an alanine-valine and a glycine-serine ex-change (themutations map at nucleotide positions 498 and 602, respectively, onthe sequence shown in Fig. 3). Nota-bly, neither of these two mutations has been found in the oncogenicv-mycalleles ofMC29, CMII,orOK10 (1, 17, 45, 62;Waltheret al., in press).
To obtain biologically active proviral DNA of MH2E21
61
61
121
121 1 Li 1
2I 1(
:.4 t
241
;3ij!1
31 1
3'lii 1
B
J. VIROL.
on November 10, 2019 by guest
http://jvi.asm.org/
ONCOGENIC myc ALLELES 347
A
Lfs
AgagTv-myc
XZRm
6_ 1 421. [OGH
4:42 3427 aa
--_
met A'LVa LeL ysAaaAIcaA;, :A .MetP- -
--ATC[AG AT A, 6TCZA'`QCTGACZ CAW[Z-rr
Li _ myJ
B
G A T CAgag v-myc
LI lI
NH27
[=Z1E
;-,41 2 41 6aa
Met Prc
---5--AT- WAAGCCTEA GOAM CGTEAT!A'AG5 CA G GATGc 3'
,,sg myc
5'
FIG. 5. Mutagenesisof MH2E21. (A) Protein-coding domainontheproviralgenomesof MH2E21 and MH2E21cl. MH2E21 specifiesa
423-amino-acid proteinwith 6residuesencoded bygagand 417residues encodedbyv-mycsequences.MH2E21cl encodesa427-amino-acid proteinwith6 residuesencoded bygagand 421 residuesencodedbyv-mycsequences(numbersinparentheses). MH2E21clwasderived from
MH2E21byin vitrorecombinationrestoringthe fourmyccodonsdeletedfromthe MH2E21v-mycallele (seeFig. 3 andtext).Thesection
of thesequencing gel (shownhere forMH2E21clDNA;thesequenceofMH2E21 DNA in thisregionisidentical) shows thesequenceof the anticodingstrandcomplementarytothe 5' 28nucleotides of thecoding-strandsequenceshown in thediagram. (B) Protein-codingdomainon the proviral genomes of MH2E21m1 and MH2E21mlcl. MH2E21m1 specifies a412-amino-acid protein, and MH2E21m1c1 encodes a 416-amino-acidprotein (numberinparentheses). Synthesisof bothproteinsisinitiatedatthemycATG codon. MH2E21m1 wasderivedfrom MH2E21byoligonucleotide-directed mutagenesisof thegagtranslational initiationcodon,andMH2E21mlclwasderived fromMH2E21m1 byinvitro recombinationrestoringthe fourmyccodons deleted from the MH2E21m1 v-mycallele(see text).The section of thesequencing gel (shownhere forMH2E21mlclDNA;thesequenceof MH2E21m1DNA inthisregionisidentical)showsthesequenceof theanticoding strand complementarytothe 5' 28 nucleotides ofthecoding-strand sequenceshown in thediagram. The single nucleotide substitution is indicatedbythearrow.
(and, byananalogousstrategy,of itsderivatives), the partial LTRsequencesatthe5' and 3' termini ofthe2.3-kbp EcoRI fragment (compare Fig. 2B)werecompleted in vitro. The 3'
0.7-kbp BalI-EcoRIfragment ofproviralDNA(Fig. 2B)was cloned into the PvuII and EcoRI sites ofpBR328. The 5'
0.3-kbp EcoRI-SacI fragment of proviralDNA(Fig. 2B)was
cloned into thecorresponding sites of pUC12. DNAs from
the pBR328 and pUC12 clones were then cleaved with
EcoRI andHindIII. The large fragment of the pBR328 digest and the small fragment of the pUC12 digest were ligated,
yielding a plasmid clone containing a complete MH2E21 LTR flanked by partial proviral sequences. The 2.3-kbp EcoRIfragment ofpMH2E21-E (Fig. 2B)was nowinserted
in theappropriate orientation into the EcoRI site within the U3 sequences of the LTR-containing plasmid clone. The finalproduct,pMH2E21 (Fig. 6A), containedacomplete and biologically active (see below) provirus of MH2E21. By the same procedure, pMH2E21m1, pMH2E21cl, and pMH2E21mlcl were constructed, containing biologically active proviral DNAs of the MH2E21 derivatives. The
structural integrity of allconstructs was verifiedby restric-tion enzymedigestion analysis of DNA from the complete proviral plasmid clones (Fig. 6B).Within theMH2E21v-myc sequences, the 5'PvuII site(nucleotideposition 682in Fig. 3), the 3' Sacl site(position 781), and the XhoI site (position 1292)arespecific for this allele,whereas allother restriction
enzyme sites shownin Fig. 2B and 6Aare shared with the chicken c-mycand the CMII v-myc alleles (47, 60, 62, 65). Hence, the particular digestions shown in Fig. 6B directly confirm the substitution of CMII v-myc sequences for MH2E21v-mycsequencesinMH2E21c1 and MH2E21m1c1
proviral DNAs. The expected restoration in those DNAs of thedeletedsequencesis alsoconfirmedbytheslightly larger size of their 0.5-kbp PstI-SalI fragment (Fig. 6B). Further confirmation of the expected structures of the constructs was obtained by partial nucleotide sequence analysis. In
particular, it was confirmed that the MH2E21m1c1 v-myc
allele, like that of CMII(62; Waltheretal., in press) and like the chicken c-myc gene (65), contains an ACG codon at a position where thev-mycallelesofMH2(26),MH2E21(Fig. 3, nucleotide position 665), MC29 (1, 45), and OK10(17)all
havea missense mutation.
