Type I and Type II Interferons Inhibit the Translation of Murine Norovirus Proteins

10 

(1)JOURNAL OF VIROLOGY, June 2009, p. 5683–5692 0022-538X/09/$08.00⫹0 doi:10.1128/JVI.00231-09 Copyright © 2009, American Society for Microbiology. All Rights Reserved. Vol. 83, No. 11 Type I and Type II Interferons Inhibit the Translation of Murine Norovirus Proteins䌤 Harish Changotra,1† Yali Jia,1† Tara N. Moore,1 Guangliang Liu,1 Shannon M. Kahan,1 Stanislav V. Sosnovtsev,2 and Stephanie M. Karst1* Center for Molecular and Tumor Virology, Department of Microbiology and Immunology, Louisiana State University Health Sciences Center, Shreveport, Louisiana,1 and Laboratory of Infectious Diseases, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, Maryland2 Received 2 February 2009/Accepted 15 March 2009 Noroviruses, constituting a genus within the Caliciviridae family, are nonenveloped, icosahedral viruses. Their genomes are positive-sense single-stranded RNA molecules that are polyadenylated at their 3⬘ ends but lack 7-methylguanosine cap structures at their 5⬘ ends; instead, their 5⬘ ends covalently associate with a viral protein, VPg. Human noroviruses are estimated to be responsible for more than 95% of nonbacterial epidemic gastroenteritis worldwide. Outbreaks caused by noroviruses commonly arise in semiclosed communities such as nursing homes (49), schools, hospitals, cruise ships (53), disaster relief situations (2, 3), and military settings (4, 30, 47). Persons of all ages are susceptible to norovirus infection, but infection of the very young (42, 59), the elderly (49), and immunocompromised individuals (14, 34, 37) has been associated with much more severe disease than that caused in healthy adults. Noroviruses are emerging pathogens of public health concern and are classified as category B biodefense agents. Further, several recent reports signify the emergence of human noroviruses associated with increased virulence and varied clinical outcomes (4, 23, 29). Human noroviruses are thus associated with considerable morbidity and have significant economic impact. Noroviruses display a rapid onset and resolution of symptoms, so it is likely that components of the innate immune response are critical for restricting viral pathogenesis. Supporting this idea, recent work demonstrates that treatment of cells bearing a human norovirus replicon with either type I or type II interferon (IFN) results in a reduction of viral replication intermediates (5, 6). Primary human norovirus infection does not elicit lasting protective immunity (18, 24, 38), so the development of effective antiviral therapies, critical to prevent disease associated with these clinically important emerging pathogens, may rely on enhancing innate immune responses to infection. A lack of cell culture and small animal model systems has greatly hindered the study of human norovirus pathogenesis (11). We recently discovered the first murine norovirus (MNV), MNV-1, in immunocompromised mice (25) and have subsequently determined that this virus replicates in both macrophages (M␾s) and dendritic cells (DCs) in vitro (54). MNV-1 is infectious by both the peroral and intranasal routes of inoculation (25), and it spreads naturally between mice (20). After oral inoculation, MNV-1 replicates in the intestine and rapidly disseminates to various peripheral tissues in immunocompetent mice (36). Infection of wild-type mice is associated with histopathological alterations in the intestine and the spleen. While MNV-1 does not cause serious clinical disease in immunocompetent hosts, oral MNV-1 infection causes fatal disease in mice lacking intact IFN signaling pathways, either * Corresponding author. Mailing address: Center for Molecular and Tumor Virology, Department of Microbiology and Immunology, Louisiana State University Health Sciences Center, 1501 Kings Highway, Shreveport, LA 71130. Phone: (318) 675-8122. Fax: (318) 675-5764. E-mail: skarst@lsuhsc.edu. † H.C. and Y.J. contributed equally to this study. 䌤 Published ahead of print on 18 March 2009. 5683 Downloaded from http://jvi.asm.org/ on November 8, 2019 by guest Human noroviruses are responsible for more than 95% of nonbacterial epidemic gastroenteritis worldwide. Both onset and resolution of disease symptoms are rapid, suggesting that components of the innate immune response are critical in norovirus control. While the study of the human noroviruses has been hampered by the lack of small animal and tissue culture systems, our recent discovery of a murine norovirus (MNV) and its in vitro propagation have allowed us to begin addressing norovirus replication strategies and immune responses to norovirus infection. We have previously demonstrated that interferon responses are critical to control MNV-1 infection in vivo and to directly inhibit viral replication in vitro. We now extend these studies to define the molecular basis for interferon-mediated inhibition. Viral replication intermediates were not detected in permissive cells pretreated with type I interferon after either infection or transfection of virion-associated RNA, demonstrating a very early block to virion production that is after virus entry and uncoating. A similar absence of viral replication intermediates was observed in infected primary macrophages and dendritic cells pretreated with type I IFN. This was not due to degradation of incoming genomes in interferon-pretreated cells since similar levels of genomes were present in untreated and pretreated cells through 6 h of infection, and these genomes retained their integrity. Surprisingly, this block to the translation of viral proteins was not dependent on the well-characterized interferon-induced antiviral molecule PKR. Similar results were observed in cells pretreated with type II interferon, except that the inhibition of viral translation was dependent on PKR. Thus, both type I and type II interferon signaling inhibit norovirus translation in permissive myeloid cells, but they display distinct dependence on PKR for this inhibition.

