0022-538X/07/$08.00⫹0 doi:10.1128/JVI.01230-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.
The p122 Subunit of
Tobacco Mosaic Virus
Replicase Is a Potent
Silencing Suppressor and Compromises both Small Interfering
RNA- and MicroRNA-Mediated Pathways
䌤
Tibor Csorba,
1,2Aurelie Bovi,
3Tama
´s Dalmay,
3* and Jo
´zsef Burgya
´n
1*
Agricultural Biotechnology Center, Plant Biology Institute, P.O. Box 411, H-2101 Go¨do¨llo˝, Hungary1; Department of Genetics,
Eo¨tvo¨s Lo´ra´nd University, Budapest, Hungary2; and University of East Anglia, Norwich, United Kingdom3
Received 5 June 2007/Accepted 10 August 2007
One of the functions of RNA silencing in plants is to defend against molecular parasites, such as viruses, retrotransposons, and transgenes. Plant viruses are inducers, as well as targets, of RNA silencing-based antiviral defense. Replication intermediates or folded viral RNAs activate RNA silencing, generating small interfering RNAs (siRNAs), which are the key players in the antiviral response. Viruses are able to counteract RNA silencing by expressing silencing-suppressor proteins. It has been shown that many of the identified silencing-suppressor proteins bind long double-stranded RNA or siRNAs and thereby prevent assembly of the silencing effector complexes. In this study, we show that the 122-kDa replicase subunit (p122) of crucifer-infectingTobacco mosaic virus (cr-TMV) is a potent silencing-suppressor protein. We found that the p122 protein preferentially binds to double-stranded 21-nucleotide (nt) siRNA and microRNA (miRNA) interme-diates with 2-nt 3ⴕoverhangs inhibiting the incorporation of siRNA and miRNA into silencing-related com-plexes (e.g., RNA-induced silencing complex [RISC]) both in vitro and in planta but cannot interfere with previously programmed RISCs. In addition, our results also suggest that the virus infection and/or seques-tration of the siRNA and miRNA molecules by p122 enhances miRNA accumulation despite preventing its methylation. However, the p122 silencing suppressor does not prevent the methylation of certain miRNAs in
hst-15mutants, in which the nuclear export of miRNAs is compromised.
RNA silencing is a highly conserved mechanism in eu-karyotes, and endogenous silencing pathways have important roles in gene regulation at the transcriptional, RNA stability, and translational levels (8). Although it operates through di-verse pathways, RNA silencing relies on a set of core pro-cesses, which may not entirely overlap. The triggers of RNA silencing are highly structured single-stranded RNA or double-stranded RNA (dsRNA) molecules, which are processed into 21- to 24-nucleotide (nt) short interfering RNA (siRNA) or microRNA (miRNA) duplexes by the RNase III-type DICER enzymes. Then, small RNAs are incorporated into a ribonu-cleoprotein complex termed an RNA-induced silencing com-plex (RISC) (50). Assembly of RISC involves guide strand incorporation and passenger strand elimination to program active RISC (31, 44). InDrosophilaembryo extract, DICER2-R2D2 (DCR2-DICER2-R2D2) complexed with duplex siRNA serves as an initiator of RISC assembly. This complex then interacts with an AGO2-containing multiprotein complex and cleaves the passenger strand of the siRNA duplex to form the single-stranded siRNA-containing 80S holo-RISC, which catalyzes sequence-specific cleavage of target RNA (31, 42, 49).
In higher plants, AGO1 protein is the slicer component of RISC (43), and it recruits small silencing-related RNAs, such as miRNAs, trans-acting siRNAs (tasiRNAs),
transgene-de-rived siRNAs (5), and virus-detransgene-de-rived siRNAs (66). However, other members of the AGO family and different Dicer-like (DCL) and RNA-dependent RNA polymerase (RDR) pro-teins are also involved in diverse RNA-silencing pathways. In the nucleus, DCL3-, RDR2-, AGO4-, and NRPD1-dependent silencing is associated with DNA cytosine methylation, hetero-chromatin-associated modifications of histone H3 tails, and transcriptional silencing (19, 22, 29, 35, 60, 67). Posttranscrip-tional RNA-silencing-related pathways for endogenous gene regulation involve miRNAs (DCL1 dependent) or tasiRNAs (DCL4 and RDR6 dependent) (30). Virus-induced RNA si-lencing is triggered by dsRNA intermediates of cytoplasmically replicating viruses, RDR1- or RDR6-dependent formation of dsRNA, or structured regions of viral RNAs (34, 54). Virus-induced silencing leads to the sequence-specific degradation of viral RNA (37) and the generation of a mobile silencing signal that activates RNA silencing in uninfected cells (4, 54).