Protein products and transforming properties of MH2E21
and its derivatives. DNAs from theplasmidclonescontaining complete proviral genomes of MH2E21 or its derivatives
(Fig. 6) were transfected onto quail embryo cells in the presence of cloned helper proviral DNA. In all cases,
transformed cell cloneswereobtained(see below). Analysis ofv-myc-specific protein products in these cells (Fig. 7A) revealed that theapparentmolecularweights deduced from
theirrelativeelectrophoretic mobilitiesagreepreciselywith
thepredictions abouttheirrelative sizes(Table 1) basedon
G A T C
VOL.59, 1986
C=
4----ftoodD
-%mom
am
I
on November 10, 2019 by guest
http://jvi.asm.org/
348 PATSCHINSKY ET AL.
A
B
kbp
23 ~ 2313~~~~~~~~
9 .4
! _
-~~~~~~~--.
6.56_ Z -
_~~~~~~
4.36*1
~~~~~~~~~~2.32
--
~~~~~~~~~2.03
.5'bUn
a-FIG. 6. ConstructionofbiologicallyactiveproviralDNAsof MH2E21 and itsderivatives. (A) The 5'-terminalEcoRI-SacIfragment and the3'-terminalBaiI-EcoRIfragment of the 2.3-kbpEcoRIinsert fragment ofpMH2E21-E (compare Fig. 2 and 3)weresubclonedintopUC12
andpBR328, respectively, and then joinedtothe 3'and 5'termini, respectively, of the 2.3-kbpEcoRIfragment(see text).The final product of thatconstruction, pMH2E21, containsacompleteandbiologically activeprovirus.Allrestriction enzymecleavage sitesutilized for the
constructionorfor thedigestions shown inpanelBareindicated,excepttheSalland PstI sites within theremnantof the pUC12 multiple cloningsite.Bythesamestrategy,pMH2E21ml, pMH2E21c1,andpMH2E21mlcl, containing biologicallyactiveprovirusesof the MH2E21 derivatives,wereconstructed. (B)DNAs(1 ,ugfor eachdigestion) ofpMH2E21 (lanes 1, 5, 9,and13), pMH2E21c1 (lanes 2,6, 10,and 14), pMH2E21ml (lanes3, 7, 11, and 15), andpMH2E21mlcl (lanes 4, 8, 12, and 16)weredigestedwithEcoRI and XhoI (lanes1 through 4),
EcoRIandPvuII(lanes5through 8), EcoRIandSacl (lanes9through 12),orPstI andSall (lanes13through 16).Thedigestion productswere separated by electrophoresis througha1%agarosegel. Molecular weightmarkersare asexplainedin thelegendtoFig.2. Note that within
thev-mycsequences, the 5' PvuII,3' Sacl,and XhoI sitesarespecificfor theMH2E21 and MH2E21ml v-mycalleles (see text).
the sequence analysis (Fig. 3) and the strategies of the in
vitro constructions (Fig. 5). While all these proteins show
the substantial difference between calculated andapparent
molecular weight (Table 1) typical for allmycprotein
prod-ucts (1, 2, 8, 16, 42, 45, 65), their differences in size (electrophoretic mobility) relative to each otheragree with
thepredicted differences in numbersofamino acid residues
(Table 1). MH2E21 encodes a 59,000/61,000-molecular-weightprotein (p59/61v-1Yc) whichis indistinguishable from the MH2 v-myc protein product (Fig. 1 and 7A). MH2E21ml, MH2E21cl, and MH2E21mlcl specify v-myc
protein products with apparent molecular weights of 57,000/59,000 (p57/59V-MYC), 60,000 (p6O`v
nY%
and 58,000(p58V-mYc),
respectively (Fig. 7A). Interestingly, theappear-ance as a characteristic doubiet in gel electrophoresis is
typical for those v-mycproteins whicharedistinguished by the MH2-andMH2E21-specificaminoacidsubstitutions and
deletions, but isnotdependenton the utilization of thegag translational initiation codon (Fig. 1 and 7A). As expected (Table 1), the MH2E21c1 p60V-MYc protein comigrated with theprotein product ofOK10 subgenomicv-mycmRNA(Fig. 7A). To test the prediction (Table 1 and Fig. SB) that the
MH2E21mlcl p58v-myc protein would be nearly identical with thechicken c-mycprotein, its electrophoretic mobility was compared with that of the chicken c-mycprotein
prod-uctand also that of the quail. Theanalysisshowed thatthe apparentmolecularweightsof theprotein productsfrom the transduced and the chromosomal myc alleles are identical (Fig. 7B). Basedontheamountof cellularlysateused forthe immunoprecipitationandtherelativeintensities of the
radio-active signals of these protein bands (Fig. 7B), it was estimatedthat there isatleast30to50 timesmorep58v-mycin MH2E21mlcl-transformed cells than there is p58c-mYc in normal aviancells.
