Properties of simian virus 40 small t antigen overproduced in bacteria.

(1)

Vol. 37, No. 2 JOURNAL OFVIROLOGY, Feb.1981,p.683-697

0022-538X/81/020683-15$02.00/0

Properties of Simian Virus

40 Small

t

Antigen

Overproduced

in

Bacteria

CARL S.THUMMEL,TERESAL. BURGESS, ANDROBERTTJIAN*

DepartmentofBiochemistry, University ofCalifornia, Berkeley, California 94720

We constructedaseries ofbacterialplasmidswhich containedtheEscherichia coli lac promoterfusedto a simian virus 40 restriction fragmentcoding forsmall t antigen. These plasmids expressed different levels of intactviral protein de-pendingonthelength of the constructed ribosome bindingsite.Smallt antigen synthesized by themostefficientproducer, HP1,constituted 0.5 to1% of the total cellularprotein. On the basis of extensive characterizationby immunoprecipita-tion, gel electrophoresis, isoelectric focusing, tryptic fingerprint analysis, and chromatographic properties, this plasmid-encoded proteinwasvirtuallyidentical to authentic

simian

virus 40 small t antigen. Partial

purification

of the

HP1-encoded and authenticsmalltantigensrevealedthe presence ofboth monomeric andmultimeric forms.

Twoproteinsareexpressedby simian virus40 (SV40) early after infection of either permissive monkey cellsornonpermissive rodentcells.One of these polypeptides, largetumor (T) antigen, is a 90,000- to 100,000-dalton nuclear protein encoded

by

the viral A gene

(56).

The SV40 largeT

antigen

has been

extensively

character-ized and showntobe involved in the initiation of viralDNA

replication

(52),

regulation

of viral

transcription (10,

39), and induction of

neoplas-tic transformation (49, 53). In contrast, small tumor (t) antigen, a 15,000- to 20,000-dalton

cytoplasmic protein

encoded

by

the SV40 F

gene,was

only recently

detectedand

plays

anas

yetundefined roleinthe viral life

cycle

(11, 37, 45).

Si

mapping (2) andsequence

analysis

(38) of

theSV40

early

mRNA's revealedtwotranscripts

which could be

distinguished

by

the size and location of their

intervening

sequences.

Al-though

thesemRNA's share their initial81

co-dons,

the

coding

sequencefor the

carboxy

ter-minus ofsmallt

antigen

is

spliced

outfromthe

primary transcript

for

large

T

antigen (38).

In

agreement with these

observations,

bothtumor

antigens sharesometryptic

peptides (28, 46)

as

well

as their N-terminal amino acid sequence (36).

Furthermore,

deletionmutants

lacking

se-quences between 0.54 and 0.59 map unitsonthe conventional SV40

genomic

map

produce

a

trun-catedsmallt

polypeptide,

but retain the

ability

tosynthesizeawild-type

large

T

antigen (11,

15, 45).

These F gene deletion mutants have been used to study the role of small t

antigen

in productive and

nonproductive

infections,

but the results were variable

and,

in certain cases,

difficulttointerpret. Someof the F gene deletion mutants appear to be

partially

defective for lytic growth on monkeycells(57). In addition,small tantigenseems toberequired for the induction ofafully transformed phenotype (5, 15, 45, 48). This function may,however, be dispensable in actively growing cells(30, 43).Finally,thesmall tproteinmayprovide some

functions

which are required forfullviral oncogenicity, since F gene mutantvirusesinjected into neonatal hamsters inducetumorswhich grow more slowly and have alonger latency than those inducedby wild-type SV40 (27; W. Topp, personal communication). On the basis of these observations, it is likely thatsmalltantigenplayssome role, albeit un-defined, in the viralinductionof both transfor-mationandoncogenicity.

In support of the idea thatthe

small

t

poly-peptide

mayberesponsible for certain

morpho-logical changes associatedwiththe transforned phenotype, itwas shown thatmicroinjection of SV40 DNAcoding for smalltantigen (0.735to 0.375mapunits) induced dissolutionofthe cy-toplasmic actin cable networkin ratfibroblasts (19).Injectionof DNAfromanFgenedeletion mutant, however, had no effect on the cyto-skeletal structure. Although these results sug-gestthat SV40 smallt

antigen

is

responsible

for cytoskeletal changes,nofirmconclusions can be made until similar experiments are

performed

withpurifiedsmalltprotein.

Ourunderstandingof the

biological

function of SV40 small t antigen has been impeded by thedifficultiesinvolved in

purifying

theprotein from conventional sources. To overcome this problem, we chose to construct arecombinant plasmid which would produce this eucaryotic

683

on November 10, 2019 by guest

http://jvi.asm.org/

(2)

protein in bacterial cells.Three features ofSV40 smalltantigen facilitate its synthesis in Esche-richia coli. First,unlike mosteucaryotic genes, the smallt structuralgeneis notinterruptedby intervening sequences (2, 38).Second,theentire coding sequenceispresenton aHindIII

restric-tion fragment which conveniently containsthe smalltinitiation codon 12 basepairs (bp) from

one of the ends. Finally, the only known post-translational modification of theproteinis

ace-tylation of the N-terminalmethionine(36). Con-struction ofaplasmidable topromote transcrip-tion and translation of the SV40 small t gene should therefore allowsynthesisin bacterialcells of a protein which isvirtually identical to

au-thentic smalltantigen.

Several bacterialplasmidshavebeendesigned todirect efficientexpressionofeucaryoticgenes as fusion proteins (16, 29, 32). Backman and

Ptashne (1) havedeveloped a plasmid

contain-ing the lac regulatory sequences which allows

theproduction of intactgene products by

con-structingahybridribosome

binding

site

consist-ing of the Shine and Dalgarno sequence from

,8-galactosidase

(44)

fusedtoa

foreign

initiation

codon. This system has been used to produce phage lambda repressorand croproteintolevels

ashigh as 2.5% of thetotal bacterialprotein(1, 42) and also tooverproducehuman

growth

hor-mone (18). Roberts and his co-workers have

used this system to achieve

synthesis

ofSV40 small t antigeninbacteria

(41).

However,

they detected only alow level of

expression

of this eucaryoticgeneproduct.In thispaper,wereport thequantitation,

isolation,

and characterization ofSV40smalltantigen

overproduced

by

E. coli carryingarecombinantplasmid.

MATERIALS AND METHODS

Celisand viruses.E.coli strain294 (endoI, rk-, Mk+,B1-)was agiftfrom H. Echols.E.coli294with

the lac il genewasconstructedby conjugation with a

strain ofE.coli whichcarries this geneonanFfactor,

agenerousgift from F. Heffron. Bacteria with drug

resistance were grown in the presence of 30 ,ug of

ampicillin (Sigma Chemical Co.) per mlor20ugof

kanamycin(Sigma)perml.

Plaque-purifiedSV40strain776waspropagatedon

CV-1 cellsasdescribedpreviously (55). CV-1 monkey

celisweremaintained onplastic dishes with

Dulbecco-modified Eagle mediumsupplemented with an

anti-biotic-antimycoticmixture (GIBCO Laboratories)and 5% fetalcalfserum(GIBCO).

Purification ofplasmid DNA. PlasmidDNAwas

purified byamodificationofthetechnique described

by Katzetal.(25). Bacteriaweregrowntoanoptical

densityat 550nmof0.5 inM9medium (33)

supple-mented withCasamino Acids, vitamin B1,and0.05%

glucose and were treated overnight with 20,ug of

chloramphenicol (Sigma) perml toamplifythe

plas-midDNA.The cellsweresuspendedinlysis buffer (50

mMTris[pH 8.0],25% sucrose,1mMEDTA)

supple-mentedwith4mg ofsolidlysozyme per ml. After 20

minat0°C, EDTAwasaddedto0.15 Mfinal

concen-tration, and solid pronase (Calbiochem)wasaddedto

approximately 1 mg/ml. Incubation of the

sphero-plastswascontinued at0°C for 10min, followedby

the addition of 0.1 volume of TET buffer(50 mM Tris

[pH8.0], 60 mM EDTA, 0.3% Triton X-100) to lyse

the cells. After 15minat0°C, the lysate was

centri-fugedat20,000 rpm for 30 mintopellet the

chromo-somalDNA. Thelysate supernatant was then phenol

extractedthreetimes, ether extracted three times, and

ethanolprecipitated. The plasmid supercoilswere

pur-ifiedby bandingtoequilibrium in a cesium

chloride-ethidium bromide gradient (8) followed by isoamyl

alcohol extraction and extensive dialysis against TE

buffer(10 mM Tris [pH 7.8], 1 mM EDTA).

This procedure was scaled down for small plasmid

preparations ("minilysates") from 5- to10-ml cultures.

An RNasedigestion(Worthington Biochemical Corp.)

wasincluded at the pronase digestion step. In placeof

the cesium chloride-ethidium bromide gradient, the

DNAwaspurified by exclusion from a 2-ml Sepharose

CL-2B column equilibrated in TE with 0.1 M NaCl.

This DNA wasconcentrated by ethanol precipitation

and used for restriction enzymeanalysis.