Systemic invasion of plants by viruses requires effective mechanisms to suppress RNA silencing. To counteract antivi-ral RNA silencing, most plant and many animal viruses have evolved silencing-suppressor proteins (45, 54). The large ma-jority of plant virus suppressors of RNA silencing bind either to long dsRNA or to siRNA-miRNA duplexes (9, 25, 32, 46, 51). However, two exceptions have also been reported: the 2b protein of cucumoviruses (66), which binds to and inactivates the AGO1 effector protein of silencing, and the P0 RNA-silencing suppressor of the poleroviruses (40, 41), which does not have RNA binding activity (J. Burgyan, unpublished re-sults).
The crucifer-infecting strain of Tobacco mosaic virus (cr-TMV) belongs to the genus Tobamovirus. Tobamoviruses are
* Corresponding author. Mailing address for J. Burgya´n: P. O. Box 411, H-2101 Go¨do¨llo˝, Hungary. Phone: 155. Fax: 36-28-526-145. E-mail: [email protected]. Mailing address for T. Dalmay: University of East Anglia, Norwich, United Kingdom. Phone: 44 1603 593221. Fax: 44 1603 592250. E-mail: [email protected].
䌤Published ahead of print on 22 August 2007.
11768
on November 8, 2019 by guest
http://jvi.asm.org/
a group of rod-shaped plant viruses with undivided positive-sense RNA genomes encoding at least four proteins. The genomic RNA of cr-TMV directs the translation of a 122-kDa protein and its read-through product, a 178-kDa protein, which are involved in the replication of the viral RNA. The other two proteins, the 29-kDa movement protein and the 18-kDa coat protein, are translated from individual 3⬘-coterminal sub-genomic RNAs (14). The p122 protein is composed of three domains: a methyltransferase domain of 42 to 466 amino acids, an intervening region (IR), and a helicase domain of 823 to 1,076 amino acids, whereas the 178-molecular-weight protein possesses an additional RDR motif. Little is known about the precise mechanism of action of p122 upon infection.
It has been demonstrated that the p126 protein of TMV strain OM (corresponding to p122 of cr-TMV) forms a het-erodimer replicase complex with p183 and two or more host proteins (56). Only one specific interaction between p126 and p183 was identified, which was in the C-terminal half of the p126 IR and the N-terminal portion of the p183 helicase do-main (17). The ratio between p126 and p183 is 1:1, although they are expressed in a 10:1 ratio during infection (56). The biological function of this excess amount of p126 remains to be determined. A substitution mutant of TMV strain L in which the amber stop codon of p126 was replaced by a tyrosine codon, thus expressing only the p183 read-through product, was shown to replicate in vivo in the absence of the p126 protein. The growth rate of this mutant virus was about 1/10 of the rate of the wild type (wt) (21). All these results imply that the open reading frame 1 product, besides being involved in replication complex actions, has other functions, as well. In-deed, the other analogous protein, p130 of tomato mosaic virus (ToMV), has been shown to have a silencing-suppressor func-tion (24). It was also shown that p130 does not suppress the activity of the preexisting sequence-specific silencing ma-chinery, suggesting that p130 blocks the utilization of small RNAs in the formation of new effector complexes (24); however, the molecular bases of the suppression remained to be determined.
Here, we demonstrate that p122 has strong silencing-sup-pressor activity, and we explore in detail the molecular mech-anism of silencing suppression by the p122 protein. Our find-ings demonstrate that p122 prevents si/miRNA assembly into RISCs, inhibiting the development of virus- or transgene-in-duced silencing activity. In contrast, p122 has no effect on the slicer activity of preassembled RISC, both in vitro and in vivo. In addition, we also demonstrate that p122 interferes with miRNA- and tasiRNA-mediated pathways. However, this in-terference is not a general effect; instead, it likely depends on the spatial and temporal coexpression of p122 and miRNAs.