Thetransformingfunction of MH2E21 and its derivatives was measured by transfection of their proviral DNAs onto
quail embryo cells. Most importantly, all proviral DNAs were capable ofinducing focus formation of transformed cells. A quantification of the transforming activities of MH2E21and itsderivatives relativetothatofMH2is shown in Table 2. Under assay conditions which largely prohibit the
spread of infectious virus, MH2E21 and MH2E21ml were
about asefficient asMH2 inthe induction of foci, whereas the substitutionof sequences isogenicto c-mycfor most of the MH2E21 v-myc sequences in MH2E21cl and MH2E21mlcl caused a significant and reproducible
reduc-tionin thetiter ofFFU perpicomole of transfected proviral
TABLE 1. Sizes ofproteins encoded by transducedor chromosomal myc alleles
Originof No.of Molwt
amino acid
proteinproduct residues Calculateda Apparentb
v-myc,MH2 423c 46,109 59,000/61,000
v-myc, MH2E21 423c 46,137 59,000/61,000 v-myc, MH2E21ml 412 45,111 57,000/59,000
v-myc, MH2E21c1 427c 47,073 60,000
v-myc, MH2E21mlcl 416 46,047 58,000
v-myc, OKlOd 427C 47,015 60,000
c-myc, chicken 416 45,989 58,000
aCalculatedmolecularweights ofmycprotein productsarebasedonamino
acidsequences deduced from nucleotidesequenceanalyses ofv-myc or c-myc alleles: MH2(26);MH2E21(Fig. 3);MHZE21derivatives(Fig.5;seetext); OK10(17);chicken(65).
bApparent molecularweightsofmycproteinproductsweredeterminedby
electrophoresisonpolyacrylamide-sodiumdodecyl sulfate gels (Fig.1and7).
cIncluding6amino-terminal aminoacids encodedby5' gag sequences. dOnlythev-mycprotein producttranslated fromsubgenomic mRNA is
consideredhere.
J.VIROL.
on November 10, 2019 by guest
http://jvi.asm.org/
ONCOGENIC myc ALLELES 349
DNA (Table 2). Underassay conditions which allow virus
spread, the relative increase in titer was larger in transfections with MH2 proviral DNA than with the other DNAs. Similarly, the titer of FFU was higher in infectious virus stocks of MH2 than in stocks of MH2E21 (see above) oritsderivatives, even when the same helper virus was used
for pseudotype formation. Interestingly, the comparison between the transforming activities of MH2E21 and
MH2E21m1 or between those of MH2E21cl and
MH2E21m1c1 revealedthatthepresenceof additional ami-no-terminal amino acid sequencesnotencoded byauthentic
c-myccodingsequencesisnotessential forthetransforming function of v-myc protein products (Table 2). Based on average size and morphology of induced foci and on the
cellular morphology oftransformedcelllines, the transform-ingproperties ofMH2E21andits derivativeswere
indistin-A
2 3 4 5 6 7 8 9 10
B
2 3 4 5
TABLE 2. Focusformation of quail embryo cells trdnsformed by clonedproviral DNAs of MH2, MH2E21, or MH2E21 derivatives
Transforming activity
DNAa FFUb
FFU/pmolc % pMH2
pRAV-LTR 0
pRAV-LTR + pMH2 39(326) 81 (677) 100(100) pRAV-LTR + pMH2E21 36(95) 77 (203) 95(30) pRAV-LTR + pMH2E21ml 38(141) 75(278) 93(41) pRAV-LTR + pMH2E21c1 10 (28) 21(59) 26(9) pRAV-LTR + pMH2E21mlcl 4(42) 9(95) 11(14)
aPlasmid DNAs containing proviral genomes of helper virus RAV-1, MH2,
MH2E21, or its derivatives were transfected onto quail embryo cells as described in Materials and Methods. Cells on two6-cmdishesreceivedatotal of 2 p.gof pRAV-LTR DNAormixtures of 2 ,ug ofpRAV-LTR DNA with
approximately4 or2 p.gofplasmidDNAscontaining the MH2 provirusor
proviruses of MH2E21 and its derivatives,respectively.
bThe total numberof FFU in transfected DNAs was determined in focus assays.Therecipientcellswereeither overlaid with agar 1 dayafter DNA transfection or transferred on two10-cmdishes 3 days after the transfection andthenoverlaidonthe nextday. The first number is the total count of foci
on two6-cmdishes in the direct assay, and the number in parentheses is the total count of foci on two10-cmdishes in the secondary assay.
cFFU perpicomole of transfectedproviral DNA.
guishable from each other, but distinct fromthose ofMH2
(Fig. 8). On average, MH2-induced foci are substantially larger than those induced byMH2E21 orits derivatives,and
MH2-transformed cell cultures show a more disordered
arrangementof cells, which also frequently pileupin clumps
(Fig.
8).