Construction ofplasmids. Restriction enzymes

werepurchased from Bethesda ResearchLaboratories

(BRL) orNewEngland Biolabs. All digestions were

performed in the buffers recommended by BRL at

37°C for0.5to 10 h. Ligations wereperformed with

T4 DNA ligase (BRL) for12 hat20°C in ligasebuffer

(66 mM Tris [pH 7.6], 10mM MgCl2, 1mM

spermi-dine, 15 mM dithiothreitol [DTT],200

jg

ofbovine

serum albumin [BSA, Miles-Pentex] per ml, 1 mM

ATP).Horizontal gel electrophoresis was performed

byusing0.7 to 1.4%agarose (Sigma type II) in TBE

buffer(45 mMTris base, 45 mM boric acid, 1.25 mM

EDTA) or Loen buffer (36 mM Tris base, 30 mM

NaH2PO4,1mMEDTA). The DNA wasvisualized by

staining with ethidium bromide and UV transillumi-nation.

Plasmid pGL101 DNA was linearized by digestion

withPvuII; theenzyme was inactivated by heating at

65°C for 5 min, and the digest was stored at -200C.

SV40DNA, prepared as described previously (23), was

digestedwith HindIII and HpaII, andfractionated by

1% agarose gel electrophoresis in TBE buffer. The

1,169-bp B fragment was excised from the gel, and the

DNA waseluted byelectrophoresis into TBE buffer

andpurifiedandconcentrated byDE52-cellulose

chro-matography and ethanol precipitation. The DNA was

resuspended inTEbuffer and stored at 5°C for

sub-sequentinsertion intopGL101.

(i)pSV250.Gel-purified SV40 HindIII B fragment

wastreated with large fragment DNApolymerase I

(BRL) at370C inthepresence of 10 ,uCi of

[a-32P]-dTTP(Amersham), all four dNTP, and nick

transla-tion buffer (50mM Tris[pH7.8], 10mM MgCl2, 1 mM

DTT, 100,tgofBSA per ml). The reaction kinetics

werefollowed by trichloroacetic acid precipitation. By

30minDNAsynthesis had almostplateaued, and the

reaction wasstopped at 60 min by phenol extraction,

three ether extractions, and ethanol precipitation. A

10-foldmolarexcess of thisblunt-endedSV40 DNA

on November 10, 2019 by guest

http://jvi.asm.org/

(3)

OVERPRODUCTION OF SV40 SMALL t ANTIGEN 685

wasligated with T4 DNA ligase to 0.2 ug of

Pvull-digestedpGL101 DNA ina

15-pl

reaction volume. The

ligation products were then digested with an excess of

PvuII tolinearize recircularized pGL101 DNA, and

this mixwas usedto transform E. coli 294cells by

standard procedures (9). The bacteria were spread on sterile nitrocellulose filters (Schleicher and Schuell)

on L agar plates containing ampicillin to select for

transformants. Theresultant colonies were transferred

to a fresh nitrocellulose filter, and these duplicate

colonies were grown, treated with chloramphenicol,

lysed, and probed with nick-translated SV40 DNA

(40)asdescribed by D. Hanahan (personal

communi-cation). Clones which contained SV40 sequences were identified by autoradiography and picked, and small

culturesweregrown forpurification of plasmid DNA

as described above. Plasmids containing the SV40

HindIII B fragment inserted into pGL101 in the proper

orientationwereidentified by digestion withHaeIIH,

Southern blotting (47), and hybridization with nick-translated SV40 DNA. One clone containing a plasmid

with theSV40 smalltgenefusedtothe lac promoter

wasselected, and the plasmid was designated pSV250.

(ii)pSV240.SyntheticHindHII linkers

(Collabora-tiveResearch) werelabeled with

[-y-'P]ATP

(Amer-sham) and T4 polynucleotide kinase (New England

Biolabs). Phosphorylation was then completed by the

addition ofanexcessofcold ATP (1 mM final

concen-tration), and the reactionwasterminatedby phenol

extraction, three ether extractions, and ethanol

precip-itation. A 30-foldexcessof thesephosphorylated

link-erswasthenligatedtoPvuII-linearized pGL101 DNA

withT4 DNAligase.Proteinwasremovedby phenol

extraction,and thepGL101DNAwasseparated from unincorporated linkers by Sepharose CL-2B

chroma-tography. The excluded fractionswerepooled, ethanol

precipitated, and digested with HindII to remove

excesslinker sequences. Afterphenolextraction, ether

extraction, and ethanolprecipitation, 0.3 yg of this

modifiedpGL101DNAwasligatedtothegel-purified

SV40HindIHBfragment,and E. coli294cellswere

transformed with the recombinant molecules, as

above. Aclone containingplasmid DNA with the SV40

insert in the proper orientation, as determined by

restrictionmappingwithTaqIandSouthern blot

hy-bridization, wasselected, and theplasmidwas

desig-natedpSV240.

(iii)HP1.pSV240DNAwasdigestedpartiallywith

HindIIItoformpredominantlylinear molecules. BAL

31nuclease (BRL) was then titratedtoremoveonly a

fewbp from the ends ofaDNAduplex by digesting

thepSV240partial digests in the presence oftracer

end-labeled DNA for30minat30°Cin BAL31buffer

(12 mMCaCl2,12mMMgCl2,0.6MNaCl,20mMTris

[pH 8.1]). Theamountof BAL31nuclease whichwas

required to remove 95% of the end label, but not

reduce thesize ofthe pSV240DNA as detectedby

agarosegel electrophoresis,wasselected foruse on a

preparative scale. BAL31nucleasetreatmentof the

pSV240partial digestwasterminatedby the addition

of EDTA to 40 mMfinal concentration, and linear

moleculeswerepurified by 0.7% agarose gel

electro-phoresisinLoenbuffer, excision of the linear DNA,

electroelution, andDE52chromatography. These

mol-ecules were recircularized with T4 DNA ligase and

used to transform E. coli 294. AmpiciUlin-resistant

colonies were picked randomly, and the plasmid DNA

wasdigested with HindIII and PstI to identify

plas-mids missing the HindIII site between the lac

pro-moter and SV40DNA.Those clones were thentested

forsmalltantigen expression as described below.

All manipulations were in accordance with the guidelines of the National Institutes of Health and

usedP2-EK1 containment.

Labelingofproteins. Bacterial clonesweregrown

in 5ml of M9 medium supplemented with amino acids

(minusmethionine), thiamine, 0.5% glycerol, and

am-piciUin. Atanoptical densityat 550nmof 0.4,50 to

200jiCi of[3S]methionine (Amersham) was added,

and the culturewasleftat37°C for2minfor

pulse-labelingor 1hfor steady-state labeling. The tube was

then chilled to stop the pulse, and the cells were

immediatelypelleted by centrifugation. The bacteria

weresuspended in 0.5ml of TE, 0.1 M NaCl, 0.1 mM

DTT, and50pg ofphenylmethylsulfonyl fluoride

(Sigma) per ml and sonicated, and the lysate was

centrifugedtopeletthecellulardebris. Inductionwith

isopropyl-,8-D-thiogalactopyranoside was

accom-plished by the addition of this inducer to1 mMfinal

concentrationinthe growth medium one generation

beforeharvesting thecells.

CV-1 monkey celswere infected with 10PFU of

SV40 per cell and leftat37°C untilapproximately 10%

of thecells showedcytopathiceffects. Thecellswere

thenwashed twice withphosphate-bufferedsaline and

incubated with DME medium minus methionine for 1.5 to 2 h at370C.From0.1 to 1mCi of[3S]methionine

wasthenadded, and theplateswere left for2hfor

pulse-labeling or 12h for steady-state labeling. The

cellswerethen washed twice withphosphate-buffered

saline andlysedby the addition of1ml of buffer B(50

mMTris [pH8.0],120mMNaCl,0.5%NonidetP-40),

and thecellulardebriswaspelletedbycentrifugation.

Extractswerestoredat-800C ifnotusedimmediately.

Immunoprecipitationandgelelectrophoresis.

Cellextract wasdiluted into bufferB,andan

appro-priateamountofantibodywasadded,usually5to 10

pl.

After2 to 4hat0°C,a10%suspensionof

Formalin-fixedStaphylococcusaureusCowan I (ATCC 12598)

(26) in buffer Bwasadded,usingtwovolumes of 10%

S. aureuspervolume ofantibody. After1 to 2hat

0°C,theS. aureuscellswerepelleted by

centrifuga-tion, washed three times with bufferB,andsuspended

insamplebuffer (0.5 M Tris[pH6.8],5%

,B-mercap-toethanol,3% sodiumdodecylsulfate[SDS],10%

glyc-erol, 0.05% bromophenol blue).The resuspended S.

aureuscells were boiled for 2 minand pelleted by centrifugation,and thesupernatantsamplebufferwas

loaded onto an SDS-polyacrylamide gelwitha 7 to

18%gradient ofacrylamide (51).