(2) 5684 CHANGOTRA ET AL. treatment of primary DCs inhibits the replication of Sindbis virus, a Togaviridae family member, either at the level of RNA genome stability or at the stage of nonstructural protein translation even in the absence of PKR, RNase L, and Mx (40). Numerous additional antiviral molecules induced by IFN-␣/␤ have now been identified, such as the adenosine deaminase that acts on dsRNA (ADAR1) (51), the ubiquitin homolog ISG15 (26), and viperin (8), and the physiologic relevance of such molecules is beginning to be defined (27, 56). A complete understanding of antiviral mechanisms requires identification of specific blocks to viral replication and the host factors responsible for such effects. While we have previously demonstrated that the type I IFN receptor and the STAT-1 molecule are critical to prevent progeny MNV-1 virion production in permissive cells (54), the underlying molecular basis for this inhibition has not been determined. Similarly, treatment of human norovirus replicon-bearing cells with either type I or type II IFN causes a decrease in levels of virus proteins and RNA species (5, 6), but the mechanism of this inhibition is currently unclear. Here, we report that both type I and type II IFN inhibit the translation of MNV-1 nonstructural proteins in M␾s and DCs. Whereas type II IFN-mediated inhibition is dependent on PKR, type I IFN-mediated inhibition can occur in its absence. Thus, type I, but not type II, IFN signaling can block MNV-1 translation through a PKR-independent process. MATERIALS AND METHODS Cells. The murine M␾ cell lines RAW264.7, J774.1, P388D1, and IC-21 and the murine/human hybrid M␾ cell line WBC264-9C (American Type Culture Collection) were maintained in Dulbecco modified Eagle medium (Invitrogen) supplemented with 10% fetal calf serum (HyClone), 100 U of penicillin/ml, 100 ␮g of streptomycin/ml, 10 mM HEPES, and 2 mM L-glutamine. Differentiation protocols for M␾s and DCs from murine bone marrow have been described (54). Mice. 129S6/SvEvTac mice (Taconic 129SVE; referred to as 129SvEv mice hereafter) were bred and housed at Louisiana State University Health Sciences Center, Shreveport (LSUHSC-S) under specific-pathogen-free conditions in accordance with Federal and University guidelines. Mice triply deficient in PKR, RNase L, and Mx1 (58) (referred to as TD mice hereafter) were kindly provided by Kate Ryman (LSUHSC-S). MNV-1 virion purification. The triply plaque-purified MNV-1.CW1 isolate (54) was used for all experiments. The stock of MNV-1.CW1 used for experiments was generated from the fifth passage of this isolate in cell culture. Virions were purified as described previously (54). Briefly, RAW264.7 cells were infected at a multiplicity of infection (MOI) of 0.05 for ⬃40 h, frozen, and thawed two times, and cell debris was removed by centrifugation at 3,000 rpm for 20 min. The supernatant fluid was layered onto a 30% sucrose cushion and centrifuged in a SW32 rotor at 90,000 ⫻ g for 3 h at 4°C. The pellet was resuspended in 10% Sarkosyl, the tubes were washed with phosphate-buffered saline, and the total volume was mixed with cesium chloride to reach a density of 1.343 g/cm3. The mixture was then centrifuged in a SW55 rotor at 115,000 ⫻ g for 40 h at 12°C. The gradients were fractionated into four fractions and individually dialyzed against phosphate-buffered saline overnight at 4°C; the virus titer of each fraction was determined by plaque assay. Mock preparations were generated in the same manner beginning with RAW264.7 cell lysates from uninfected cultures. Recombinant IFN treatment, infections, and transfections. Cells were pretreated with 1,000 international units of recombinant murine IFN-␤ (rIFN-␤; PBL Biomedical Laboratories) or rIFN-␥ (PeproTech, Inc.) per ml of supplemented Dulbecco modified Eagle medium for 18 to 20 h in all experiments, unless otherwise indicated. The media containing rIFN was removed after the pretreatment, and the cells were washed. For infections, virus was added to the cells for 1 h on ice. Cells were then washed to remove unbound virus, and the media containing rIFN were added back to the cells. For introduction of virionassociated RNA into RAW264.7 cells, RNA extracted from MNV-1.CW1 virions using TRIzol (Invitrogen) was transfected into cells using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s protocol. Briefly, virion-associated Downloaded from http://jvi.asm.org/ on November 8, 2019 by guest due to a lack of both type I and type II IFN receptors (IFN␣␤␥R⫺/⫺ mice) or due to a lack of the STAT-1 molecule (STAT1⫺/⫺ mice) (25). Infection of STAT1⫺/⫺ mice results in seeding of the proximal intestines and rapid virus replication, followed by dissemination of virus to the mesenteric lymph nodes, spleens, livers, lungs, and distal lymph nodes (36). Virus replicates to significantly higher titers in both mucosal and peripheral sites in STAT1⫺/⫺ mice compared to wild-type controls. Infection is also associated with rapid weight loss, severe gastric bloating, diarrhea, pneumonia, and destruction of both splenic and liver tissue (25, 36). These data highlight the absolutely critical requirement for functional IFN responses in MNV-1 protection in vivo. Moreover, we have determined that IFN responses limit MNV-1 virion production in primary bone marrow-derived M␾s (BMM␾s) and DCs (BMDCs) (54). IFNs are critical components of the innate immune response to viral infection (16, 28, 39, 44). The most well-characterized role of IFNs is to directly inhibit the replication of viruses through the induction of an antiviral state (44). The type I IFNs, including both alpha and beta IFNs (IFN-␣/␤), are produced by most virus-infected cells. Once secreted, IFN-␣/␤ bind to a common receptor on neighboring uninfected cells and initiate a paracrine signaling cascade. Both the IFN-␣/␤ receptor and downstream signaling molecules, including STAT-1, are critical for protection from viral infection as mice deficient in these factors do not mount effective antiviral responses (12, 22, 31). The single type II IFN, IFN-␥, is produced by specific cells of the immune system including NK cells, CD4⫹ T helper 1 cells, and CD8⫹ cytotoxic T cells. It has more recently been shown that antigen-presenting cells such as DCs and M␾s can also produce large amounts of IFN-␥ in response to interleukin-12 and that this production contributes to pathogen control in vivo (13, 50). Receptor engagement by IFN-␥ results in activation of the tyrosine kinases JAK-1 and JAK-2 and subsequent phosphorylation of STAT-1. STAT-1 homodimers then translocate to the nucleus and bind a promoter sequence called the IFN-␥-activated site element to activate gene transcription. Mice lacking a functional IFN-␥ receptor (IFN␥R⫺/⫺ mice) are susceptible to vaccinia virus (21) but not to other viruses that cause increased disease in IFN␣␤R⫺/⫺ mice (35), showing that the two systems are not functionally redundant in all situations. IFN signaling culminates in the induction of hundreds of genes referred to as IFN-stimulated genes (ISGs), the actions of which generate an antiviral state. Multiple ISGs have defined roles in directly inhibiting viral replication. For example, the double-stranded RNA (dsRNA)-activated protein kinase (PKR) phosphorylates and inhibits the activity of cellular eukaryotic translation initiation factor 2␣ (eIF-2␣) that is required for viral and host translation (32). Another well-characterized IFN-␣/␤-induced antiviral pathway involves two enzymes, the dsRNA-dependent 2⬘-5⬘ oligoadenylate synthetase and RNase L (15, 57). Specifically, 2⬘-5⬘ oligoadenylate synthetase bound to dsRNA generates 2⬘-5⬘ linked adenylate oligomers that activate latent RNase L, which then cleaves both viral and host single-stranded RNAs. Moreover, the importance of additional antiviral molecules is evident from studies showing that cells or organisms triply deficient in PKR, RNase L, and Mx remain resistant to infection with IFN-␣/␤sensitive viruses (25, 40, 54, 55, 58). For example, IFN-␣/␤ J. VIROL.