0061
iO
."DtOC Mo_
Df00,'.;
--5o
- 58,000
FIG. 7. Protein products of transduced and chromosomal myc
alleles.(A) Quailembryo cells transformedbyMH2E21(lanes1and 6), MH2E21m1 (lanes 2 and 7), MH2E21cl (lanes 3 and 8), MH2E21mlcl(lanes4and9),orOK10 (lanes5 and10)werelabeled with[35S]methionine, and proteins were immunoprecipitated from
cellularlysates. Eachprecipitatewaspreparedfrom thelysateof 5
x 106 cells(containingbetween 5 x 107and7 x 107cpm)withthe
rabbitanti-myc-peptide serumeither without(lanes1through 5)or
with (lanes 6 through 10) preadsorption to the peptide. Equal portions (20%)of allprecipitateswereanalyzed by gel
electropho-resis asfor Fig. 1. The fluorographwas exposed for 3days. The
apparentmolecularweightsof thefollowingv-mycprotein products are indicated in the margin: MH2E21 p59/61v-mYc, MH2E21ml p57/59V nYC, MH2E21cl p60'VYC, MH2E21mlcl p58v' Yc, OK10
p64V-myC, and OK10 p2gag-Pol-myc. (B) Proteins from uninfected chicken embryo cells(lanes 1 and2)anduninfected quail embryo cells(lanes4and5)werelabeled andanalyzedasdescribedforpanel
A. Eachimmunoprecipitate waspreparedfromthelysateof 4.5 x
106chickenembryocells(containing3.3 x108cpm)orof 5.6x 106 quail embryo cells (containing 3.9 x 101cpm), with the anti-myc-peptide serumeither without(lanes2 and4)orwith(lanes 1and5) preadsorptiontothepeptide. Equal portions (30%)of allprecipitates were analyzed onthegel. Forcomparison, aportions (5%) ofthe precipitatefrom 5 x 106 MH2E21mlcl-transformed cells (panelA,
lane 4) was coelectrophoresed in lane 3. Chicken p58c-myc, quail p58c-myc, and MH2E21m1c1 p8v-mychave identicalapparent
molec-ularweightsof58,000.
DISCUSSION
The structureofMH2E21proviralDNAdescribed in this study apparentlycomesclosetothatofthesmallestpossible
vector thatcontainsanoncogenicmycmutant allele and that can be
replicated
like a retroviral genome. The nucleotidesequenceofthe MH2E21 genomeindicates thatit is almost
certainly
derived fromsubgenomic
v-myc mRNAofMH2. In fact, the sequence directly proves that thepresumed
splicing signals
on the MH2 genome are utilized for theexpression
of its v-myc allele.Apparently,
allcis-acting
sequence elements necessary forencapsidation andreverse
transcription of viralRNAand forintegration and transcrip-tion of
proviral
DNA are contained within the 5' leadersequence and the 3'
noncoding region
of the MH2E21 genome. Thisfinding is consistent withthegenetic
analyses ofpackaging
mutants of RSV whichwereshowntocontain deletions mapping between the primerbinding
site and the start ofthe gag gene, hence at locations 5' of thesplice
donor site utilized forthegeneration
ofsubgenomic
mRNAs(38, 50),orwithin the 3' noncoding
region
(54). The titer of transforming virus in infectious virus stocks obtainedby
superinfection
oftransformednonproducer
cells withhelper
virus is lowerfor MH2E21 than for MH2.Similarly,
upontransfection of
proviral
DNAs ontoavianembryo cells underassay conditions
allowing
virusspread,
MH2 is more effi-cientthanMH2E21in focus induction. This difference couldreflect less-efficient
packaging
or stabilization of the MH2E21genomeowingeithertoitssmall size ortothelackofsequences which may enhance
efficiency
ofencapsidation
orstabilization of viral RNA,like the
proposed
RNAdimer linkage site which maps 3' ofthe splice donor site of RSV RNA (49) or the proposed additionalpackaging
locus that also maps downstream of thesplice
donor site (43). Formurine leukemia virus and for avian reticuloendotheliosis
andspleen necrosisviruses
(which
areunrelatedtotheavianVOL.59, 1986
on November 10, 2019 by guest
http://jvi.asm.org/
350 PATSCHINSKY ET AL.
AFLQ¢#A,
_1 f
'
G HWK lu
*.3.5.:
FIG. 8. Cell transformation by MH2, MH2E21, and MH2E21 derivatives. Morphology of quail embryo cells transformed by MH2 (line A103) (A), MH2E21 (line E21) (B), MH2E21ml (C), MH2E21cl (D), or MH2E21mlcl (E) (phase contrast micrographs, x79). The cell cultures transformed by the MH2E21derivativeswereobtained bytransfection of the respective proviral DNAs in the presence of helper (RAV-1) proviral DNA. Focus formation of quail embryo cellstransformed by MH2 (F), MH2E21 (G), MH2E21ml (H),MH2E21cl (I), or MH2E21mlcl (K) (bright field micrographs, x31). Proviral DNAs were transfected onto quail embryo cells in the presence of helper (RAV-1) proviral DNA, the recipient cells were transferred after 3 days and overlaid with agar on the next day, and foci were photographed after 13 moredays (compare Table 2).
leukosis-sarcoma viruses), cis-acting encapsidation se-quences have beenmapped downstream ofthesplice donor site utilized for the generation of subgenomic mRNAs,
providing a straightforward explanation forthe preferential
incorporation of unspliced genome-sized RNAs into viral particles (34, 63, 64). For the avian leukosis-sarcoma vi-ruses, however, there is precedence for the encapsidation andpresumably alsoreverse transcription ofenvand possi-bly also src mRNAs, although in most cases subsequent
transmissionofthedetectedsubgenomic proviruses through
anormal retroviral life cyclewas notdirectlydemonstrated
(18, 27, 28, 35, 55). Nevertheless,the efficiency of incorpo-ration of subgenomic mRNAs of avian leukosis-sarcoma
viruses is generally low. Hence,therelatively high efficiency with which the MH2E21 virus can be propagated may be
partially due to unusual structural features of its genome,
like the observed peculiar changes due to the apparent
recombination with RPV or like an undefined fortuitous packaging sequence provided by the v-myc allele. After submission of thismanuscript,Martinetal.(36)reportedthe
isolation ofan MH2variant very similar and, in its genetic
design, possibly identical to MH2E21. The independent isolation of such variants from different stocks ofMH2 is anotherdirectindication for therelatively high frequencyof theeventsleading totheirformation.