Purification ofradioactive smalltantigen.A

10-ml culture ofHP1cellswaspulsedfor5min with

500pCiof[3S]methionineasdescribed above. This

crude extractwasthen subjectedto

immunoprecipi-tationwith 200plof hamster anti-Timmunoglobulin

G, and theprecipitatedproteinswerefractionatedby

preparative SDS-polyacrylamide gel electrophoresis

as described above. The band of small t antigen,

identified byautoradiography, was excised, andthe

proteinwaselutedbyelectrophoresisdirectlyintoa

VOL. 37,1981

on November 10, 2019 by guest

http://jvi.asm.org/

(4)

dialysis bag containing0.2mg ofBSA. The SDSwas

removed by dialysis againstincreasing concentrations

of urea, upto 8M, followedbydecreasing

concentra-tions ofurea inthepresence of 1% BSA. After final

dialysis against 1% BSA, precipitated material was

pelleted by centrifugation, andthe purified small t

antigen (ca. 107cpm)wasusedfortrypticfingerprint

analysis orradioimmunoassay.

Radioimmunoassay. The sample to be assayed

(upto 20

p1)

wasaddedto100

pl

ofradioimmunoassay

buffer(phosphate-buffered saline,0.1%NonidetP-40,

0.1%BSA)containing0.03to0.05tdofhamster anti-T

antibody. After 20 minat00C, 1,000 cpm (2to10ng)

ofpurified radioactive smalltantigenwasadded,and

the immune complex formation was continued for

another20min.Thecomplexwascollected with2

pl

ofa 10% suspension of S. aureus Cowan I cells by

incubationat00Cfor10min.The cellswerepelleted

bycentrifugation andresuspended in 10

pl

of water,

and radioactivity was quantitated by scintillation

counting. Theamountofantibodyusedin theassay

wasdeterminedby titrationastheamountrequiredto

precipitate50 to70%of the pure radioactive smallt

antigen.

To assayextractfromSV40-infected monkeycells,

large T antigen was first removed by precipitation

with5

p1

of anti-D2serum.Thesupernatant from that

immunoprecipitationwasthensubjectedtothe

stand-ardradioimmunoassaydescribed above.

Column chromatography of small t antigen.

(i) HP1. For preparative purposes, HP1 cells were

growntolatelog phase inarichmedium(0.7%

Casa-minoAcids, 0.7% tryptone[Difco Laboratories],0.7%

yeast extract, 0.7% brain heart infusion, 20 mM

K2HPO4[pH7.2],0.5%glycerol,20,ug ofampicillin per

ml). Thecells were lysed by sonication in10mM Tris

(pH7.8)-imMEDTA-0.2 MNaCl-0.1mMDTT-50 Mgofphenylmethylsulfonyl fluoride per ml, and the

lysatewascentrifugedat100,000xgfor1h.Nucleic

acidswereremoved fromthe S-100by the addition of

fresh 1% protamine sulfate(Sigma)to0.2%final

con-centration andremoval of theprecipitate by

centrifu-gation. The supernatant was then brought to 60%

saturation with ammonium sulfate (Schwarz-Mann),

and the precipitate wascollected by centrifugation,

resuspended in the appropriate buffer, and loaded

ontoagel filtration column. The columns were

equil-ibrated in either20 mMTris(pH 7.8)-i MLiCl-0.1

mM DTTor 20 mM Tris(pH 7.4)-50 mMNaCl-0.1

mMEDTA-0.1mMDTT.For alarge-scale

prepara-tion (15 g ofHP1 cells), 20 ml of the resuspended

ammonium sulfate pellet was loaded onto a Biogel

A1.5mcolumn (80 by 3.5 cm), and 5-ml fractions were

collected,togenerateaprofile similar to that seen in

Fig.7.

(ii) SV40. One hundred 100-cm plates of CV-1

monkeycellswereinfected with 5 PFU ofSV40 per

cell,andthecellswere harvested afterapproximately

3daysat370C.AfterswellinginDounce buffer (0.01

M sodiumphosphate [pH 7.0], 0.01 M NaCl, 4 mM

MgCl2, 0.1mMDTT,50ug ofphenylmethylsulfonyl

fluoride perml), the cells were disrupted by 20 strokes

in atype Bground glass homogenizer and centrifuged

at 5,000 rpm for 5 min to pellet the nuclei. The

supernatantcytoplasmic fraction was brought to 60%

saturation with ammoniumsulfate, and the precipitate

was pelletedbycentrifugation and resuspended in2

ml of20 mM Tris (pH 7.4)-50 mM NaCl-0.1 mM

DTT. This was fractionated onaBiogel A1.5m column

(60 by 1.5cm) equilibrated with thesamebuffer, and

1.2-mlfractionswerecollected. In all cases, the nucleic

acids andprotein were monitored by absorbance at

260 nm and280nm,respectively. The smalltantigen

wasdetected byradioimmunoassay.

RESULTS

Construction ofplasmidsdesignedto ex-press SV40 small t antigen. We have used theplasmidpGL101toachieveexpression of the SV40 small t gene in bacteria. This plasmid consists primarily of pBR322 DNA sequences between the EcoRI site and the PvuII sitewhich contain thegenecoding forampicillin resistance. Spanning theEcoRI-PvuII

junction

is a

95-bp

restrictionfragmentcontaining theE.coli UV-5 lac promoter, operator, and ,B-galactosidase ribosome

binding

site(24).This

fragment

is suf-ficient to promote efficient transcription and translation ofany genewhichhasits initiation codon fusedtotheribosomebinding site in the properorientation.

Digestion ofSV40 DNAwith therestriction enzymeHindIIIgeneratesa1,169-bp

fragment,

designated theB

fragment,

whichcontains the entire small t gene with the initiation codon located 12 bpfrom one ofthe ends. This frag-ment was purified by preparative agarose gel electrophoresis and then insertedintothe PvuII site ofpGL101 by usingtwodifferentprocedures (Fig.1).

The first recombinant plasmid was con-structed by

modifying

the ends of the SV40 HindIIIB

fragment.

E.coli

large fragment

DNA polymerase I was used to synthesize a DNA complementto the single-stranded endsofthe

HindIII

fragment

togenerate blunt ends.

Plas-midpGL101DNA wasthendigested withPvuII, andthe modifiedSV40restrictionfragmentwas inserted with T4 DNA

ligase.

Because hybrid molecules do notcontainanyPvuIIrestriction sites, the ligation products were digested exten-sively withPvuII before transformation to re-duce the background ofrecircularized pGL101 DNA.The circular recombinants were then used

totransform E. coli 294, andtransformantswere selectedby growthinthepresence of

ampicilhin.

Bacterial colonies containing SV40 sequences were identified by a modification of the Grun-stein andHogness (21)screeningprocedure. Sev-eral suchcloneswereselected, and theplasmid DNAs were analyzed by restriction enzyme mapping and Southem blot hybridization to confirm the presence and determine the orienta-tion ofthe inserted SV40HindIIIBfragment.A

on November 10, 2019 by guest

http://jvi.asm.org/

(5)

EcoRI

Pldc

Pvull

AMR I3

CutwithPvufl

Ligate onHindmlinker Cut

t g HindM

SV40HindNB Fragment

Mixond ligote

P/vc

9 ~~~~~Ligate

t_

I

with PvuIl

P/Ic HlndHM

t~~~~~

IPartial cut withHindM

and treated with BAL 31

t

SV40HindmBFragment dNTP+lorge t Ifrogmentpo/I

Mixondligate

FIG. 1. Schematic representation ofplasmid construction designed to express SV40 small t antigen.

Preparation of the DNA and construction of the hybrid plasmids is described in the text.

clonecarrying the smalltgenefusedtothe lac promoter in the proper orientation was selected, and the plasmidwasdesignatedpSV250.

Roberts et al. (42) have demonstrated that overproduction of proteins utilizingtheplasmid lac promoter system can be achieved by ran-domly varying the distance between the bacte-rial ribosome binding site, postulated by Shine andDalgarno (44), and the initiation codon of the inserted gene. A change of asfewas 3 bp canaffect thelevel of expression byasmuchas 20-fold (42). Withthisin mind,we constructed

a

plasmid

whichcontainedarestriction site

be-tweenthe Shine andDalgarnosequenceand the smalltAUG codon. This recombinantallowed directmanipulationof the basesequence within thiscrucialregion.

PvuIIwasusedtolinearizepGL101 DNA,and HindIII linkerswere

ligated

tothe plasmid by using T4 DNA ligase. The SV40

HinduI

B fragment was then inserted into this HindIII site, and the hybrid molecules were used to

transformE. coli294. The transformantswere

screened for colonies containing SV40 se-quences, as before. One clone with the SV40

insert in theproper orientation wasselected,and

the

plasmid

wasdesignated pSV240.

This plasmid has two HindIII sites, one of whichlies betweenthe bacterialShineand

Dal-garno

sequenceand the smalltinitiation codon.

PlasmidpSV240DNA wassubjectedtopartial digestion with HindIIItogenerate apopulation ofmolecules,someof whichwere cutonlyatthe hybrid ribosome

binding

site. These molecules were then treated with nuclease BAL 31 to decreaserandomly the distance betweenthetwo

sequences. Linearmoleculeswerethen

purified

by agarose

gel

electrophoresis, recircularized withT4 DNA

ligase,

and usedtotransformE.

coli 294.