(3) VOL. 83, 2009 IFN-MEDIATED INHIBITION OF MNV REPLICATION RESULTS We have previously demonstrated that IFN responses are critical to prevent overall MNV-1 virion production in primary M␾s and DCs (54), but the molecular basis of this inhibition was not defined. Studies to define this mechanism(s) would be facilitated by the use of a permissive cell line that is sensitive to IFN. Murine M␾ cell lines such as RAW264.7 cells are permissive to MNV-1 (54), so we examined whether type I IFN inhibits MNV-1.CW1 virion production in these cells after various rIFN-␤ treatments. Both pre- and posttreatment of RAW264.7 cells resulted in robust inhibition of viral replication (Fig. 1A). These concentrations of rIFN-␤ were not toxic to the cells, as determined by trypan blue exclusion comparisons of treated and untreated cells (data not shown). MNV1.CW1 virion production was inhibited by rIFN-␤ pretreatment in a dose-dependent manner and occurred over a range of MOIs in RAW264.7 cells (Fig. 1B). MNV-1.CW1 displayed various degrees of sensitivity to rIFN-␤ pretreatment in other M␾ cell lines (Fig. 1C), suggesting that certain murine M␾ cell lines (i.e., IC-21) may be deficient in their ability to respond to IFN, a common phenomenon in immortalized cell lines (43). Type I IFN pretreatment also inhibited MNV-1 virion production in primary BMM␾s and BMDCs in a dose-dependent manner (Fig. 1D). Type I IFN inhibits MNV-1 virion production prior to the production of nonstructural proteins. To determine whether the earliest steps in the virus replication cycle, virus entry and genome uncoating, were targeted by type I IFN responses, we compared progeny virion production after transfection of virion-associated RNA into untreated and rIFN-␤-pretreated cells (Fig. 2A), since transfecting MNV-1 RNA into cells bypasses the steps of entry and uncoating. Overall, progeny virion production was significantly inhibited by rIFN-␤ pretreatment when transfection of virion-associated RNA was used to initiate infection, demonstrating a block downstream of these earliest events. The transfection efficiency of a fluorescent RNA oligonucleotide was unaffected by rIFN-␤ pretreatment of RAW264.7 cells (data not shown). Because protein synthesis is thought to initiate intracellular norovirus replication after uncoating of the incoming genome, we next questioned whether viral proteins were detected in cells treated with type I IFN. To examine this, we performed immunoblotting of cell lysates generated from untreated or rIFN-␤-pretreated RAW264.7 cells. The levels of the nonstructural polymerase protein (Pol; 57.5 kDa) and the structural capsid protein (58.6 kDa) were significantly reduced in rIFN-␤-pretreated cells compared to untreated cells at 6 and 12 h postinfection (hpi) (Fig. 2B). When we probed the cell lysates with polyclonal antibody to the ProPol nonstructural polyprotein, we also detected a smaller protein corresponding in size to VPg-Pro (33.5 kDa) and several larger species consistent in size with VPg-Pro-Pol (91.0 kDa) and p18-VPg-Pro-Pol (109.6 kDa) polyproteins in untreated, but not rIFN-␤-pretreated, cells. Upon overexposure of this film, we also detected a species corresponding in size to the viral protease (19.2 kDa) in untreated cells at 12 hpi (data not shown). When probing cell lysates with polyclonal antibody to the capsid protein, we also detected a larger protein consistent in size with a capsid dimer in untreated, but not rIFN-␤-pretreated, cells at 12 hpi. Such a species has previously been detected in MNV-1-infected RAW264.7 cells (48). Several smaller species of unknown identity were also detected at 12 hpi. Consistent with these studies in which infection was initiated with virions, nonstructural and capsid proteins were not detected in rIFN-␤-pretreated cells when infection was initiated with transfection of virion-associated RNA (data not shown). The kinetics of viral protein synthesis observed here in untreated cells are in agreement with a previous study, in which it was shown that nonstructural proteins are detectable 8 to 12 hpi (by immunoblotting) and newly synthesized MNV-1 capsid protein is detectable 8 hpi (by metabolic labeling and immunoprecipitation) in RAW264.7 cells infected at an MOI of 2 to 4 (48). Type I IFN signaling does not result in the degradation of incoming genomes. A reduction in nonstructural proteins in rIFN-␤-pretreated cells could be explained by either decreased genome stability or by a block to translation of viral proteins. To distinguish between these possibilities, we examined the integrity of viral genomes in rIFN-␤-pretreated cells. The numbers of viral genomes in untreated and rIFN-␤-pretreated cells Downloaded from http://jvi.asm.org/ on November 8, 2019 by guest RNA was mixed with an equal volume of Lipofectamine 2000, both diluted in Opti-MEM medium (Invitrogen). After 20 min at room temperature, the RNALipofectamine 2000 complexes were added to cells for 2 to 3 h. Cells were washed to remove noninternalized complexes, and the media containing rIFN were added back to the cells. The transfection efficiency was determined in every experiment by transfecting a 100 nM concentration of fluorescein-labeled BLOCK-iT RNA oligonucleotide (Invitrogen) into RAW264.7 cells and determining the frequency of fluorescence-positive cells 24 h posttransfection. In all experiments, 85 to 95% of cells were fluorescence positive. None of the rIFN treatment conditions altered transfection efficiency of the BLOCK-iT RNA oligonucleotide. MNV-1 plaque assay. Progeny virions in culture supernatants were quantified by using a plaque assay that has been previously described (54). Briefly, 2 ⫻ 106 RAW264.7 cells were seeded into each well of six-well plates, and infections were performed the following day with 10-fold dilutions of virus samples in duplicate. After a 1-h infection at room temperature, the inoculum was removed, and the cells were overlaid with 1.5% SeaPlaque agarose (Cambridge Biosciences) in complete minimal essential medium. After 48 h of incubation at 37°C, plaques were visualized 3 to 4 h after overlaying them with 1.5% SeaKem agarose (Cambridge Biosciences) in complete minimal essential medium containing 0.01% neutral red. Protein analysis. For Western blot analysis, standard protocols were used to separate cell lysates by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transfer the proteins to polyvinylidene difluoride membranes. These were probed with either polyclonal rabbit antibody to the MNV-1 structural capsid protein (25) or goat antibody to the MNV-1 nonstructural protease-polymerase (ProPol) polyprotein (ProPol protein for goat immunization was generated as previously described [48]), followed by incubation with appropriate peroxidaselabeled secondary antibody and enhanced chemiluminescence (Amersham) development. After exposure to film, the membranes were stripped with Restore Plus Western blot stripping buffer (Thermo Scientific) and reprobed for ␤-actin. qRT-PCR. Total RNA was extracted from cells by using TRIzol (Invitrogen) according to the manufacturer’s protocols, 1 ␮g of RNA was used to generate single-stranded cDNA using ImProm-II reverse transcriptase (Promega), and equivalent volumes of cDNA were used in triplicate quantitative reverse transcription-PCRs (qRT-PCRs). The following virus-specific primers were used: 5⬘end-f, CCTGTGATCGGCTCTATCTT; 5⬘end-r, CTTCTCCACATCAATCG TTG; 3⬘end-f, AATCTCCGGTTCATGGGT; and 3⬘end-r, AATCAGGGTGA ATGTCGC. Dilutions of plasmids containing virus primer target sequences were included in triplicate reactions to generate standard curves. Triplicate reactions were also performed for each sample with primers specific to 18S rRNA (forward, CGCCGCTAGAGGTGAAATTCT; reverse, CGAACCTCCGACTTTC GTTCT). A standard curve was generated by including dilutions of a known concentration of cellular cDNA, amplified with 18S rRNA primers, on each plate. The levels of viral genomes were normalized to 18S levels, and the approximate cell numbers were determined based on 1.7 ⫻ 105 cells per ␮g of murine cDNA. 5685

(4) 5686 CHANGOTRA ET AL. J. VIROL. over the first 8 h of infection were determined by qRT-PCR using primers near either the 5⬘ end or the 3⬘ end of the MNV-1 genome. There was no significant reduction in the number of genomes detected in untreated or rIFN-␤-pretreated cells between 0 and 8 hpi (Fig. 2C), demonstrating that the MNV-1.CW1 genome is not rapidly degraded by type I IFN-induced molecules. While a significant increase in genome levels was observed between 6 and 8 hpi in untreated cells, this increase was not observed in rIFN-␤-pretreated cells, confirming that the type I IFN-mediated block precedes viral RNA replication. Because RT-PCR amplifies only a small region of the genome, it was formally possible that partial genome degradation did occur in rIFN-␤-pretreated cells but was not detectable by this methodology. To confirm our qRT-PCR results, we next performed an RNA transfer experiment whereby total RNA was extracted from untreated or rIFN-␤-pretreated cultures after 1 or 8 h of MNV-1.CW1 infection, the RNA was transfected into untreated cells, and infection was allowed to proceed for 24 h in these secondary cultures. Comparable numbers of virions were produced in secondary cultures transfected with RNA collected at 1 hpi from untreated or rIFN␤-pretreated cells (Fig. 2D). In two separate experiments, transfection of RNA from 1-h-infected rIFN-␤-pretreated cells actually resulted in a slightly higher level of virion production in secondary cultures compared to transfection of RNA from 1-h-infected untreated cells, but this difference was not statistically significant. As expected, transfer of RNA from 8-hinfected untreated cells resulted in a higher level of virion production compared to the transfer of RNA from 8-h-infected rIFN-␤-pretreated cells. Type II IFN also inhibits the translation of MNV-1 nonstructural proteins. The ability of type II IFN signaling to directly inhibit MNV replication has not previously been analyzed. Although MNV-1 replicates similarly in BMM␾s generated from IFN␥R⫺/⫺ mice compared to 129SvEv mice (54), this cell type is not expected to produce significant amounts of IFN-␥ in culture. Therefore, we tested whether MNV-1.CW1 could replicate efficiently in RAW264.7 cells pretreated with rIFN-␥. Type II IFN signaling potently inhibited overall virion production in a dose-dependent manner after either infection (Fig. 3A) or transfection of virion-associated RNA (Fig. 3B). The type II IFN-mediated block to MNV-1.CW1 infection was associated with significantly reduced levels of both nonstructural and structural proteins at 6 and 12 hpi compared to levels Downloaded from http://jvi.asm.org/ on November 8, 2019 by guest FIG. 1. Type I IFN potently inhibits MNV-1 replication in M␾s and DCs. (A) Different IFN treatment conditions (pretreatment or posttreatment with respect to infection) were tested for MNV-1.CW1 inhibition. For pretreatment, RAW264.7 cells were pretreated with 1,000 U of rIFN-␤/ml for 18 to 20 h prior to infection. For posttreatment, RAW264.7 cells were treated with 100 U of rIFN-␤/ml immediately after infection. Cells were infected with MNV-1.CW1 at an MOI of 1 for 1 h on ice, supernatants were collected 24 hpi, and virus titers determined by plaque assay. (B) RAW264.7 cells were untreated or pretreated with increasing amounts of rIFN-␤ for 18 to 20 h. Cells were then infected with MNV-1.CW1 at an MOI of 0.1, 1, or 10 for 1 h on ice. Supernatants were collected 24 hpi, and the virus titers were determined by plaque assay. (C) WBC264-9C, J774.1, P388D1, and IC-21 M␾ cell lines were pretreated with various amounts of rIFN-␤ for 18 to 20 h prior to infection with MNV-1.CW1 at an MOI of 1, based on titration of the virus stock on RAW264.7 cells. Titers of supernatants collected 24 hpi were determined by plaque assay. The data are presented as the average fold increases in inhibition comparing the number of virions in rIFN␤-pretreated cells to the number in untreated cells, on a logarithmic scale. (D) Primary BMM␾s and BMDCs were differentiated from 129SvEv mice. Cells were treated with increasing amounts of rIFN-␤ for 18 to 20 h prior to infection with MNV-1.CW1 at an MOI of 1. Titers of supernatants collected 24 hpi were determined by plaque assay. In all cases, duplicate wells per condition were tested in individual experiments, and data from three or more independent experiments are averaged.