The oncogenic transduced mutant alleles of the chicken c-myc gene found in the retroviral isolates MC29, CMII,
OK10, and MH2 all encodeprotein productsthatare
struc-turallydifferent from the normal c-mycprotein product.The v-myc alleles are fused in frame either with large
comple-ments of virion genes on genome-sized mRNAs, or, on
subgenomic mRNAs, with a small gag complement on the
leadersequence. All v-myc allelescontain nucleotide
substi-tutions or substitutions and deletions (MH2) within the
c-myc-derived coding region, and sequences derived from the 5' noncoding terminus of the second c-myc exon are
always included in the v-myc coding region. Furthermore, OK10 encodestwov-mycprotein products,onespecified by
genome-sizedmRNAand theotherspecified bysubgenomic mRNA, and MH2 encodes a gag-mil hybrid protein in addition to the v-myc protein product. In summary, all natural oncogenic retroviral isolates containing transduced mycalleles carry and expressgeneticinformation other than authentic c-myccodingsequences.Hence,inthe absence of
a classicalgenetic definition, a rigorous biochemical
defini-tion of sequences necessary or sufficient, or both, for cell transformation by v-myc oncogenes could not be directly
deduced from the genetic structure of these viruses. How-ever,it hasrecentlybeen demonstratedforthe v-myc alleles
of MH2 and MC29 that neither a fusion with a large complement of virion genes nor, in the case ofMH2, the concomitantexpression ofa second oncogene is necessary for transformation of avianembryocells (3, 22, 24, 51,66). The analyses ofthe molecular and biological properties of MH2E21andits defined derivativesnowconfirm and extend these observations. The direct comparison between the
protein productsand thetransforming propertiesof MH2E21 andMH2E21ml shows thatadditional amino-terminal amino acid residues not encoded by the authentic myc coding region are not essential for cell transformation and do not evenhave anenhancing effecton thetransformingfunction of the v-myc protein product.
Comparisons
between MH2E21 and MH2E21cl or between MH2E21ml and MH2E21m1c1directly
show that most of the structural alterations within the MH2E21 (or MH2E21m1 or MH2)v-myccoding regionare notessentialfor transformation of
J. VIROL.
on November 10, 2019 by guest
http://jvi.asm.org/
ONCOGENIC myc ALLELES 351
avianembryo cells. MH2E21mlcl encodes a protein prod-uctthat differs from the normal c-myc protein by only two
amino acid substitutions. Since apparently neitherthe dele-tion of 4 amino acids nor the substitudele-tions of 23 amino acid
residuesare essential for the basic transforming function of the MH2E21 v-mycprotein product, itappearsunlikely,but cannotbe ruledout, thatjustthe tworemainingmutations in the MH2E21mlcl construct are of functional significance.
Also, these two mutations have not been found in the
oncogenic v-myc alleles of MC29, CMII, and OK10. It has recently been postulated that mutation of a specific c-myc
codon (61 of the c-myc coding region, corresponding to codon 72 of the coding region of the MH2E21 sequence
shown inFig.3) maybe essentialfor oncogenic activation of
transduced myc alleles, based on the observation that this
codon is changed in the v-myc sequencesof MC29, OK10, andMH2(40). However, the v-myc allelesof CMII (Walther
et al., in press) and of the MH2E21cl and MH2E21m1c1 constructsdonothaveamutation of that codon. Hence,the
analyses presentedhere stronglysuggest that neither major
structural changesnorspecific, ifany,missense mutations of
thec-myccoding region are necessaryfor activation ofthe basic oncogenic function of transduced myc alleles. It is possible, however, and indeed suggested by the observation of reduced transformation efficiencyof the MH2E21cl and MH2E21mlcl constructs, that mutations may enhance
transforming function and possibly playanimportant rolefor
the evolution offully tumorigenic v-myc oncogenes. Aside
from the two missense mutations in their shared coding domains, the major structural difference between the MH2E21mlcl v-myc allele and the normal chicken c-myc allele is the complete substitution of retroviral for cellular transcriptional control elements in the transduced allele.
Concordantly, the abundance ofthe
protein product
ofthetransducedallele intransformed cells is
substantially higher
than that ofthe c-myc geneproduct in normal cells. Ithasrecentlyalso been reported thataugmented
expression
ofac-myc gene with unaltered
coding
sequence issufficient forcotransformationofratembryo cellswitha mutant rasgene
(31). Hence, quantitative changes ingene
expression
rather thanqualitative changes in thestructureof thegeneproductmay be essential for the activation of the basic
oncogenic
function ofthe myc oncogene.ACKNOWLEDGMENTS
WethankBirgit SchroeerandChristiane Trachmannfor excellent technical assistance.
This work was supported by the Max-Planck-Gesellschaft, the DeutscheForschungsgemeinschaft, andthe Fonds derChemischen Industrie.
LITERATURE CITED
1. Alitalo, K., J. M. Bishop, D. H. Smith, E. Y. Chen, W.W.
Colby, and A. D. Levinson. 1983. Nucleotide sequenceof the v-myc oncogene of avian retrovirus MC29. Proc. Natl. Acad. Sci. USA80:100-104.