Forty

transformants

containing

the

modified

pSV240

molecules were selected and screenedbyrestrictionenzymemappingof plas-mid DNA for loss of theHindIII sitenear the lac promoter. Fourteen such cloneswere iden-tified and tested by

immunoprecipitation

for theirabilitytoproduce small tantigen. As

ex-pected,avarietyof different levels of

expression

was detected. Three clones, carrying

plasmids

designated HP1, HP2, and HP3,

appeared

to

produce

substantially

moresmallt

protein

than

VOL. 37,1981

on November 10, 2019 by guest

http://jvi.asm.org/

[image:5.485.45.442.69.378.2]

(6)

didpSV240. Sincetheseplasmids exhibited ap-proximately thesame high level ofproduction, HP1 was arbitrarily selected for quantitation andcharacterizationofthe viralprotein.

Synthesis of SV40 small tantigenin bac-teria.We have two antibodies available to de-tect the early gene products of SV40. One of theseantibodieswasisolated fromthe serum of hamsters bearing SV40-induced tumors and is specific for thevirallycodedlargeTand small tantigens (3, 13).The otherantibodywasmade by injecting rabbits with

purified

D2 protein isolated from HeLa cells infected with the ade-novirus-SV40hybridvirusAd2+D2(54).The D2 protein lacks theaminoterminalregionoflarge T antigen which is shared with the small t polypeptide (22). Antibodies directedagainstD2 will therefore react onlywith large T antigen-specific determinants and notcross-react with small tantigen (54). SincetheSV40HindIIIB fragmentcontains one-half of thelargeT struc-tural gene as well as the entire smallt coding sequence,itcouldpotentiallypromotethe syn-thesis oftruncatedlarge T-related proteins. The useof the anti-T and anti-D2seraallowsusto distinguish these proteins from SV40 small t antigen.

TodetectSV40-relatedproteins expressed in bacteriaand comparethem with authentic SV40 smalltantigen,bothSV40-infectedmonkey cells andHP1bacterial cellswerepulse-labeled with [35S]methionine,andtheextractsweresubjected to immunoprecipitation with anti-D2 and anti-T sera. A control preimmune serum was also used toidentify proteinswhich were nonspecif-ically precipitated (Fig. 2A,lanes1 and 2). The immnunecomplexes werecollected on protein

A-bearing

S.aureuscellsandthenfractionated

by

SDS-polyacrylamide

gelelectrophoresis. As

ex-pected, the rabbit anti-D2 serum precipitated only the SV40 largeTantigen from the infected monkey cell extract,whereasthe hamsterserum precipitated both the large T and small t anti-gens (Fig. 2A,lanes3and5).No proteins in the HP1 extract werespecifically precipitatedwith the rabbit anti-D2serum, but the hamster anti-Tantibodyselectively precipitateda 12-kilodal-ton(kd) protein and a 15-kdproteinwhich co-migratedwiththeSV40smallt antigen (Fig. 2A, lanes4 and6). These resultsdemonstrate that theHP1-encoded smalltprotein is the same size and has the same antigenic determinants as authentic SV40 small t antigen.

Furthermore,

with the exception ofthe 12-kd protein, there appear tobenoadditional SV40-relatedproteins synthesizedinHP1.

Sinceour abilityto detect small t antigen is dependent on the use of anti-T antibody, we wereinterestedin

determining

theefficiency of

ourimmunoprecipitations.SDS-polyacrylamide gel electrophoresisofacrude extract prepared from pulse-labeledHP1 cells allowed us to vis-ualizedirectlya15-kd protein whichcomigrated withSV40 smalltantigen (Fig.2C,lane4). After anti-Timmunoprecipitationandgel electropho-resis of the supematant fraction, however, none of this protein could be detected (Fig. 2C, lane 3). Furthermore, the pattem displayed by the supematant was almostidentical to that of an extract prepared from E. coli cells carryinga control nonproducer plasmid (Fig. 2C, lane 5). These results indicate that our immunoprecipi-tation technique is capable of selectively and quantitatively removing small t antigen from a crude cell extract.

Quantitation of small t antigen produced byrecombinantplasmids.PlasmidspSV240, pSV250, andHP1 were constructed toprovide different levels ofexpressionofsmalltantigen. To compare the relative amounts of small t proteinbeingproducedby these clones, bacteria carryingpSV240, pSV250, and HP1 were pulse-labeled with[3S]methionine,and the crude ex-tracts weresubjected to anti-T immunoprecipi-tation with an excess ofantibody, followed by SDS-polyacrylamide gel electrophoresis (Fig. 2B). Plasmid pSV250 was found toproduce two-fold more small tantigenthan didpSV240,and HP1 produced approximately 25-fold more of thisprotein than didpSV240. Asexpected,the relative levels of small texpressionvaried con-siderably with changes in the structure ofthe hybrid ribosomebindingsite.

Havingdemonstrated that HP1 is ahigh pro-ducer of SV40 small tantigen,wewereinterested in quantitating the amount ofsmall t protein present in bacteriacarryingthisplasmid. Since

pulse-labeling

reflects the rate of synthesis

rather than absolute amount, HP1 cells were labeled understeady-state conditions. A crude extract containing 106 cpm of labeled protein wasthensubjectedto

immunoprecipitation

with an excess of anti-Tantibody (Fig. 3A, lane 3). By excising the band of antigen from the gel, 12,000 to 25,000 cpm could be recovered. Since thesmall tpolypeptidecontainsapproximately threefold more methionine residues than does anaverage protein (14), we calculated that small t antigen represents 0.4 to 0.8% of the total labeledproteinin the extract.

Toconfirm thisquantitation,we immunopre-cipitatedsmall tantigenfromacrude extract of HP1cellsanddirectlyvisualizedthe proteins by Coomassie blue staining (Fig. 3B). Approxi-mately 2 to 3 ,tg of small t antigen can be

inmmunoprecipitated

from 300,ug ofprotein. This

is equivalent to 0.6 to 1% of the total cellular protein,or40,000 to80,000moleculesofsmall t

on November 10, 2019 by guest

http://jvi.asm.org/

(7)

OVERPRODUCTION OF SV40 SMALL t ANTIGEN

A

B

;0i;0fXFv-1;

0;,-

0AAt.ira

X -W tE;*

;y 0

;- titSt ff?.^-7. 00

*:0i.i.i

aX v 0;; +

-.SS:T..

00 a.ff SX ffff

00.:i:(Vit:}7.tit-.;d03Si,

tU

0fff W- .-'d il 0 _

ff *-', iV;0 r ;

f<-si.X*''it0<,.?W;.';

t00S0i;0000 f-t t: 0&X.> 0!

S00 00000 |w-WEE-E

o O a

O D :

-:

_-_ I I

O O -|

N

n1)D 'D

Ir

<

(J)VJCJ)

.

<<

.4

O

00

FIG. 2. Characterization ofsmalltantigens byimmunoprecipitation andgelelectrophoresis.SV40-infected

monkey cells and clonespSV240,pSV250,andHPIwerepulse-labeled with[35S]methionine,and the crude extractsweresubjectedtoimmunoprecipitationwith theantibodies described below. Theimmunecomplexes

werecollectedonprotein-A bearingS.aureuscells(26), fractionatedon a7to18%gradient ofpolyacrylamide

containingSDS(51),and visualizedbyautoradiographyasdescribed inthetext.(A) Labeledextractsfrom

SV40-infected monkey ceUs (lanes 1, 3,and5)and HP) cells(lanes 2, 4,and6)weresubjectedto

immunopre-cipitation with control rabbit anti-hamster serum, rabbit anti-D2 serum, and hamster anti-T antibody,

respectively. (B) Samples containing2x 106cpmofextractfrom SV40-infected monkey cells and 1.5x106

cpmofextractsfrom pSV240,pSV250,andHP) cellsweresubjectedtoimmunoprecipitationwithan excessof

anti-Tantibody.(C)Lane1depictsananti-Timmunoprecipitate from SV40-infected monkeycells. Asample

containing4x 105 cpmofextractfromHPI cells wassubjected toanti-Timmunoprecipitation, and the

precipitated proteinsaredepictedinlane2;1 x 105cpmof the supernatant from thisimmunoprecipitation

was runin lane3. Asample containing105cpmofHPI cellextractwasruninlane4,andanequalamount ofradioactiveprotein from apSV240-like clone, carrying aplasmid withthe SV40 insert in the wrong

orientation,was runinlane5.(D)HP) DNAwasused totransformaderivativeofE.coli 294whichcarries the laci'geneandthusoverproduceslacrepressor(34).Anti-Timmunoprecipitationandgelelectrophoresis

wereperformedonceUseither withorwithout induction withisopropyl-,B-D-thiogalactopyranoside.

antigenperHP1bacterial cell.

Wethencompared thelevelofexpression of

HP1 with that ofcelLsproductively infected with

SV40. Infectedmonkeyceliswerelabeled with [3S]methionine under steady-state conditions.

Acrude extract was prepared, and 106 cpm of

labeled protein wastreated with an excess of

anti-T antibody (Fig. 3A, lane 2). By excising theband ofsmalltantigen from the gel,

approx-imately 0.03to0.06% of the totallabeled protein could berecovered.