(5) VOL. 83, 2009 IFN-MEDIATED INHIBITION OF MNV REPLICATION 5687 in the untreated control cell (Fig. 3C), as was observed for the block in rIFN-␤-pretreated cells. Moreover, genome stability and integrity were unaltered (Fig. 3D and E). We conclude that both type I and type II IFN inhibit MNV-1.CW1 replication through a mechanism that targets translation of viral proteins from the incoming genomes. Type I and type II IFN inhibit MNV-1 virion production similarly in primary cells. To determine whether our findings in RAW264.7 cells were indicative of events occurring in primary cells, we compared viral Pol levels in untreated versus rIFN-pretreated wild-type 129SvEv (WT) BMM␾s and BMDCs. The Pol protein was not detectable in rIFN-␤-pretreated or rIFN-␥-pretreated BMM␾s (data not shown), was absent in rIFN-␤-pretreated BMDCs (Fig. 4A), and was significantly reduced in rIFN-␥-pretreated BMDCs compared to untreated control cells (Fig. 4B). Overall, these data support the conclusion that type I and type II IFN block MNV-1.CW1 virion production in primary M␾s and DCs as they do in RAW264.7 cells. The block to MNV-1 translation mediated by type I and type II IFN is differentially dependent on PKR. To determine whether the block to MNV-1.CW1 translation is PKR dependent or PKR independent, we next compared viral protein levels in untreated and rIFN-pretreated BMDCs generated from mice triply deficient in PKR, RNase L, and Mx1 (TD cells). Although viral Pol was not detected in TD BMDCs Downloaded from http://jvi.asm.org/ on November 8, 2019 by guest FIG. 2. Type I IFN inhibits early MNV-1 translation. In all experiments, RAW264.7 cells were either untreated or pretreated with 1,000 U of rIFN-␤/ml for 18 to 20 h. (A) Cells were then transfected with 0.2 ␮g of virion-associated RNA. Supernatants were collected 24 h posttransfection, and virus titers were determined by plaque assay. Duplicate wells per condition were tested in three independent experiments, and the data were averaged. The limit of detection is 10 PFU/ml. Infectious virions were only detected in three of the six supernatants tested from rIFN-␤-pretreated cells. (B) Cells were infected with MNV-1.CW1 at an MOI of 1 for 1 h on ice. Cell lysates were collected at 0, 6, or 12 hpi and analyzed by immunoblotting. Blots were first probed with ␣-ProPol, then stripped and reprobed with ␣-capsid, and finally stripped and reprobed with ␣-actin antibody as a loading control. The data are representative of three experiments, with duplicate wells tested in each experiment. (C) Cells were infected with MNV-1.CW1 at an MOI of 10, or mock infected, for 1 h on ice. Total RNA was extracted from cell lysates at 0, 0.5, 1, 2, 4, 6, or 8 hpi; single-stranded cDNA was generated; and triplicate qRT-PCRs were performed with primers specific to the 5⬘ end of the MNV-1 genome, the 3⬘ end of the MNV-1 genome, or 18S rRNA for normalization. No virus signal was detected in mock-infected cultures (data not shown). The data from two experiments were averaged, with duplicate wells tested in each experiment. (D) Cells were infected with MNV-1.CW1 at an MOI of 10 for 1 h on ice. Total RNA was extracted from untreated or rIFN-␤-pretreated cells at 1 or 8 hpi, and 2 ␮g was transfected into 2 ⫻ 105 untreated cells using Lipofectamine 2000. Supernatants were collected at 24 h posttransfection, and virus titers were determined by plaque assay. Duplicate wells per condition were tested in two independent experiments, and the data were averaged. The limit of detection is 20 PFU/ml.