MATERIALS AND METHODS
Plasmid constructs.The full-length infectious cDNA clone of pUC19-cr-TMV was prepared previously (T. Dalmay, unpublished results), and the pUC19-cr-TMV-⌬p122 mutant virus clone was prepared by PCR mutagenesis, replacing the amber stop codon of p122 (TAG) with tyrosine (TAT).
The suppressor p122 was PCR amplified using appropriate primer pairs, cloned into pBIN61, and used for agroinfiltration assays. The following con-structs used for different transient assays were described previously: 35S-green fluorescent protein (GFP), 35S-GFP-IR, 35S-sigma 3 (28), 35S-His-HC-Pro (25), GFP-Cym, and GFP-Pothos latent virus(PoLV) (37). GFP-171.1 and GFP-171.2 were kindly provided by O. Voinnet and were described previously (38).
Con-struct 35S-p122-His was prepared by amplifying the p122 open reading frame by PCR using a forward primer containing a start codon (italics) (5⬘-ATGG CACAATTTCAACAAACAATTGAC-3⬘) and a reverse primer containing RGS His6epitope codons (underlined) and a stop codon (italics) (5⬘-CTAG TGATGGTGATGGTGATGCGATCCTCTTTGTATCCCCGCTTCAACTC TATACATGTC-3⬘), and then this fragment was cloned into an SmaI-cleaved BIN61 vector. 35S-p122 was prepared like 35S-p122-His except that the His tag was omitted from the reverse primer. For the Pri-miR171c construct, we amplified the pri-miR171 sequence from cDNA ofArabidopsis thalianawith the forward (5⬘-TGAGCGCACTATCGGACATCAAATAC-3⬘) and reverse (5⬘-TAAACGCGTGATATTGGCACGGCTC-3⬘) primers and cloned it into the pBIN61-SmaI vector.
Agrobacterium tumefaciensinfiltration.A. tumefaciensC58C1/pBIN61 harbor-ing the appropriate plasmid (GFP, HC-Pro, p122, or pBIN-sigma3) was infiltrated according to the method described previously (46). The GF-IR construction was made in the pHannibal vector (57) by amplifying GFP sequences with forward primer 5⬘-GAACTCGAGATGAGTAAAGGAGAAG AACTTTTCAC-3⬘ or 5⬘-GAGGTACCCGTGTCTTGTAGTTCCCGTCAT C-3⬘and reverse primer 5⬘-GAATCTAGAATGAGTAAAGGAGAAGAACTT TTCAC-3⬘ or 5⬘-GAATCGATCGTGTCTTGTAGTTCCCGTCATC-3⬘. The GF-IR construction (bearing an intron between the GF and FG sequences) was transferred into the pBIN-61 vector and used in infiltration assays. The GFP-expressingNicotiana benthamiana16C line was coinfiltrated with 35S-GFP (op-tical density at 600 nm [OD600] ⫽0.3) or 35S-GF-IR (OD600 ⫽0.6) and suppressor protein constructs at an OD600of 0.6. Total RNA was extracted from the infiltrated paths and analyzed by Northern and Western blotting.
Uninfected or Cym19stop-infectedN. benthamianaplants were coinfiltrated with siRNA- or miRNA-sensor constructs (37, 38) at an OD600of 0.15, and the suppressor protein constructs and the pri-miR171c construct were infiltrated at OD600s of 0.5 and 0.4, respectively.
RNA isolation and hybridization analyses. In vitro transcription of the pUC19-cr-TMV or pUC19-cr-TMV-⌬p122 viral construct from PmlI-linearized DNA templates and the inoculation of RNA transcripts ontoN. benthamiana andA. thalianaColumbia-0 ecotype plants were performed as described previ-ously (13). In vitro RNA transcripts were capped with a cap analogue (New England Biolabs, Hitchin, United Kingdom) as previously described (34). Total RNAs from mock- and cr-TMV-infected plants were isolated using Trizol re-agent. RNA extraction was performed 4 days postinoculation (p.i.) forN. benthamianaand 14 days p.i. forA. thaliana. RNA gel blot analysis was per-formed as described previously (46).