Sequencedetermination of thehybrid ri-bosome binding sites. The nucleotide

se-quenceof50bpencompassingthehybrid

ribo-somebinding site ofpSV240,pSV250,HP1, HP2,

and HP3 was determined by the Maxam and

Gilbert(31) sequencing method (Fig. 4).As

pre-dicted, pSV240 contained one HindI linker

between thelacpromoterand theSV40insert,

andpSV250wasmiing3bpof the linker. HP3

is a12-bp deletionmutant ofpSV240,whereas

HP1 and HP2 are missing an identical 11-bp sequence.Thedistancefromthe Shine and Dal-garno sequencetothe smallAUG codon is thus

reduced from 20bpin pSV240to 9 bpin HP1

andHP2and 8bp inHP3. This indicates that

C

12

345 D

0L N

120 K-I

IO0K-1

85K-1

iXi

20K~

i. .-4A^

12K-#'

I +

)

c-OG)

VOL. 37,1981

689 on November 10, 2019 by guest

http://jvi.asm.org/

(8)

690 BURGESS, AND

B

Coomassie

stain

() In

< X

a I I

N

FIG. 3. Quantitation ofsmalltantigen produced

byHP). (A) Samples containing106cpmofextract

from SV40-infected monkey cells andHPI cells

la-beled understeady-stateconditionsweretreated with

anti-Tantibody,and theprecipitatesweresubjected

togel electrophoresis. The endlanescontain 6.5 x

104cpmofcrudeextractfromthese cells. The

immu-noprecipitatedsmalltantigens,shown in thecenter

lanes, wereexcised andquantitatedasdescribed in

thetext.(B)An unlabeled crudeextractofHP) cells

containing300A gofproteinwassubjectedto

immu-noprecipitationwith10 1l ofrabbit anti-D2serum or

hamster anti-TIgG. Theprecipitated proteinswere

fractionated byslabgelelectrophoresisanddirectly

visualizedby stainingwithCoomassiebrilliant blue

(Bio-Rad Laboratories). These samples were not

heatedbefore gel electrophoresis.

therearesequences inpSV240 thatreduce the efficiencywith which themRNA canbe bound

by the 30Sribosomal subunitor,possibly,which

attenuatetranscription.

Characterization ofthe small t antigen produced by HP1. Our motive for constructing

a bacterial plasmid which overproduces SV40 small tantigenwas tofacilitate purification of the protein for functional analysis. We were

therefore interestedin characterizingthe HP1-encodedprotein andcomparing it with authentic SV40small t antigen. Having determined that

the size and antigenicity of the HP1-encoded

andauthenticsmalltantigenswereidentical,we

nextused themore sensitivetechnique of

isoe-lectric focusing to characterize the physical properties of thesetwoproteins. Crudeextracts

prepared from both

[3S]methionine-labeled

HP1 cells and E. coli cells carrying a control

nonproducer plasmidweresubjectedto

isoelec-tric focusing in the first dimension and then SDS-polyacrylamide gel electrophoresis in the second dimension (Fig.5A andB). Under these conditionsitwaspossibletoseparatebothsmall

tantigen and the 12-kd protein frommostother bacterial proteins. The HP1-encoded antigen

wasfoundtomigrateintheisoelectricfocusing dimension withanisoelectricpoint of 7.2to7.4, identicaltothereported isoelectric point of

au-thentic SV40 small t protein (Fig. 5C) (12). In addition,amixture ofsmalltantigen isolated by anti-Timmunoprecipitation from both SV40-in-fected monkeycells and HP1 cells comigrated

during two-dimensional gel electrophoresis (Fig. 5D). Therefore, the size and the charge of the HPl-encoded small tantigenwere identicalto

that of the authenticvirally coded protein. Upon isoelectric focusing,weobservedcharge

heterogeneity in small t antigen isolated from both SV40-infectedmonkeycellsand HP1cells.

Inmostcasesthree differentspecieswere

iden-tified, although more forms could be resolved

withalongerexposure.

We performed tryptic fingerprint analysis of the smalltantigen expressed in HP1 and

com-pared itspattemwiththat of theauthentic SV40 small t protein. Small t antigen was purified

from pulse-labeled SV40-infected monkey cells and HP1 cells by anti-T immunoprecipitation

and SDS-polyacrylamide gel electrophoresis. These purified radioactive antigens were then

oxidized with performic acid and subjected to

digestion with tolylsulfonyl phenylalanyl chlo-romethyl ketone-treated trypsin. The peptides

were fractionated by electrophoresis atpH2.1

in one dimension and ascending

chromatogra-phy in the second dimension. Allexceptoneof

thetryptic peptides comigrated in both dimen-sions(Fig. 6). The unique peptide corresponded

totheN-terminal fragment of smalltantigen in thefingerprintpatterndescribed by Linkeetal. (28). The altered mobility of the HP1-encoded

small tpeptide could, therefore, be due to the absence of N-terminalacetylation knownto oc-curineucaryoticcells(36), although other

post-translational modificationsof the HPl-encoded protein cannot be ruled out. As observed by

other investigators (46), some of the peptides seem to be over-represented in the digest of

small tantigen isolated fromonesourcerelative

to the other. However, even tryptic digests of

identicalproteins exhibit such quantitative

dif-A

Steady State

35S-met

on November 10, 2019 by guest

http://jvi.asm.org/

[image:8.485.70.232.71.347.2]

(9)

PLASMIDS smollt

SD HindM linker

pSV240

--AC[AG

G AAACAG TCAGTTTGCAAAG

AGGAT----TGITCClTITGTC

GTTCGAJAACGTTTCTACCTA--3bp

SD 7

pSV250

--ACIAGGAAACAGAGCTTTGCAAAG

GAT----TGI

CTTTGTCTCGAAACGTTTCTACCTA--HPI,HP2

llbp

SD 'lZ7

--AC GGAAACAGCCAG G

GAT--

--TGITCCTITTGTCGGTCTACCTA--LEVELOF EXPRESSION (molecules/cell)

<2,000

3-6,000

40-80,000

12 bp

SD

`

HP3

--ACGGAAAACAGCCA

T GAT-- 40-80,000

--TGj[CCTTTGTCGGTTACCTA--FIG. 4. Nucleotidesequenceof the hybrid ribosome binding sites. Plasmid DNA was digested withHinfI,

end-labeledbyapolynucleotide kinase exchange reaction with[y-32P]ATP(7),and then cleaved withPstI.

The 890-bpfragment containing the hybrid ribosome binding site for small t antigen was purified by gel

electrophoresis and sequencedaccordingtothetechnique of Maxam and Gilbert (31). The ribosome binding

sequence,hypothesizedby Shine and Dalgarno (44), is abbreviated to SD, and the SV40 sequence is drawn in

bold letters. Thedirectionof transcription isfromlefttoright.

ferences, suggesting that this variabilityis inher-entinthe technique.

The structureof the 12-kdprotein synthesized byHP1 wassimilarlyanalyzed by tryptic finger-printing. Three, andpossiblyfour, smallt pep-tides were absent in the 12-kdprotein pattern (Fig. 6, peptides a, b, c, and d). Peptides a, b, and chave all been mapped tothe amino ter-minus ofsmalltantigen(28). The12-kdprotein may therefore be considered to be an amino-terminal deletion of small t antigen. Further analysis willbenecessary toascertainthe exact structureofthis12-kdprotein.

Chromatographic properties

of the

HP1-encoded small t

antigen. Having

achieved a

high level of production ofintact small tantigen, we began working on the purification of this proteinfrom E. colicarrying theHP1 plasmid. Since no biochemical

activity

for the small t

protein hasyet beenidentified,wedependedon anti-T antibodies as a specific probe for the presenceoftheantigen.

Initially,

acomplement fixationassaywasattempted, butsmall tantigen wasfoundtobe inefficientinfixing complement, evenwhenitwaspresent in

large

amounts.We therefore

developed

a sensitive and rapid ra-dioimmunoassay. One unit ofsmall t antigen (approximately 5 to 10 ng) was defined as the amount ofprotein required to give 50% inhibi-tion ofcomplex formation between pure radio-active small tantigenand alimitingamount of anti-Tantibody.

Our initialattemptatthepurificationof HP1-encoded small t antigen involved subjecting a crudepreparation of HP1 extract togelfiltration chromatography. Surprisingly,about 50% of the

antigen was found to elute with an apparent molecularweightof greater than 106 (Fig. 7).

SDS-polyacrylamide gel electrophoresis and direct visualizationoftheantigenby Coomassie blue stainingwere used toconfirm the presence of the small tprotein in the excluded and in-cludedfractions(Fig. 8A).Approximately three-fold more 15-kd protein was visible in the ex-cluded fraction than in the included fraction. This result could be accounted for if two-thirds of the cross-reacting antigen in the included fractionwerethe 12-kdprotein.

We havetried4 MNaCl,0.2 M

,8-mercapto-ethanol,6 Murea, avariety of

detergents,

and extremesin pHin anattemptto dissociate the small tproteininto itsmonomerform. None of theseagents, either aloneorin

combination,

was

sufficienttodisruptthe smallt

complex.