(6) 5688 CHANGOTRA ET AL. J. VIROL. pretreated with rIFN-␤ (Fig. 4C), near-normal levels of Pol were detected in TD BMDCs pretreated with rIFN-␥ compared to untreated control cells (Fig. 4D). Although we observed a modest reduction in Pol levels in rIFN-␥-pretreated cells in some experiments, such as the one presented in Fig. 4D, equivalent levels of Pol were detected in untreated and rIFN-␥-pretreated TD BMDCs in other experiments (data not shown). The stochastic nature of this phenotype was confirmed by densitometry in which we normalized Pol levels to actin (data not shown). Even though the magnitude of the phenotype was slightly variable across experiments, the level of Pol in rIFN-␥-pretreated TD cells was reproducibly much higher than that detected in rIFN-␥-pretreated WT cells. We conclude that PKR (or RNase L; see the Discussion) is required for MNV-1 translation inhibition upon type II, but not type I, IFN signaling. Similar observations were made in TD BMM␾s (data not shown). This differential dependence on PKR for type I IFN-mediated versus type II IFN-mediated inhibition of early MNV-1 replication was also apparent when the levels of virion production were compared over the first 12 h of infection (Fig. 4E): while an increase in the number of virions was observed between 6 and 12 hpi in rIFN-␥-pretreated TD BMDCs and in untreated cells, no such increase was detected in rIFN-␥-pretreated WT cells. Conversely, no virion production was detected in either WT or TD cells pretreated with rIFN-␤. Collectively, these data demonstrate that type I IFN induces a PKR-independent mechanism of translation inhibi- tion that targets MNV-1; while type II IFN can also inhibit MNV-1 translation, this inhibition is dependent on PKR. Type I, but not type II, IFN inhibits a late step in the viral replication cycle. During the course of analyzing virion production in rIFN-pretreated cells, we noticed that the levels of virions at late time points did not precisely reflect the inhibitions we observed in early viral translation (Fig. 2 to 4) or in early virion production (Fig. 4E). To examine the possibility that MNV-1 overcomes the early IFN-mediated translation block in infected cells, we measured virion production in WT BMDCs pretreated with either rIFN-␤ or rIFN-␥, or untreated, at late time points (Fig. 5A). Although virion production was rescued in rIFN-␥-pretreated cells to levels near those observed in untreated cells (⬃10-fold reduction in virions in rIFN-␥-pretreated cells compared to untreated cells 24 to 72 hpi), type I IFN-mediated inhibition lasted through 72 h of infection (⬃300-fold reduction in virions in rIFN-␤-pretreated cells compared to untreated cells 24 to 72 hpi). Interestingly, the type I IFN-mediated inhibition observed at later time points was dependent on either PKR or RNase L since it was not observed in TD BMDCs (Fig. 5B and C). These data demonstrate a second point of divergence between the mechanisms used by type I and type II IFN to inhibit MNV-1 replication: type I IFN-induced ISGs (including at least PKR or RNase L) can target a late MNV-1 replication step, but type II IFN-induced ISGs cannot. Downloaded from http://jvi.asm.org/ on November 8, 2019 by guest FIG. 3. Type II IFN inhibits early MNV-1 translation. (A and B) RAW264.7 cells were untreated or pretreated with increasing amounts of rIFN-␥ for 18 to 20 h. Cells were then infected with MNV-1.CW1 at an MOI of 1 for 1 h on ice (A) or transfected with 0.2 ␮g of virion-associated RNA (B). Supernatants were collected 24 h later, and virus titers were determined by plaque assay. Duplicate wells per condition were tested in two independent experiments, and the data were averaged. The limit of detection was 10 PFU/ml. (C to E) RAW264.7 cells were either untreated or pretreated with 1,000 U of rIFN-␥/ml for 18 to 20 h. (C) Cells were infected with MNV-1.CW1 at an MOI of 1 for 1 h on ice. Cell lysates were collected at 0, 6, or 12 hpi and analyzed by immunoblotting. Blots were first probed with ␣-ProPol, then stripped and reprobed with ␣-capsid, and finally stripped and reprobed with ␣-actin antibody as a loading control. The data are representative of two experiments, with duplicate wells tested in each experiment. (D) Cells were infected with MNV-1.CW1 at an MOI of 10, or mock infected, for 1 h on ice. Total RNA was extracted from cell lysates at 0, 0.5, 1, 2, 3, 4, 6, or 8 hpi; single-stranded cDNA was generated, and triplicate qRT-PCRs were performed with primers specific to the 5⬘ end of the MNV-1 genome or 18S rRNA for normalization. No virus signal was detected in mock-infected cultures (data not shown). The data from two experiments were averaged, with duplicate wells tested in each experiment. (D) Cells were infected with MNV-1.CW1 at an MOI of 10 for 1 h on ice. Total RNA was extracted from untreated or rIFN-␥-pretreated cells at 1 or 8 hpi, and 2 ␮g was transfected into 2 ⫻ 105 untreated cells using Lipofectamine 2000. Supernatants were collected 24 h posttransfection, and virus titers were determined by plaque assay. Duplicate wells per condition were tested in two independent experiments, and the data were averaged. The limit of detection is 20 PFU/ml.

(7) VOL. 83, 2009 IFN-MEDIATED INHIBITION OF MNV REPLICATION 5689 DISCUSSION We demonstrate here that both type I and type II IFN signaling inhibit the accumulation of MNV-1 nonstructural proteins. The earliest steps of infection, viral entry and genome uncoating, do not appear to be major targets of IFN responses because transfection of virion-associated RNA (which should bypass these initial steps) into rIFN-pretreated cells did not alleviate the block to progeny virion production. The extent of inhibition observed in rIFN-pretreated cells when infection was initiated with virions was greater than that observed when infection was initiated with virion-associated RNA. While this could indicate multiple IFN-mediated blocks to MNV-1 virion production, one at the level of entry or uncoating and one subsequent to these initial steps, a direct comparison of infection and transfection conditions is not possible: the transfection efficiency of a fluorescently labeled RNA oligonucleotide into RAW264.7 cells was consistently 85 to 95%, so we presume a majority of cells were transfected with virion-associated RNA, but it is unclear how many genomes were delivered to each transfected cell. Thus, the exact “multiplicity of transfec- tion” is unclear, and this could influence the extent to which inhibitors are effective. We can conclude from these data that there is an IFN-mediated block to MNV-1 replication that occurs after entry and genome uncoating but prior to the translation of the nonstructural polyprotein. There are several possible explanations for the drastically reduced levels of nonstructural protein observed in rIFN-pretreated cells: (i) genome stability may be altered such that there is a reduction in template molecules available for translation or (ii) the production, processing, or stability of nonstructural proteins may be blocked. The first explanation, decreased genome stability, is unlikely because no reduction in the number of genomes was detected 0 to 8 hpi in rIFNpretreated cells by qRT-PCR with primers near either the 5⬘ or the 3⬘ ends of the genome. Moreover, viral RNA collected from rIFN-pretreated cells 1 h after infection retained its integrity, as determined by the production of infectious virions upon its transfer into untreated cells. This combination of strategies, qRT-PCR and RNA transfer, has been used to demonstrate that Sindbis virus infection does not alter the Downloaded from http://jvi.asm.org/ on November 8, 2019 by guest FIG. 4. Type I and type II IFN inhibit MNV-1 translation in primary DCs. BMDCs were differentiated from wild-type 129SvEv (WT) mice (A and B) or triply deficient PKR/RNaseL/Mx1⫺/⫺ (TD) mice (C and D) and then either left untreated or pretreated with 1,000 U of rIFN-␤ (A and C) or rIFN-␥ (B and D)/ml for 18 to 20 h. Cells were then mock infected or infected with MNV-1.CW1 at an MOI of 1 for 1 h on ice. Cell lysates were collected at 0, 6, 12, and 24 hpi for MNV-1.CW1-infected cultures and at 24 hpi for mock-infected cultures (24M) and analyzed by immunoblotting with antibody to ProPol. Blots were stripped and reprobed with ␣-actin antibody as a loading control. The data are representative of three experiments. (E) WT or TD BMDCs were either left untreated, pretreated with 1,000 U of rIFN-␤/ml, or pretreated with 1,000 U of rIFN-␥/ml for 18 to 20 h. Cells were infected with MNV-1.CW1 at an MOI of 1 for 1 h on ice. Supernatants were collected at 0, 6, 9, and 12 hpi, and virus titers were determined by plaque assay. Duplicate wells per condition were tested, and the data were averaged. The number of virions at each time point after 0 hpi was then normalized to the number of virions detected at 0 hpi, which was assumed to be the level of input virus. The experiment was repeated twice, and the data were averaged.