2. Alitalo, K.,G.Ramsay, J.M.Bishop,S.Ohlsson-Pfeiffer,W. W. Colby, and A. D. Levinson. 1983. Identification ofnuclear pro-teins encoded by viral and cellular myc oncogenes. Nature (London)306:274-277.
3. Bechade, C., G. Calothy, B. Pessac, P. Martin, J. Coll, F.
Denhez,S. Saule, J. Ghysdael,and D.Stehelin. 1985.Induction ofproliferationortransformation ofneuroretina cellsbythe mil and mycviraloncogenes. Nature (London)316:559-562.
4. Bishop, J. M. 1981. Enemies within: the genesis of retrovirus oncogenes. Cell 23:5-6.
5. Bister, K. 1984. Molecular biology of avian acute leukemia viruses, p. 38-63. In J. M. Goldman and 0. Jarrett (ed.), Leukemia andlymphoma research, vol.1.Mechanisms of viral leukaemogenesis. Churchill Livingstone, Ltd., Edinburgh. 6. Bister, K.,and P. H.Duesberg.1980.Geneticstructureof avian
acuteleukemia viruses. ColdSpring Harbor Symp. Quant. Biol. 44:801-822.
7. Bister, K., and P. H. Duesberg. 1982. Genetic structure and transforming genes of avian retroviruses, p. 3-42. InG. Klein (ed.), Advances in viral oncology, vol. 1. Raven Press, New York.
8. Bister, K.,M.J. Hayman,and P. K.Vogt.1977. Defectiveness of avian myelocytomatosis virus MC29: isolation of long-term nonproducer cultures and analysis of virus-specific protein synthesis. Virology82:431-448.
9. Bister, K., H.-C. Loliger, and P. H. Duesberg. 1979.
Oligoribonucleotide map and protein of CMII: detection of conserved and nonconserved genetic elements in avian acute
leukemia viruses CMII, MC29, and MH2. J. Virol. 32:208-219.
10. Bister, K., M. Nunn, C.Moscovici,B.Perbal,M. A.Baluda,and P. H. Duesberg. 1982. Acute leukemia viruses E26 and avian myeloblastosis virus have relatedtransformation-specificRNA sequences but differentgeneticstructures, gene products, and
oncogenic properties. Proc. Natl. Acad. Sci. USA 79:3677-3681.
11. Bister, K., G. Ramsay, M. J. Hayman, and P. H. Duesberg. 1980. OK10, an avian acute leukemia virus of the MC29 subgroup with a unique genetic structure. Proc. Natl. Acad. Sci. USA 77:7142-7146.
12. Chiswell, D. J., G. Ramsay, and M. J. Hayman. 1981. Two virus-specific RNAspeciesarepresentin cells transformedby defective leukemia virus OK10. J. Virol. 40:301-304.
13. Cooper, J. A., and T. Hunter. 1983. Identification and charac-terization of cellular targets fortyrosine proteinkinases. J. Biol. Chem. 258:1108-1115.
14. Frank, R.,W.Heikens,G.Heisterberg-Moutsis,and H.Blocker. 1983. A new general approach for the simultaneous chemical
synthesisoflargenumbersofoligonucleotides: segmentalsolid supports. Nucleic AcidsRes. 11:4365-4377.
15. Hackett,P.B.,R.Swanstrom,H. E.Varmus,andJ.M.Bishop. 1982.The leadersequenceofthesubgenomicmRNA'sofRous sarcoma virus is appoximately 390 nucleotides. J. Virol. 41:527-534.
16. Hann, S. R., H. D. Abrams, L. R. Rohrschneider, and R. N. Eisenman. 1983. Proteins encoded by v-myc and c-myc
onco-genes: identification and localization in acute leukemia virus transformants and bursal lymphoma cell lines. Cell 34:789-798.
17. Hayflick, J., P. H.Seeburg, R.Ohlsson, S.Pfeiffer-Ohlsson,D. Watson, T. Papas, and P. H. Duesberg. 1985. Nucleotide
se-quence oftwo overlapping myc-related genes in avian
carci-nomavirus OK10 and their relation tothe myc genesof other viruses and the cell. Proc. Natl. Acad. Sci. USA 82:2718-2722.
18. Hughes,S.H.,P. R.Shank, D. H.Spector,H.-J. Kung,J. M. Bishop, H. E. Varmus,P. K. Vogt,and M. L.Breitman. 1978. Proviruses of avian sarcoma virus are terminally redundant,
co-extensive with unintegrated linear DNA and integrated at
many sites. Cell15:1397-1410.
19. Jansen, H. W., and K. Bister. 1985. Nucleotide sequence analysisof the chickengenec-mil,the progenitorof the
retro-viraloncogene v-mil. Virology 143:359-367.
20. Jansen,H. W., R.Lurz, K. Bister,T. I.Bonner, G. E. Mark, and U. R. Rapp. 1984. Homologous cell-derived oncogenesin avian carcinoma virus MH2 and murine sarcoma virus 3611. Nature(London)307:281-284.
21. Jansen, H. W., T. Patschinsky, and K. Bister. 1983. Avian oncovirus MH2: molecularcloningofproviralDNAand
struc-turalanalysisofviral RNAandprotein.J. Virol. 48:61-73. 22. Jansen, H. W., T. Patschinsky, N. Walther, R. Lurz, and K. VOL.59, 1986
on November 10, 2019 by guest
http://jvi.asm.org/
352 PATSCHINSKY ET AL.
Bister. 1985. Molecular and biological properties of MH2D12, a spontaneous mil deletion mutant of avian oncovirus MH2. Virology 142:248-262.