How-ever, with extremedenaturationconditions such asthose employedduring SDS-polyacrylamide gel electrophoresis, we found the antigen mi-grating as a monomeric species. The small t

moleculesarethereforenot

covalently

boundto

oneanother, except

perhaps by

labile disulfide-typebonds.Weare

currently pursuing

alternate conditions to achieve dissolution of the high-molecular-weight

complex.

Having established that small t antigen was

present in HP1 cells ina

high-molecular-weight

form, we were interested in

characterizing

the gelfiltration

properties

of authenticSV40small tantigen.Acrude

cytoplasmic

extractof SV40-infected monkeycellswasfractionated

by

aga-rose A1.5m

chromatography,

and the small t

protein was found to elute in a broad

peak

extending from

approximately 500,000

daltons

VOL. 37,1981

on November 10, 2019 by guest

http://jvi.asm.org/

[image:9.485.96.392.77.229.2]

(10)

692 THUMMEL, BURGESS, AND TJIAN

IEF

llJ

CD

uI

, ':

X W i f,&S 0, * '

'#E i t40" .0::

.|i::

*< * =

0:"i:i" i : i.0, f,+,. ziS.iS:-:

hiR:::::D:

:,'-'i ::: ::' ::::

:*.

t:.ff

,,, ::04

:: (:

.:'iE't9 i.iMW =

A:-:,::Xi':...::7

,,.ft

.SaWBs:.

tA,C,i'

::

'iN-'''Vit;

''i":0.'

.00>4s4'0'StCE;

i@'X,

d7

...7:-,,¢-,,;

.S:-i

,,R,,,,w0

E$:

..RE

¢,>v

.-: m.'i =%Q, i, ,04

.'' -:

:::-:E:. .

i- iS.i vii 0

.... ... .;,

-7a;-0;v: 000 0- Bx

.. *

t:f)000; ff ff .;

.:

::::

:Xt000;C00. f;

:::

:? ..*A:

::i..7 Z E:

1, -*.it E

f ,:

::

, .00 7d, S*;i

W

::, ,l:

::

FIG. 5. Two-dimensionalgelelectrophoresisofsmalltantigenfrom SV40andHPI.Thefollowingsamples

from[35SJmethioninepulse-labeledcellsweresubjectedtoisoelectricfocusingin onedimension and

SDS-polyacrylamidegelelectrophoresis (PAGE)in thesecond dimension(35).Panels:(A)7x105cpmofanextract fromcellscarryingapSV240-like plasmid, with theSV40insert in thewrongorientation; (B) 7 x105cpm of

HP1 extract;(C)2x 103 cpmofimmunoprecipitatedsmalltantigenfrom SV40-infectedmonkeycells;(D)A

mixture of2 x 103 cpm each ofauthentic SV40 and HPl-encoded small t antigen purified by anti-T

immunoprecipitation.

downtomonomeric size(Fig.7). Onceagain,gel electrophoresis of anti-T immunoprecipitates from several column fractions confirmed the presenceofsmalltantigen in a high-molecular-weight form (Fig. 8B). P. Tegtmeyer, T. Spill-man, and F. R. Schuetz (Cold Spring Harbor Symp. Quant. Biol.,inpress)havealsoreported size heterogeneity of authentic SV40 small t

antigen isolated fromlytically infectedmonkey

cells. The behavior of the HP1-encoded smallt

protein as a high-molecular-weight complex is therefore not unique to the bacterial system. The larger small t complex and high ratio of oligomerstomonomers inthe bacterialextract

maybe due to the increased intracellular

con-centrationfound in HP1cells.

Itis alsopossiblethatsomecomponentof the bacterial cell isresponsiblefor the shift ofsmall J. VIROL.

on November 10, 2019 by guest

http://jvi.asm.org/

[image:10.485.89.394.61.490.2]

(11)

t antigen to a very high molecular weight. To testfor this,anextract from E. coli 294cells was mixed with a cytoplasmic extract from SV40-infectedmonkeycellsandsubjected to gel filtra-tion chromatography. Thesmall telution pat-ternlooked identicaltothat frominfected mon-keycellsalone, indicating that, under these con-ditions, no bacterialcomponents are contribut-ing to the formation of the high-molecular-weightcomplex.

We haveused phenyl-Sepharose chromatog-raphyaswellas avarietyof ionexchange resins such asDEAE-cellulose, Bio-Rex 70, phospho-cellulose, and hydroxyapatitetofractionate fur-ther the smalltpolypeptide. Inmost cases,the antigen was found to behave heterogeneously. Todate we have beenabletoachieve a 100-fold purificationof thisprotein, andwe arecurrently

X1%

-c

0.

0

1I...

0

E-0

0

pursuing alternative means of

purifying

the HP1-encodedsmall t antigen tohomogeneity.

DISCUSSION

We have maximized the expression of SV40 smalltantigen by constructing a bacterial plas-mid whichfuses the SV40 F gene to the E. coli lac promoter-operatorsequence.Recently,other investigators havesuccessfullyusedsimilar tech-niques to achieve expression of various procar-yotic andeucaryotic viralgenes (1, 41, 42). We have modifiedtheirprocedureby first inserting theforeigngene into a vectorcarrying the lac promoter and then reconstructing the hybrid ribosomebindingsiteby treatment with BAL 31 nuclease.This enzyme has asingle-stranded en-donucleaseactivityand also acts

exonucleolyti-Electrophores

is

[image:11.485.97.385.265.572.2]

pH

2.I

FIG. 6. Trypticfingerprint analysisofsmalltantigen fromSV40 and HP1. Proteins labeled with

[MS]-methioninewerepurified byanti- Timmunoprecipitation, SDS-polyacrylamide gel electrophoresis, and

elec-troelutionasdescribedin the text. Samplesweresubjected toperformic acid oxidation anddigestedwith

tolylsulfonyl phenylalanyl chloromethylketone-treated trypsin (Worthington) asdescribedpreviously (46).

Samplesof1 to5 1l(ca.50,000to100,000 cpm)werespottedonBrinkmanglass-backedcellulosethin-layer

plates, subjected to electrophoresis atpH2.1 (8% acetic acid, 2%formic acid) for 1,000 V-h, and then

chromatographed in the second dimensionfor4to5h inbutanol-pyridine-acetic acid-water(97:75:15:60).

Theplatesweredriedandautoradiographed. Thearrowsindicatepeptidesdiscussed in thetext.

VOL. 37,1981

on November 10, 2019 by guest

http://jvi.asm.org/

(12)

694 THUMMEL, BURGESS, AND TJIAN

.0 0

4

-r

I

0

0 N

4

l

0

4.

= E C,)

0

N

-r

0 40

4

I:

, )

.E

= oi

[image:12.485.64.456.56.264.2]

40 60 80 100 120 140 160 180 20 30 40 50 60 TO

Fraction Fraction

FIG. 7. Agarose A1.5m columnchromatographyofextractfrom HPI cells andfrom SV40-infectedmonkey

cells. Crudeextractsfrom15gof HPI cells(1,300mgofprotein) andonehundred 100-cmplates of

SV40-infectedmonkeycells(12mgofprotein)wereprepared and subjectedtoBio-GelA1.5mcolumnchromatography

asdescribed in the text. Small tantigen was detectedby radioimmunoassay by using anti-D2serum to

preabsorb large Tantigenin theinfectedmonkeyceUfractions,asdescribed in thetext.Nucleic acids and

proteinweredeterminedspectrophotometrically byabsorbanceat260nmand280nm,respectively. Thepeak

of smalltantigeninfraction 25 of the infected monkey cell profile couldnotbe detectedby gelelectrophoresis

andCoomassiestainingand thus may represent residuallargeTantigen notpreabsorbed bythe anti-D2

serum.

callytodigestprocessivelyfrom thetermini of

a DNA duplex (20), leaving blunt ends which

canberejoined byT4DNAligase.These prop-erties ofBAL31 nuclease make it ideal for the construction of"expression plasmids" and forin vitro deletionmutagenesis in general.

By transforming HP1 intoaderivative ofE. coli 294 whichoverproduces lac repressor, we haveconfirmed thatexpression of smallt anti-gen is under the control of the lacregulatory sequences. Theexpressionof smalltantigen in this host was effectively abolished. However, uponinductionwith

isopropyl-,8-D-thiogalacto-side, maximum levels of expression could be achieved (Fig. 2D). In contrast, when this gra-tuitous inducerwasaddedto aculture of HP1 in its normal E. coli 294 host, only a slight increase inexpression could be detected. This is

to be expected as there are approximately 10 molecules of lac repressor present in a wild-type E. coli cell (17), and these few molecules can have little effecton the30 to 40HP1 plasmids which are present in a transformed bacterium

(6).

Under ourgrowth conditions, HP1 produced 40,000to80,000molecules ofsmallt antigenper' cell, orapproximately 1,000 to 3,000 molecules ofsmall tantigen per plasmid. Thus, HP1 was functioning at20 to60% of its maximum

theo-reticalefficiencyincomparisonto afully induced

,8-galactosidase

gene

(1).

Figure 3A demonstrates that the

concentra-tionofsmalltantigeninan extractof HP1 cells was 10-fold higher than that in an equivalent

amount of SV40-infected monkey cell extract.