Quantitative real-time RT-PCR analysis.Expression of the DCL1 gene in cr-TMV-infected and healthy control wt or mutant plants was estimated by quantitative real-time reverse transcription (RT)-PCR using the SYBR Green assay (Applied Biosystems) and the Rotor-Gene 3000 (Corbett Research) sys-tem. RT-PCR was performed with the DCL1 forward primer (5⬘-ACAACTGC TGCTTGGAAGGTTTTTCAACCTTTGC-3⬘) and the DCL1 reverse primer (5⬘-GCATTGGAAGTGTCTCTGGTGTCACCATGG-3⬘) (amplicon region, between bases 5501 and 5570 of the DCL1 mRNA). cDNA was synthesized in a 20-l reaction volume using a QuantiTect Reverse Transcription Kit (QIAGEN). The quantitative real-time RT-PCR thermal profile was 95°C for 10 min and 40 cycles of 95°C for 15 s and 60°C for 60 s. The U6 snRNA was used as an internal standard in quantitative PCR analysis for each reaction. The primers for U6 were as follows: forward primer, 5⬘-GTCCCTTCGGGGACATCCGATAAAATTGG AACG-3⬘, and reverse primer, 5⬘-AAAATTTGGACCATTTCTCGATTTATG CGTG-3⬘). The quantitative RT-PCR analysis was repeated five times, and the average was taken to determine the level of DCL1 mRNA.
Protein analysis.Infiltrated leaf tissues were homogenized 3 days p.i. in ex-traction buffer (150 mM Tris-HCl, pH 7.5, 6 M urea, 2% sodium dodecyl sulfate, and 5%-mercaptoethanol). Samples were boiled, and cell debris was removed by centrifugation at 18,000⫻gat 4°C for 10 min. The supernatants were resolved on 8% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and subjected to Western blot analysis. The proteins were visualized using anti-GFP, anti-His, and anti-hemagglutinin (HA) antibodies by chemiluminescence (ECL kit; Am-ersham) according to the manufacturer’s instructions. Commercially available antibodies were used for detection of endoplasmic reticulum-targeted GFP and His6-tagged proteins. Ponceau red staining was used to check the global protein contents of the samples.
In vitro RNA silencing.Drosophilalysate preparation, target RNA labeling, and siRNA annealing were described previously (18). In a 10-ml reaction mix-ture, 2 ml of lysate and siRNA in 5 nM final concentrations were used in 1⫻lysis buffer containing 10% (vol/vol) glycerol. GFP target RNA was in vitro tran-scribed with T7 polymerase in the presence of [32
P]UTP and used in 0.5 nM final concentration. In direct-competition assays, the reaction mixtures were
on November 8, 2019 by guest
http://jvi.asm.org/
bated for 1 h. In active RISC assays, siRNA and the extract were incubated for 30 min to allow RISC assembly, and then the target RNA and suppressor proteins were added to the reaction. Samples were deproteinized, and the RNA was analyzed on an 8% denaturing gel.
Native gel electrophoresis.Native gel electrophoresis for separation of silenc-ing complexes was essentially as described previously (42) with some modifica-tions. In direct-competition assays, in vitro reaction mixtures that were used for target cleavage assays were incubated for 30 min with 5 nM32P-labeled siRNA and suppressor protein and diluted with 10l of loading buffer (1⫻lysis buffer, 6% Ficoll 400), and part of the mixture was analyzed on a 3.9% (39:1 acrylamide-bisacrylamide) native acrylamide gel. The gels were dried and exposed to a storage phosphor screen, and bands were quantified with a Genius Image Ana-lyzer (Syngene).
Detection of 2ⴕ and 3ⴕ OH on the last nucleotide of miRNAs.Periodate treatment and-elimination were performed as previously described (2).
Gel mobility shift assay.For RNA binding reactions, labeled single-stranded RNA or dsRNA (0.5 nM) was incubated with agrobacterium-infiltrated N. benthamianaleaf extract containing⬃1g total protein or the relevant dilutions. Binding reactions and mobility shift assays were carried out as described previously (32).
RESULTS
The p122 protein of cr-TMV is a potent silencing suppres-sor.Kubota et al. (24) reported that the ToMV p130 protein had silencing-suppressor activity, suggesting that homologous proteins in the closely related TMV species are also silencing suppressors. In the strain of TMV that infects A. thaliana
(cr-TMV), the corresponding protein is encoded by the p122 gene. cr-TMV-infectedA. thalianaplants show aberrant leaf development (Fig. 1A), typical of plants carrying mutations in small-RNA pathways, that supports the hypothesis that p122 of cr-TMV is a silencing-suppressor protein.