(8) 5690 CHANGOTRA ET AL. J. VIROL. stability of transfected mRNAs even though those mRNAs are not translated efficiently (45). Therefore, the most likely explanation for our results is that nonstructural protein production or accumulation is prevented by an IFN-induced antiviral molecule(s). In addition to demonstrating that MNV-1 genomes are not rapidly degraded in rIFN-pretreated cells, the qRT-PCR studies reported here also provide valuable information with regard to the kinetics of norovirus RNA replication: while the number of genomes detected per cell in untreated cultures was relatively constant between 0 and 4 hpi (⬃20 genomes/cell), an approximate doubling in genome numbers was observed at 6 hpi (⬃40 genomes/cell) and a significant increase was observed at 8 hpi (⬃350 genomes/cell) (see Fig. 2C and 3D). Thus, the first round of MNV-1 RNA replication is initiated by 6 hpi, and multiple rounds have occurred by 8 hpi in RAW264.7 cells. A complete understanding of antiviral mechanisms requires identification of specific blocks to viral replication and the host factors responsible for such effects. A well-characterized antiviral mechanism that could account for IFN-mediated translation inhibition is PKR-dependent phosphorylation, and thus inhibition, of cellular eIF-2␣. We have previously reported that MNV-1 virion production occurs similarly in 129SvEv and PKR⫺/⫺ BMM␾s, whereas significantly more virions are produced in IFN␣␤R⫺/⫺ and STAT1⫺/⫺ BMM␾s (54), suggesting that PKR is not required for the type I IFN-induced block to virion production. Consistent with this, we report here that the type I IFN-mediated block to the translation of MNV-1 proteins can occur in the absence of PKR. Tesfay et al. recently reported a type I IFN-induced PKR-independent pathway that operates in murine embryonic fibroblasts to inhibit the trans- lation of cap-dependent, but not internal ribosome entry site (IRES)-dependent, viral messages (52). This pathway appears to target translation initiation at a step later than small ribosome association with the mRNA but prior to the formation of the 80S ribosome, thus discriminating between 5⬘ cap-dependent and IRES-dependent messages without directly targeting association of cap-binding proteins. Ongoing studies aim to determine whether this pathway is the same pathway involved in inhibiting the translation of MNV-1 proteins. Norovirus genomes do not contain typical 7-methylguanosine cap structures at their 5⬘ ends; instead, the viral protein VPg is covalently linked to this site (1, 19, 33, 46). Moreover, the genomes contain very short 5⬘-untranslated regions that presumably exclude the presence of an IRES. Thus, translation is not initiated through typical 5⬘ cap-dependent or IRESdependent mechanisms. Instead, work from several groups supports the idea that VPg acts as a cap substitute, recruiting host translation machinery to the 5⬘ end of viral genomes (7, 9, 10, 17). Human norovirus VPg and MNV-1 VPg have both been shown to interact either directly or indirectly with cellular eIF-4E, eIF-4GI, and eIF-3 (7, 9, 10). One intriguing possibility that we plan to address in the future is that the responsible IFN-induced effector(s) prevents VPg association with host translation initiation factors. A direct comparison of the pathway defined by Tesfay et al. and the one responsible for inhibiting MNV-1 translation may shed light not only on IFN-induced antiviral host strategies but also on norovirus translation initiation mechanisms. Interestingly, the block to MNV-1 translation mediated by type II IFN signaling is dependent on PKR so, presumably, type II IFN does not activate this PKRindependent antiviral pathway of viral translation inhibition. Downloaded from http://jvi.asm.org/ on November 8, 2019 by guest FIG. 5. Type I, but not type II, IFN inhibits a late step in the MNV-1 replication cycle. WT (A) or TD (B) BMDCs were either left untreated, pretreated with 1,000 U of rIFN-␤/ml, or pretreated with 1,000 U of rIFN-␥/ml for 18 to 20 h. Cells were infected with MNV-1.CW1 at an MOI of 1 for 1 h on ice. Supernatants were collected at 18, 24, 48, and 72 hpi, and virus titers were determined by plaque assay. Duplicate wells per condition were tested in two independent experiments, and the data were averaged. The limit of detection is 10 PFU/ml. Virus titers from earlier time points (0, 6, 9, and 12 hpi) are included from Fig. 4 for clarity. (C) The same data presented in panels A and B are replicated to highlight the differences observed in WT and TD cells.

(9) VOL. 83, 2009 IFN-MEDIATED INHIBITION OF MNV REPLICATION ACKNOWLEDGMENTS This study was supported by Center for Molecular and Tumor Virology grant P20-RR018724 from the National Center for Research Resources (NCRR), a component of the National Institutes of Health (NIH). This study was also supported by the Louisiana Board of Regents through the Board of Regents Support Fund [grant LEQSF(2008-11)-RD-A-16]. The findings presented here are solely the responsibility of the authors and do not necessarily represent the official view of the NCRR or the NIH. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. REFERENCES 1. Burroughs, J. N., and F. Brown. 1978. Presence of a covalently linked protein on calicivirus RNA. J. Gen. Virol. 41:443–446. 2. Centers for Disease Control and Prevention. 2005. Infectious disease and dermatologic conditions in evacuees and rescue workers after Hurricane 26. Katrina–multiple states, August-September, 2005. MMWR Morb. Mortal. Wkly. Rep. 54:961–964. Centers for Disease Control and Prevention. 2005. Norovirus outbreak among evacuees from hurricane Katrina–Houston, Texas, September 2005. MMWR Morb. Mortal. Wkly. Rep. 54:1016–1018. Centers for Disease Control and Prevention. 2002. Outbreak of acute gastroenteritis associated with Norwalk-like viruses among British military personnel-Afghanistan, May 2002. MMWR Morb. Mortal. Wkly. Rep. 51:477– 479. Chang, K. O., and D. W. George. 2007. Interferons and ribavirin effectively inhibit Norwalk virus replication in replicon-bearing cells. J. Virol. 81:12111– 12118. Chang, K. O., S. V. Sosnovtsev, G. Belliot, A. D. King, and K. Y. Green. 2006. Stable expression of a Norwalk virus RNA replicon in a human hepatoma cell line. Virology 353:463–473. Chaudhry, Y., A. Nayak, M. E. Bordeleau, J. Tanaka, J. Pelletier, G. J. Belsham, L. O. Roberts, and I. G. Goodfellow. 2006. Caliciviruses differ in their functional requirements for eIF4F components. J. Biol. Chem. 281: 25315–25325. Chin, K. C., and P. Cresswell. 2001. Viperin (cig5), an IFN-inducible antiviral protein directly induced by human cytomegalovirus. Proc. Natl. Acad. Sci. USA 98:15125–15130. Daughenbaugh, K. F., C. S. Fraser, J. W. Hershey, and M. E. Hardy. 2003. The genome-linked protein VPg of the Norwalk virus binds eIF3, suggesting its role in translation initiation complex recruitment. EMBO J. 22:2852– 2859. Daughenbaugh, K. F., C. E. Wobus, and M. E. Hardy. 2006. VPg of murine norovirus binds translation initiation factors in infected cells. Virol. J. 3:33. Duizer, E., K. J. Schwab, F. H. Neill, R. L. Atmar, M. P. Koopmans, and M. K. Estes. 2004. Laboratory efforts to cultivate noroviruses. J. Gen. Virol. 85:79–87. Durbin, J. E., R. Hackenmiller, M. C. Simon, and D. E. Levy. 1996. Targeted disruption of the mouse Stat1 gene results in compromised innate immunity to viral disease. Cell 84:443–450. Frucht, D. M., T. Fukao, C. Bogdan, H. Schindler, J. J. O’Shea, and S. Koyasu. 2001. IFN-gamma production by antigen-presenting cells: mechanisms emerge. Trends Immunol. 22:556–560. Gallimore, C. I., D. Lewis, C. Taylor, A. Cant, A. Gennery, and J. J. Gray. 2004. Chronic excretion of a norovirus in a child with cartilage hair hypoplasia (CHH). J. Clin. Virol. 30:196–204. Ghosh, S. K., J. Kusari, S. K. Bandyopadhyay, H. Samanta, R. Kumar, and G. C. Sen. 1991. Cloning, sequencing, and expression of two murine 2⬘-5⬘oligoadenylate synthetases. Structure-function relationships. J. Biol. Chem. 266:15293–15299. Goodbourn, S., L. Didcock, and R. E. Randall. 2000. Interferons: cell signaling, immune modulation, antiviral response and virus countermeasures. J. Gen. Virol. 81:2341–2364. Goodfellow, I., Y. Chaudhry, I. Gioldasi, A. Gerondopoulos, A. Natoni, L. Labrie, J. F. Laliberte, and L. Roberts. 2005. Calicivirus translation initiation requires an interaction between VPg and eIF4E. EMBO Rep. 6:968–972. Green, K. Y. 2007. Caliciviridae: the noroviruses, p. 949–979. In D. M. Knipe, P. M. Howley, D. E. Griffin, R. A. Lamb, M. A. Martin, B. Roizman, and S. E. Straus (ed.), Fields virology, 5th ed. Lippincott-Raven Publishers, Philadelphia, PA. Herbert, T. P., I. Brierley, and T. D. Brown. 1997. Identification of a protein linked to the genomic and subgenomic mRNAs of feline calicivirus and its role in translation. J. Gen. Virol. 78(Pt. 5):1033–1040. Hsu, C. C., C. E. Wobus, E. K. Steffen, L. K. Riley, and R. S. Livingston. 2005. Development of a microsphere-based serologic multiplexed fluorescent immunoassay and a reverse transcriptase PCR assay to detect murine norovirus 1 infection in mice. Clin. Diagn. Lab. Immunol. 12:1145–1151. Huang, S., W. Hendriks, A. Althage, S. Hemmi, H. Bluethmann, R. Kamijo, J. Vilcek, R. M. Zinkernagel, and M. Aguet. 1993. Immune response in mice that lack the interferon-gamma receptor. Science 259:1742–1745. Hwang, S. Y., P. J. Hertzog, K. A. Holland, S. H. Sumarsono, M. J. Tymms, J. A. Hamilton, G. Whitty, I. Bertoncello, and I. Kola. 1995. A null mutation in the gene encoding a type I interferon receptor component eliminates antiproliferative and antiviral responses to interferons alpha and beta and alters macrophage responses. Proc. Natl. Acad. Sci. USA 92:11284–11288. Ito, S., S. Takeshita, A. Nezu, Y. Aihara, S. Usuku, Y. Noguchi, and S. Yokota. 2006. Norovirus-associated encephalopathy. Pediatr. Infect. Dis. J. 25:651–652. Johnson, P. C., J. J. Mathewson, H. L. DuPont, and H. B. Greenberg. 1990. Multiple-challenge study of host susceptibility to Norwalk gastroenteritis in US adults. J. Infect. Dis. 161:18–21. Karst, S. M., C. E. Wobus, M. Lay, J. Davidson, and H. W. Virgin. 2003. STAT1-dependent innate immunity to a Norwalk-like virus. Science 299: 1575–1578. Lenschow, D. J., N. V. Giannakopoulos, L. J. Gunn, C. Johnston, A. K. O’Guin, R. E. Schmidt, B. Levine, and H. W. Virgin. 2005. Identification of interferon-stimulated gene 15 as an antiviral molecule during Sindbis virus infection in vivo. J. Virol. 79:13974–13983. Downloaded from http://jvi.asm.org/ on November 8, 2019 by guest This disparity should facilitate future comparative studies designed to identify ISGs involved in this pathway. It is formally possible that RNase L, and not PKR, is required for the block mediated by type II IFN since our studies utilized TD cells that lack both of these well-characterized ISGs (these cells are also genetically deficient in the Mx1 gene but this protein is nonfunctional in most inbred mouse strains, including the 129SvEv strain). However, based on the known action of RNase L to cleave viral RNAs (41) and our data that MNV-1 genomes are not destabilized in rIFN-␥-pretreated cells (see Fig. 3D and E), this possibility seems unlikely. Another difference between type I IFN- and type II IFNmediated inhibition of MNV-1 replication was elucidated in our studies, namely, that type I IFN remains inhibitory to MNV-1 replication late in the viral replication cycle, while type II IFN does not. The most likely explanation for these observations is that the block to early translation mediated by either type I or type II IFN is not complete and that even reduced levels of nonstructural proteins are sufficient to initiate viral RNA replication and subsequent progeny virion production. However, in the case of type I IFN, a downstream block prevents one or multiple late steps in the viral replication cycle. The virus growth curves presented in Fig. 5 implicate PKR or RNase L as a key player in this late replication block because it is not observed in TD cells. Moreover, the ISGs involved in this inhibition do not appear to be induced by type II IFN. Future studies aim to dissect this late block to MNV-1 replication. Again, we will rely on comparative studies of type I IFN- versus type II IFN-induced ISG expression to facilitate this investigation. In conclusion, the translation or stability of MNV-1 nonstructural proteins is inhibited by both type I and type II IFN in permissive M␾s and DCs. This translation block occurs independent of PKR in type I IFN-pretreated cells but requires PKR in type II IFN-pretreated cells. Future studies aim to identify the host factor(s) responsible for the PKR-independent inhibition stimulated by type I IFN and to ultimately understand the mechanism by which this factor(s) blocks the translation of viral proteins. Inhibition of VPg-mediated translation initiation represents a particularly attractive means to target antiviral therapies because this process is virus specific. Thus, understanding at the molecular level how IFN inhibits this process will provide fundamentally important information regarding norovirus replication strategies and host antiviral mechanisms. 5691