The quantitation of small tantigen inthis eu-caryotic systemis

imprecise,

because detection of the protein can be achieved only by immu-noprecipitation (13). However, assuming that 0.05% of the totalproteininthe SV40-infected monkey cells is small t antigen,then 1 liter of HP1cellsatlate log phase containsasmuchof the antigenas canbe recovered from 1.2 x 105 plates of SV40-infected monkeycells. This level ofproduction should facilitate the purification of thisproteintohomogeneity.

The small t antigens produced by HP1 and SV40were found tobe virtually indistinguish-able on the basis of electrophoretic mobility, antigenic determinants, isoelectric point, and trypticfingerprintanalysis. The only detectable difference between theseproteinswasthe slower migration of theHP1-encoded N-terminal tryp-tic peptide during ascending chromatography. This difference ismostlikelyduetothe absence of amino-terminal acetylation in the bacterial protein. Like manyeucaryoticproteins (4),small

t antigen isolated from SV40-infected monkey

on November 10, 2019 by guest

http://jvi.asm.org/

(13)

A

1 2 3 45 6

B

1234

[image:13.485.44.236.63.297.2]

HPI

SV40

FIG. 8. SDS-gel electrophoresis of

high-molecular-weightandmonomericsmalltantigen. Samplesfrom

gel filtration columnfractions containing

high-mo-lecular-weightand monomericsmalltantigenwere

fractionated by SDS-polyacrylamidegel

electropho-resis either beforeorafter immunoprecipitation. The

proteinswerevisualized by staining withCoomassie

brilliantblue. (A) Samples containing150U ofsmall

tantigen fromHPI cellsaseithera

high-molecular-weight complex (lanes Ito3)orinmonomericform

(lanes 4 to 6) are depicted. A sample of the total

protein (lanes1and4),thesupernatantofananti-T

immunoprecipitation (lanes2 and5),and the

immu-noprecipitated proteins (lanes3 and6)were

electro-phoresedinneighboringlanes.(B) Samples

contain-ing 200 U ofsmall t antigen from SV40-infected

monkeycells which elutefrom gel filtrationas a

high-molecular-weight complex (lanesI and2)or as

mon-omeric antigen (lanes 3 and 4) were subjected to

immunoprecipitation with anti-D2 serum to

preab-sorb thelargeTantigen(lanes1 and3).The

super-natant from that immunoprecipitation was then

treated with anti-Tantibody toprecipitate smallt

antigen (lanes2 and4). Large Tantigen has been

proteolyzed toits 89-kd and 84-kdformsduetothe

extractionprocedureused(46).

cells is acetylated at its amino terminus (36). Functionalanalysis of the purified HPl-encoded protein will reveal whether this modification is required for biological activity.

We found thatpSV240, pSV250, and HP1all produced a 12-kd SV40-coded protein in

addi-tiontothe 15-kdsmalltantigen. Tryptic finger-print analysis of the 12-kd protein revealed a

structure identical to that of small t antigen,

with the exception of several amino-terminal

tryptic peptides.Since theexpressionof the

12-kg protein could be regulatedwith lac repressor, itstranscriptmustalso derive fromthelac pro-moter.Theexpressionofthe 12-kd protein may be due to protein synthesis initiation at an in-phase AUG codon located within the small t gene. In fact, there is a potential AAGGAGG Shine andDalgarnosequencelocated upstream from the fourth and fifth in-phase AUG codons of the smalltcoding sequence (38). The stable duplex that thissequence could forn with the 3' end of E. coli 16S rRNA may favor internal initiationoftranslation(44, 50).

The 12-kdproteinappears to represent a for-tuitous amino-terminal deletion of SV40 smallt antigen. It should be possibleto construct other deletion mutations in the small t coding se-quence ofHP1 by using site-directed in vitro mutagenesis techniques. Thesemutant smallt proteins maybe useful for studying the func-tion(s) of this viraltumorantigen.

In spite of the high level of production af-fordedby HP1,thepurificationofsmalltantigen fromthis clone isnotstraightforward, duetothe aggregation properties of the protein. We are currently employingunconventionaltechniques which shouldallow us to

purify

thisprotein to homogeneity. Wehave beguntoraise multiva-lentandmonoclonal antibodiesdirectedagainst small t antigen to determine its intracellular location inSV40-infected and transformed cells. Inaddition,weintendto

purify

the high-molec-ular-weight

complex

ofsmall t

antigen,

mono-mericantigen, and12-kdproteinandtesttheir biological activities by microinjectioninto mam-malian cells. Finally, wehopeto testthese dif-ferentspecies for potential enzymaticactivities.

ACKNOWLEDIGMENTS

WethankTony Pawson and Tsu-Hsun Kung for helpwith thetryptic fingerprintanalysis,Taffy Mullenbach for tissue culturepreparation, Gail Lauer formaking pGL101available, MichaelKligmanfor criticalreadingof thispaper,and Judith Pike forpreparation of themanuscript.

This workwasfundedby Public Health ServicegrantCA 25417 from the National Cancer Institute, by the Cancer ResearchCoordinating Committee, byaBiomedical Research Support Grant, andby partial supportfrom Public Health ServicegrantES01896 from the National Institute of Environ-mental Health Sciences.

0 LITERATURE CITED

1. Backman, K., and M. Ptashne.1978.Maximizinggene

expressionon aplasmid usingrecombination in vitro. Cell13:65-71.

2. Berk, A.,and P.Sharp.1978.Spliced earlymRNAs of simianvirus 40. Proc. Natl. Acad. Sci.U.S.A. 75:1274-1278.

3. Black,P. H.,W. P.Rowe,H.C.Turner,and R. J. Huebner. 1963.Aspecificcomplement-fixing antigen present in SV40tumor andtransformed cells. Proc. Natl.Acad. Sci.U.S.A. 50:1148-1156.

4. Bloemendal,H. 1977. The vertebrate eye lens. Science 197:127-138.

VOL. 37,1981

on November 10, 2019 by guest

http://jvi.asm.org/

(14)

5. Bouck, N., N. Beales, T. Shenk, P. Berg, and G. DiMayorca. 1978. Newregionof thesimian virus 40

genomerequiredfor efficient viral transformation. Proc. Natl.Acad. Sci. U.S.A. 75:2473-2477.

6. Boyer,H.W.,M.Betlach,F.Bolivar,R.L.Rodriguez, H. L.Heyneker, J. Shine, and H. M. Goodman. 1977. In R. F. Beers, Jr., and E. G. Bassett (ed.), Recombinant molecules: impactonscience andsociety,

p.9-20.RavenPress,Publishers,New York. 7.Chacanos, G.,J. H.vandeSande,and R. B.Church.

1975.Endgrouplabelingof RNA anddouble-stranded DNAbyphosphate exchange catalyzed by bacterio-phageT4induced polynucleotidekinase. Biochem. Bio-phys.Res. Commun. 66:962-969.

8.Clewell,D.B.,and D. R. Helinski. 1969.Supercoiled circularDNA-protein complexinEscherichia coli:

pu-rification and induced conversion toanopencircular DNAform.Proc. Natl. Acad. Sci. U.S.A. 62:1159-1166. 9. Cohen, S. N.,A.Chang,andL. Hsu. 1972. Nonchro-mosomalantibiotic resistanceinbacteria:genetic trans-formationof Escherichia colibyR-factor DNA. Proc. Natl.Acad. Sci. U.S.A.69:2110-2114.

10.Cowan, K.,P.Tegtmeyer, and D. D.Anthony. 1973.

Relationshipofreplicationandtranscriptionofsimian virus 40DNA.Proc. Natl. Acad.Sci.U.S.A. 70:1927-1930.

11.Crawford,L.V.,C. N.Cole,A.E.Smith,E.Paucha, P.Tegtmeyer,K.Rundell,and P. Berg. 1978. Or-ganizationandexpressionofearlygenesofsimianvirus 40.Proc.Natl.Acad. Sci. U.S.A. 75:117-121.

12. Crawford, L.V.,and P. Z.O'Farrell. 1979. Effect of alkylationonthephysical propertiesof simian virus 40 T-antigen species.J. Virol.29:587-596.

13.Crawford,L.V.,D. C.Pim,andD. P.Lane. 1980. An immunochemical investigation ofSV40T-antigens. 2. Quantitationofantigensandantibodyactivities.

Virol-ogy100:314-325.

14. Dayhoff,M.O.,R. E.Dayhoff,andL. T. Hunt. 1976. Compositionofproteins,p.301-310.In M.0.Dayhoff

(ed.), Atlas ofproteinsequence and structure 5. Na-tional BiomedicalResearch Foundation, Washington, D.C.

15. Feunteun, J.,M.Kress,M.Gardes, and R. Monier. 1978.Viable deletionmutantsinthe simianvirus40 early region. Proc. Natl. Acad. Sci. U.S.A. 75:4455-4459.

16. Fraser,T.H.,and B. J.Bruce. 1978.Chicken ovalbumin issynthesized and secretedby Escherichia coli. Proc. Natl.Acad.Sci. U.S.A.75:5936-5940.