23. Jansen, H. W., B.Ruckert, R. Lurz, and K. Bister. 1983. Two unrelatedcell-derived sequences in the genome of avian leuke-mia and carcinoma inducing retrovirus MH2. EMBO J. 2:1969-1975.
24. Jansen, H. W., C. Trachmann, T. Patschinsky, and K. Bister. 1985. Themillrafand myc oncogenes: molecular cloning and in vitro mutagenesis, p. 280-283. In R. Neth, R. C. Gallo, M. Greaves, and G. Janka (ed.),Modern trends in human leukemia VI. Springer-Verlag KG, Berlin.
25. Kan, N. C., C. S. Flordellis, C. F. Garon, P. H. Duesberg,and T.S. Papas. 1983. Avian carcinoma virus MH2 contains a transformation-specific sequence, mht, and shares the myc sequence with MC29, CMII, and OK10 viruses. Proc. Natl. Acad. Sci. USA80:6566-6570.
26. Kan, N. C., C. S. Flordellis, G. E. Mark, P. H. Duesberg,and T.S. Papas. 1984. Nucleotide sequence of avian carcinoma virus MH2: two potential onc genes, one related to avian virus MC29 and the other related to murine sarcomavirus 3611. Proc. Natl. Acad. Sci. USA81:3000-3004.
27. Kawai, S., and T. Koyama. 1984. Characterization of a Rous sarcoma virus mutant defective inpackaging its owngenomic RNA: biologicalpropertiesofmutantTK15andmutant-induced transformants. J. Virol. 51:147-153.
28. Koyama, T., F. Harada, and S. Kawai. 1984.Characterizationof a Rous sarcoma virus mutant defective in packaging its own genomic RNA: biochemical properties of mutant TK15 and mutant-induced transformants. J.Virol. 51:154-162.
29. Kramer, W., V. Drutsa, H. W. Jansen, B. Kramer, M. Pflugfelder, and H.-J. Fritz. 1984. The gapped duplex DNA approach to oligonucleotide-directed mutation construction. Nucleic Acids Res. 12:9441-9456.
30. Laimins, L. A., P. Tsichlis, and G. Khoury. 1984. Multiple enhancerdomainsin the3' terminus ofthe PraguestrainofRous sarcoma virus. Nucleic Acids Res. 12:6427-6442.
31. Lee, W. M. F., M. Schwab, D. Westaway, and H. E. Varmus. 1985. Augmented expression of normal c-myc is sufficient for cotransformation of rat embryocells with a mutant ras gene. Mol. Cell. Biol. 5:3345-3356.
32. Linial, M., and M. Groudine. 1985.Transcription ofthree c-myc exons is enhanced inchicken bursallymphomacelllines. Proc. Natl. Acad. Sci. USA 82:53-57.
33. Luciw, P. A., J. M. Bishop, H. E. Varmus, and M. R. Capecchi. 1983. Location and function ofretroviral and SV40 sequences thatenhancebiochemical transformationaftermicroinjection of DNA. Cell 33:705-716.
34. Mann, R., R. C. Mulligan, and D.Baltimore.1983. Construction ofaretrovirus packaging mutant anditsuse toproduce helper-freedefective retrovirus. Cell33:153-159.
35. Martin, G. S., K. Radke, S. Hughes, N. Quintrell, J. M. Bishop, and H. E. Varmus. 1979. Mutants of Rous sarcoma virus with extensive deletions of the viralgenome. Virology 96:530-546.
36. Martin, P., C. Henry, F. Ferre, C. Bechade, A. Begue, C. Calothy, B. Debuire, D. Stehelin, and S. Saule. 1986. Character-ization ofamyc-containing retrovirus generatedbypropagation ofan MH2 viral subgenomic RNA. J. Virol. 57:1191-1194. 37. Messing, J. 1983. New M13 vectors for cloning. Methods
Enzymol. 101:20-78.
38. Nishizawa, M., T. Koyama, and S. Kawai. 1985. Unusual featuresofthe leader sequence ofRous sarcomavirus packag-ing mutantTK15. J. Virol. 55:881-885.
39. Pachl, C., B. Biegalke, and M. Linial. 1983. RNA andprotein encoded by MH2 virus: evidenceforsubgenomicexpressionof v-myc. J. Virol. 45:133-139.
40. Papas, T. S., and J. A.Lautenberger. 1985. Sequence curiosity in v-myconcogene. Nature (London) 318:237.
41. Patschinsky, T., B. Schroeer, and K. Bister. 1986. Protein product ofproto-oncogene c-mil. Mol. Cell. Biol. 6:739-744. 42. Patschinsky, T.,G. Walter, and K. Bister. 1984. Immunological
analysis of v-myc gene products using antibodies against a
myc-specific synthetic peptide. Virology 136:348-358. 43. Pugatsch, T., and D. W. Stacey. 1983. Identification of a
sequence likely tobe required for avian retroviral packaging.
Virology128:505-511.
44. Ramsay, G.,and M.J. Hayman. 1980.Analysis of cells trans-formed by defective leukemia virus OK10: production of noninfectious particles and synthesis of Pr769"9 and an addi-tional 200,000-daltonprotein. Virology 106:71-81.