(10) 5692 CHANGOTRA ET AL. 43. 44. 45. 46. 47. 48. 49. 50. 51. 52. 53. 54. 55. 56. 57. 58. 59. Chiba. 2001. Clinical severity of Norwalk virus and Sapporo virus gastroenteritis in children in Hokkaido, Japan. Pediatr. Infect. Dis. J. 20:849–853. Salzberg, S., D. H. Wreschner, F. Oberman, A. Panet, and M. Bakhanashvili. 1983. Isolation and characterization of an interferon-resistant cell line deficient in the induction of (2⬘-5⬘)oligoadenylate synthetase activity. Mol. Cell. Biol. 3:1759–1765. Samuel, C. E. 2001. Antiviral actions of interferons. Clin. Microbiol. Rev. 14:778–809. Sanz, M. A., A. Castello, and L. Carrasco. 2007. Viral translation is coupled to transcription in Sindbis virus-infected cells. J. Virol. 81:7061–7068. Schaffer, F. L., D. W. Ehresmann, M. K. Fretz, and M. I. Soergel. 1980. A protein, VPg, covalently linked to 36S calicivirus RNA. J. Gen. Virol. 47: 215–220. Sharp, T. W., K. C. Hyams, D. Watts, A. F. Trofa, G. J. Martin, A. Z. Kapikian, K. Y. Green, X. Jiang, M. K. Estes, and M. Waack. 1995. Epidemiology of Norwalk virus during an outbreak of acute gastroenteritis aboard a US aircraft carrier. J. Med. Virol. 45:61–67. Sosnovtsev, S. V., G. Belliot, K. O. Chang, V. G. Prikhodko, L. B. Thackray, C. E. Wobus, S. M. Karst, H. W. Virgin, and K. Y. Green. 2006. Cleavage map and proteolytic processing of the murine norovirus nonstructural polyprotein in infected cells. J. Virol. 80:7816–7831. Storey, M. Norovirus outbreak kills three in Vancouver (WA) retirement center. Report 4-8-2006. Associated Press, New York, NY. Suzue, K., T. Asai, T. Takeuchi, and S. Koyasu. 2003. In vivo role of IFNgamma produced by antigen-presenting cells in early host defense against intracellular pathogens. Eur. J. Immunol. 33:2666–2675. Taylor, D. R., M. Puig, M. E. Darnell, K. Mihalik, and S. M. Feinstone. 2005. New antiviral pathway that mediates hepatitis C virus replicon interferon sensitivity through ADAR1. J. Virol. 79:6291–6298. Tesfay, M. Z., J. Yin, C. L. Gardner, M. V. Khoretonenko, N. L. Korneeva, R. E. Rhoads, K. D. Ryman, and W. B. Klimstra. 2008. Alpha/beta interferon inhibits cap-dependent translation of viral but not cellular mRNA by a PKR-independent mechanism. J. Virol. 82:2620–2630. Widdowson, M. A., E. H. Cramer, L. Hadley, J. S. Bresee, R. S. Beard, S. N. Bulens, M. Charles, W. Chege, E. Isakbaeva, J. G. Wright, E. Mintz, D. Forney, J. Massey, R. I. Glass, and S. S. Monroe. 2004. Outbreaks of acute gastroenteritis on cruise ships and on land: identification of a predominant circulating strain of norovirus–United States, 2002. J. Infect. Dis. 190:27–36. Wobus, C. E., S. M. Karst, L. B. Thackray, K. O. Chang, S. V. Sosnovtsev, G. Belliot, A. Krug, J. M. Mackenzie, K. Y. Green, and H. W. Virgin. 2004. Replication of Norovirus in cell culture reveals a tropism for dendritic cells and macrophages. PLoS Biol. 2:e432. Xiang, Y., R. C. Condit, S. Vijaysri, B. Jacobs, B. R. Williams, and R. H. Silverman. 2002. Blockade of interferon induction and action by the E3L double-stranded RNA binding proteins of vaccinia virus. J. Virol. 76:5251– 5259. Zhang, Y., C. W. Burke, K. D. Ryman, and W. B. Klimstra. 2007. Identification and characterization of interferon-induced proteins that inhibit alphavirus replication. J. Virol. 81:11246–11255. Zhou, A., B. A. Hassel, and R. H. Silverman. 1993. Expression cloning of 2-5A-dependent RNase: a uniquely regulated mediator of interferon action. Cell 72:753–765. Zhou, A., J. M. Paranjape, S. D. Der, B. R. Williams, and R. H. Silverman. 1999. Interferon action in triply deficient mice reveals the existence of alternative antiviral pathways. Virology 258:435–440. Zintz, C., K. Bok, E. Parada, M. Barnes-Eley, T. Berke, M. A. Staat, P. Azimi, X. Jiang, and D. O. Matson. 2005. Prevalence and genetic characterization of caliciviruses among children hospitalized for acute gastroenteritis in the United States. Infect. Genet. Evol. 5:281–290. Downloaded from http://jvi.asm.org/ on November 8, 2019 by guest 27. Lenschow, D. J., C. Lai, N. Frias-Staheli, N. V. Giannakopoulos, A. Lutz, T. Wolff, A. Osiak, B. Levine, R. E. Schmidt, A. Garcia-Sastre, D. A. Leib, A. Pekosz, K. P. Knobeloch, I. Horak, and H. W. Virgin. 2007. IFN-stimulated gene 15 functions as a critical antiviral molecule against influenza, herpes, and Sindbis viruses. Proc. Natl. Acad. Sci. USA 104:1371–1376. 28. Levy, D. E., and A. Garcia-Sastre. 2001. The virus battles: IFN induction of the antiviral state and mechanisms of viral evasion. Cytokine Growth Factor Rev. 12:143–156. 29. Lopman, B., H. Vennema, E. Kohli, P. Pothier, A. Sanchez, A. Negredo, J. Buesa, E. Schreier, M. Reacher, D. Brown, J. Gray, M. Iturriza, C. Gallimore, B. Bottiger, K. O. Hedlund, M. Torven, C. H. von Bonsdorff, L. Maunula, M. Poljsak-Prijatelj, J. Zimsek, G. Reuter, G. Szucs, B. Melegh, L. Svennson, Y. van Duijnhoven, and M. Koopmans. 2004. Increase in viral gastroenteritis outbreaks in Europe and epidemic spread of new norovirus variant. Lancet 363:682–688. 30. McCarthy, M., M. K. Estes, and K. C. Hyams. 2000. Norwalk-like virus infection in military forces: epidemic potential, sporadic disease, and the future direction of prevention and control efforts. J. Infect. Dis. 181(Suppl. 2):S387–S391. 31. Meraz, M. A., J. M. White, K. C. Sheehan, E. A. Bach, S. J. Rodig, A. S. Dighe, D. H. Kaplan, J. K. Riley, A. C. Greenlund, D. Campbell, K. CarverMoore, R. N. DuBois, R. Clark, M. Aguet, and R. D. Schreiber. 1996. Targeted disruption of the Stat1 gene in mice reveals unexpected physiologic specificity in the JAK-STAT signaling pathway. Cell 84:431–442. 32. Meurs, E., K. Chong, J. Galabru, N. S. Thomas, I. M. Kerr, B. R. Williams, and A. G. Hovanessian. 1990. Molecular cloning and characterization of the human double-stranded RNA-activated protein kinase induced by interferon. Cell 62:379–390. 33. Meyers, G., C. Wirblich, and H. J. Thiel. 1991. Genomic and subgenomic RNAs of rabbit hemorrhagic disease virus are both protein-linked and packaged into particles. Virology 184:677–686. 34. Morotti, R. A., S. S. Kaufman, T. M. Fishbein, N. K. Chatterjee, M. E. Fuschino, D. L. Morse, and M. S. Magid. 2004. Calicivirus infection in pediatric small intestine transplant recipients: pathological considerations. Hum. Pathol. 35:1236–1240. 35. Muller, U., U. Steinhoff, L. F. Reis, S. Hemmi, J. Pavlovic, R. M. Zinkernagel, and M. Aguet. 1994. Functional role of type I and type II interferons in antiviral defense. Science 264:1918–1921. 36. Mumphrey, S. M., H. Changotra, T. N. Moore, E. R. Heimann-Nichols, C. E. Wobus, M. J. Reilly, M. Moghadamfalahi, D. Shukla, and S. M. Karst. 2007. Murine norovirus 1 infection is associated with histopathological changes in immunocompetent hosts but clinical disease is prevented by STAT1-dependent interferon responses. J. Virol. 81:3251–3263. 37. Nilsson, M., K. O. Hedlund, M. Thorhagen, G. Larson, K. Johansen, A. Ekspong, and L. Svensson. 2003. Evolution of human calicivirus RNA in vivo: accumulation of mutations in the protruding P2 domain of the capsid leads to structural changes and possibly a new phenotype. J. Virol. 77:13117– 13124. 38. Parrino, T. A., D. S. Schreiber, J. S. Trier, A. Z. Kapikian, and N. R. Blacklow. 1977. Clinical immunity in acute gastroenteritis caused by Norwalk agent. N. Engl. J. Med. 297:86–89. 39. Pestka, S., C. D. Krause, and M. R. Walter. 2004. Interferons, interferon-like cytokines, and their receptors. Immunol. Rev. 202:8–32. 40. Ryman, K. D., L. J. White, R. E. Johnston, and W. B. Klimstra. 2002. Effects of PKR/RNase L-dependent and alternative antiviral pathways on alphavirus replication and pathogenesis. Viral Immunol. 15:53–76. 41. Sadler, A. J., and B. R. Williams. 2008. Interferon-inducible antiviral effectors. Nat. Rev. Immunol. 8:559–568. 42. Sakai, Y., S. Nakata, S. Honma, M. Tatsumi, K. Numata-Kinoshita, and S. J. VIROL.