17. Gilbert, W.,and B.Mueller-Hill. 1966.Isolationofthe lacrepressor. Proc.Natl. Acad. Sci. U.S.A. 56:1891-1898.

18. Goeddel,D.V.,H. L.Heyneker, T. Hozumi, R. Ar-entzen,K.Itakura,D.G.Yansura, M. J. Ross, G. Miozzari,R.Crea, andP.H.Seeburg.1979.Direct expression inEscherichia coli ofa DNA sequence

codingforhumangrowth hormone. Nature (London) 281:544-548.

19. Graessmann, A.,M.Graessmann,R.Tjian,andW. C.Topp. 1980.Simian virus 40small-tproteinis

re-quiredforlossof actin cable networks inratcells.J.

Virol. 33:1182-1191.

20. Gray, H.B., D. A. Ostrander,J.L. Hodnett, R. J.

Legerski, and D. L. Robberson.1975.Extracellular nucleasesof Pseudomonas BAL 31. I.Characterization of single strand-specific deoxyriboendonuclease and double-stranddeoxyriboexonucleaseactivities. Nucleic Acids Res.2:1459-1492.

21. Grunstein, M.,and D.S.Hogness.1975.Colony hybrid-ization:amethodfor the isolation of cloned DNAs that

containaspecificgene.Proc. Natl. Acad.Sci. U.S.A. 72:3961-3965.

22. Hassell, J. A.,E. Lukanidin, G. Fey, andJ.

Sam-brook. 1978. Thestructureandexpression oftwo de-fective adenovirus2/simian virus 40 hybrids. J. Mol. Biol.120:209-247.

23. Hirt,B. 1967.Selective extraction of polyoma DNA from infectedmousecellcultures. J.Mol. Biol.26:365-369. 24.Johnsrud, L. 1978.Contactsbetween Escherichia coli

RNA polymerase anda lac operon promoter. Proc. Natl. Acad. Sci. U.S.A.75:5314-5318.

25. Katz,L,D.T.Kingsbury, and D.R. Helinski. 1973.

Stimulation by cyclic adenosine monophosphate of plasmidDNAreplication and catabolite repression of theplasmid DNA-protein relaxation complex. J. Bac-teriol.114:577-591.

26. Kessler, S. W. 1975. Rapid isolation of antigens fromcells withastaphylococcal proteinA-antibody absorbent. J.

Immunol.115:1617-1624.

27. Lewis, A. M., and R. G. Martin. 1979. Oncogenicity of simianvirus40deletionmutantsthat induce altered 17-kilodaltont-proteins. Proc. Natl. Acad. Sci. U.S.A. 76: 4299-4302.

28. Linke, H. K., T. Hunter, and G. Walter. 1979. Struc-turalrelationship between the 100,000- and 17,000-mo-lecular weight T antigens of simian virus40(SV40)as

deducedby comparison with the SV40-specific proteins codedby the nondefective adenovirustype2-SV40 hy-brid viruses. J. Virol. 29:390-394.

29. Martial, J. A., R. A.Hallewell,J. D.Baxter,andH. M. Goodman. 1979. Human growthhormone: comple-mentaryDNAcloning and expressionin bacteria.

Sci-ence205:602-607.

30. Martin, R. G.,V. P. Setlow,C. A.Edwards,andD. Vembu. 1979. The roles of the simian virus40 tumor antigens in transformation ofChinese hamster lung cells.Cell 17:635-643.

31. Maxam, A. M., and W. Gilbert. 1977. Anewmethodfor sequencing DNA. Proc. Natl. Acad. Sci. U.S.A. 74:560-564.

32. Mercereau-Puijalon, O.,A.Royal,B.Cami,A. Gar-apin, A. Krust,F.Gannon,and P.Kourilsky.1978. Synthesisofanovalbumin-likeprotein byEscherichia coliK12 harbouring arecombinant plasmid. Nature (London) 275:505-510.

33. Miller, J.1972.Experimentsinmolecular genetics.Cold Spring HarborLaboratory, Cold Spring Harbor, New York.

34. Mueller-Hill, B.,L.Crapo,and W.Gilbert.1968. Mu-tantsthat makemorelacrepressor.Proc.Natl. Acad. Sci. U.S.A.59:1259-1264.

35. O'Farrell, P. H. 1975.Highresolutiontwo-dimensional electrophoresis ofproteins. J. Biol. Chem. 250:4007-4021.

36. Paucha, E.,A.Mellor,R.Harvey,A.E.Smith, R. W. Hewick, andM. D.Waterfield.1978.Large andsmall

tumor antigens from simian virus 40 have identical aminoterminimappingat0.65mapunits.Proc. Natl.

Acad.Sci.U.S.A.75:2165-2169.

37. Prives, C., E.Gilboa, M. Revel, and E. Winocour. 1977.Cell-freetranslation of simian virus 40 early

mes-senger RNA coding for viral T-antigen. Proc. Natl. Acad.Sci. U.S.A.74:457-461.

38. Reddy,V.B.,B.Thimmappaya,R.Dhar,K.N.

Sub-ramanian,B. S.Zain,J.Pan,P. K.Ghosh,M.L. Celma,andS. M.Weissman. 1978.Thegenomeof simian virus 40.Science 200:494-502.

39. Reed,S.I.,G.Stark,and J. C.Alwine.1976. Autoreg-ulationofsimian virus 40geneAby Tantigen.Proc. Natl.Acad.Sci.U.S.A.73:3083-3087.

40.Rigby, P.,D.Rhodes,M.Dieckmann, and P. Berg. 1977. Labeling deoxyribonucleic acid tohigh specific activityin vitrobynicktranslationwithDNA

polym-eraseI. J.Mol. Biol. 113:237-251.

41. Roberts,T.M.,I.Bikel, R.R.Yocum,D.M.

Living-ston,and M.Ptashne. 1979.Synthesisof simian virus

J. VIROL.

on November 10, 2019 by guest

http://jvi.asm.org/

(15)

40 tantigen in Escherichiacoli.Proc.Natl. Acad. Sci. U.S.A. 76:5596-5600.

42.Roberts, T.M.,R.Kacich,and M.Ptashne. 1979. A general method for maximizing the expression of a clonedgene. Proc. Natl. Acad. Sci. U.S.A. 76:760-764. 43.Seif,R., and R.G. Martin. 1979. Simian virus 40 small

t antigenis notrequired for the maintenance of trans-formation but mayactasapromoter (cocarcinogen) during establishment of transformation in resting rat cells. J. Virol. 32:979-988.

44. Shine, J., and LDalgarno. 1974. The 3'-terminal se-quence ofEscherichia coli 16Sribosomal RNA: com-plementarity to nonsense triplets and ribosome binding sites. Proc.Natl. Acad. Sci. U.S.A.71:1342-1346. 45.Sleigh, M. J., W. C. Topp, R. Hanich,and J.F.

Sam-brook.1978. MutantsofSV40with an altered small t protein are reducedin theirabilitytotransformcells. Cell14:79-88.

46. Smith, A.E., R.Smith, and E. Paucha.1978.Extraction andfingerprint analysis of simian virus40 large and smallT-antigens. J. Virol. 28:140-153.

47. Southern, E. M. 1975. Detection ofspecific sequences among DNAfragmentsseparated by gel electrophore-sis.J. Mol. Biol.98:503-517.

48. Steinberg, B. M., and R. Pollack. 1979. Anchorage independence:analysis of factors affecting the growth and colony formationofwild-typeand dl54/59mutant SV40-transformedlines.Virology 99:302-311. 49. Steinberg, B. M., R. Pollack, W.Topp, and M.

Bot-chan.1978.Isolationand characterization ofT

antigen-negative revertants from aline oftransformedrat cells containing onecopy of the SV40 genome.Cell 13:19-32.

50. Steitz, J.A.,and K. Jakes. 1975. How ribosomes select initiatorregionsinmRNA:base pair formation between the3' terminusof 16S rRNA and the mRNAduring initiation of proteinsynthesisinEscherichia coli. Proc. Natl.Acad. Sci. U.S.A. 72:4734-4738.

51. Studier, R. W.1973.Analysis of bacteriophageT7early RNAs andproteinsonslab gels. J. Mol.Biol. 79:237-248.

52. Tegtmeyer, P. 1972.Simian virus 40 deoxyribonucleic acidsynthesis: theviralreplicon. J.Virol. 10:591-598. 53. Tegtmeyer, P. 1975. Function of simian virus 40 gene A

intransforming infection.J.Virol.15:613-618. 54. Tjian,R., A. Robbins, and D.Lane. 1979. Inhibition of

SV40 T antigen enzymatic activity by amonospecific antibody, p. 637-642. In R. Axel, T. Maniatis, and C. F. Fox(ed.), Eukaryotic gene regulation, vol. 14. Academic Press,Inc., New York.

55. Todaro, G.,and K. I. Takemoto.1969."Rescued" SV40: increasedtransformiingefficiency in mouse and human cells. Proc. Natl. Acad. Sci. U.S.A. 62:1031-1037. 56. Tooze, J.1980.Themolecularbiologyoftumorviruses.

Part 2, DNAtumorviruse.Cold Spring Harbor Labo-ratory,ColdSpringHarbor, New York.

57. Topp, W.C. 1980. Variable defectiveness for lytic growth of the dl 54/59mutantsofsimian virus 40. J.Virol. 33: 1208-1210.

VOL. 37,1981