45. Reddy,E.P.,R. K.Reynolds,D.K. Watson,R.A.Schultz, J. Lautenberger, and T.S. Papas. 1983. Nucleotide sequence analysisof theproviral genomeofavianmyelocytomatosisvirus (MC29).Proc. Natl. Acad. Sci. USA80:2500-2504.
46. Richert,N.D.,P.J.A.Davies,G.Jay,andI. H. Pastan. 1979. Characterizationof an immunecomplex kinase in immunopre-cipitates of avian sarcoma virus-transformed fibroblasts. J. Virol. 31:695-706.
47. Robins, T., K. Bister, C. Garon, T. Papas, and P. Duesberg. 1982. Structural relationship between a normal chicken DNA locus and the transforming gene of the avian acute leukemia virus MC29. J. Virol. 41:635-642.
48. Sanger,F., S. Nicklen, and A. R. Coulson. 1977. DNA sequenc-ing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA74:5463-5467.
49. Schwartz, D. E., R. Tizard, and W. Gilbert. 1983. Nucleotide sequence ofRous sarcomavirus. Cell32:853-869.
50. Shank, P. R., and M. Linial. 1980. Avian oncovirus mutant (SE21Q1b) deficient in genomic RNA: characterization of a deletionin the provirus.J.Virol. 36:450-456.
51. Shaw, J.,M.J. Hayman,and P. J. Enrietto. 1985. Analysis ofa deleted MC29 provirus: gag sequences are not required for fibroblast transformation.J. Virol. 56:943-950.
52. Shih,C.-K., M. Linial, M. M. Goodenow, and W. S.Hayward. 1984. Nucleotide sequence 5' of the chicken c-myc coding region:localizationofa noncoding exon that is absentfrommyc transcripts in most avian leukosis virus-induced lymphomas. Proc. Natl. Acad. Sci. USA 81:4697-4701.
53. Smith,D. R.,B. Vennstrom, M. J. Hayman, and P. J. Enrietto. 1985.Nucleotidesequence ofHBI, a novelrecombinantMC29 derivative with altered pathogenic properties. J. Virol. 56: 969-977.
54. Sorge, J., W. Ricci, and S. H. Hughes. 1983. cis-actingRNA packaging locus in the 115-nucleotide direct repeat of Rous sarcoma virus. J. Virol.48:667-675.
55. Stacey, D. W. 1980. Expression of a subgenomic retroviral messenger RNA. Cell21:811-820.
56. Sutrave, P., T. I. Bonner, U. R. Rapp, H. W. Jansen, T. Patschinsky, and K. Bister. 1984. Nucleotidesequenceof avian retroviral oncogene v-mil: homologue of murine retroviral oncogene v-raf. Nature(London) 309:85-88.
57. Sutrave, P., H. W. Jansen, K. Bister, and U. R. Rapp. 1984. 3'-Terminal region of avian carcinoma virus MH2 shares se-quence elements with avian sarcomavirusesY73and SR-A. J. Virol. 52:703-705.
58. Thomas, P. S. 1980.Hybridization of denaturedRNAand small DNAfragments transferredtonitrocellulose.Proc.Natl. Acad. Sci. USA 77:5201-5205.
59. Varmus, H. E. 1984. The molecular genetics of cellular onco-genes. Annu. Rev. Genet. 18:553-612.
60. Vennstrom, B., D. Sheiness, J. Zabielski, and J. M. Bishop. 1982. Isolation and characterization of c-myc, a cellular homolog of the oncogene (v-myc) of avian myelocytomatosis virusstrain 29. J. Virol. 42:773-779.
61. Vogt, P. K. 1969. Focus assay of Rous sarcoma virus, p. 198-211. In K. Habel and N. P. Salzman (ed.), Fundamental techniques invirology. Academic Press, Inc., New York. 62. Walther, N., R. Lurz, T. Patschinsky, H. W. Jansen, and K.
Bister. 1985. Molecularcloning of proviral DNAand structural analysis ofthe transduced myc oncogene ofavian oncovirus CMII. J. Virol. 54:576-585.
63. Watanabe, S., and H. M. Temin. 1982.Encapsidationsequences for spleennecrosisvirus,anavianretrovirus,arebetween the 5' long terminal repeat and the startofthe gag gene. Proc. Natl. Acad. Sci. USA 79:5986-5990.
J. VIROL.
on November 10, 2019 by guest
http://jvi.asm.org/
ONCOGENIC myc ALLELES 353 64. Watanabe, S., and H. M. Temin. 1983.Construction ofahelper
cell line for avian reticuloendotheliosis virus cloning vectors.
Mol. Cell. Biol. 3:2241-2249.
65. Watson, D. K., E. P. Reddy, P. H. Duesberg, and T.S. Papas. 1983. Nucleotidesequence analysisofthechickenc-mycgene reveals homologous and unique coding regions by comparison
with the transforming gene of avian myelocytomatosis virus MC29, Agag-myc. Proc. Natl. Acad. Sci. USA 80:2146-2150. 66. Zhou, R.-P., N. Kan, T. Papas, and P. Duesberg. 1985.
Muta-genesis of avian carcinoma virus MH2: onlyoneoftwopotential transforming genes (bgag-myc) transforms fibroblasts. Proc. Natl. Acad. Sci. USA 82:6389-6393.
VOL. 59, 1986