(11)

New documents

Here, we investigated the effect of BHB on reactive oxygen species ROS and malondialdehyde MDA production and the mitogen-activated protein kinase MAPK signal pathway, all mediators

Combining rule-based morphological seg- mentation Omorfi to data-driven morpho- logical segmentation Morfessor... Rescoring n-best lists with TheanoLM Enarvi and Kurimo,

Interictal 18F-FDG-PET localizing epileptogenic foci was sig- nificantly higher in a single lobe than in multiple lobes of the brain Pearson Chi-square test, P=0.004.. Similarly,

2.7 Data For training translation model, language models, and NMT reranker, we used only the provided constrained data SETIMES 2 parallel Turkish- English corpus, and monolingual

Novel research di- rections we investigated include: neural probabilistic language models, bilingual neural network language models, morpho- logical segmentation, and the attention-

Therefore, the present study was design- ed to determine which established cardiovas- cular risk factors are correlated with baPWV and RHI, and to investigate the association of hs-CRP

Our primary submission investigates the use of additional features from Quality Estimation QE to better discriminate translation hypothesis within an n-best list produced by a

TEPP-46 treatment maintains normal levels of basal glycolysis but inhibits glycolytic capacity in IL-2/12 activated NK cells 170.. 18 hour TEPP-46 treatment dramatically inhibits NK

Original Article Drug-drug interaction potential of 1,5-dicaffeylquinic acid, a new herbal drug for the treatment of hepatitis B and human immunodeficiency virus infection, based on the

ParFDA obtains results close to the top constrained phrase-based SMT with an average of 2.52 BLEU points difference using significantly less computation for building SMT systems than