To gain insight into the nature of the silencing-suppressor activity of p122, previously described systemically silenced GFP transgenicA. thalianaAmp⫻GFP and Amp plants (12) were inoculated with cr-TMV. Fourteen days p.i., GFP fluo-rescence was assessed in the virus-infected plants. Figure 1C and D shows that TMV infection resulted in reversion of GFP expression in both Amp and Amp⫻GFP plants. However, in the Amp⫻GFP plants, GFP was expressed only in and around the vein. These observations suggest that the suppressor pro-tein expressed during infection with cr-TMV cannot suppress silencing completely in plants in which silencing is robust, as is the case in Amp⫻GFP plants.
To explore the molecular bases of the silencing suppression of p122, 35S-p122, and 35S-p122-His were coexpressed with 35S-GFP or/and 35S-GF-IR in N. benthamiana leaves. The well-characterized HC-Pro ofTobacco etch virus, which specif-ically binds to 21-nt siRNAs, and reovirus sigma 3, which exclusively binds to long dsRNA (28), were used as controls in the agroinfiltration assay (25). The transiently expressed p122 suppressed GFP silencing with the same efficiency as 35S-HC-Pro, based on the bright fluorescence in the coinfiltrated areas (Fig. 1F). The suppression of GFP silencing by p122 was also very effective in the presence of 35S-GF-IR expression (Fig. 1F). To confirm the visual observations, we also checked the GFP mRNA and GFP-specific siRNA accumulations. Total RNA samples were extracted from the infiltrated area 60 h after infiltration and analyzed by Northern blotting (Fig. 1G). In the presence of p122 or HC-Pro, the GFP mRNA accumu-lated to a high level, even when 35S-GF-IR was simultaneously coexpressed, while the level of GFP mRNA was strongly
re-duced when GFP was coexpressed with GF-IR or expressed alone in the absence of suppressors (Fig. 1G). An RNA band corresponding to the GF-IR transcript was observed only in the presence of sigma 3 protein, which inhibits DICER activity by dsRNA binding (25), but not in the presence of HC-Pro or p122 (Fig. 1G, top, compare lanes 5, 6, and 7 with 8), indicating that p122 does not interfere with DICER activity, similar to HC-Pro, which was demonstrated previously (25). As we ex-pected, GFP siRNA accumulated in the leaf infiltrated only with GFP (Fig. 1G, bottom, hybridized with GFP probe), while the presence of HC-Pro, p122, or sigma 3 protein abolished the accumulation of GFP siRNAs. In contrast, when GFP was coinfiltrated with GF-IR, a very large amount of GFP siRNA accumulated in either the presence or the absence of p122 and Hc-Pro (Fig. 1G, bottom, lanes 5, 6, and 7). The accumulation of siRNA was inhibited only in the presence of sigma 3, which compromises DICER activity (25). This result demonstrated that p122 inhibits the accumulation of siRNA when the RNA silencing is triggered by sense GFP transcript. However, p122 did not inhibit the processing of GF-IR dsRNA into siRNAs but interfered with the silencing machinery downstream of siRNA generation. We also tested the effect of p122 on the accumulation of RDR6-dependent secondary siRNAs (33). We have shown that p122 was able to inhibit the accumulation of secondary siRNAs detected by P-specific probe (Fig. 1G, compare lane 1 to lane 3). The inhibition of secondary siRNA (P-specific siRNA) accumulation by p122 was very efficient regardless of whether the GFP silencing was triggered by GFP alone or GFP plus GF-IR expression (Fig. 1G, compare lanes 1 to 3 and 5 to 7). It is worth noting that the majority of primary siRNAs were 24 nt long and only one-third of the siRNAs were 21/22 nt long when the silencing was triggered by GF-IR (Fig. 1G, middle, lanes 5, 6, and 7, GF-specific siRNAs). In contrast, the majority of secondary siRNAs (P specific) were 21/22 nt long, suggesting that they were the products of DCL4 and DCL2, respectively. We also analyzed the accumulation of virus-derived siRNA in cr-TMV-infected plants. Total RNA was extracted
fromN. benthamianaat 4 days p.i. and fromA. thalianaat 14 days
p.i. A large amount of viral siRNA accumulated in the virus-infected, but not in the mock-inoculated, plants (Fig. 1E), sug-gesting that p122 does not compromise the generation of siRNAs.
p122 inhibits siRNA-directed RNA cleavage and the assem-bly of silencing-related complexes in Drosophila embryo ex-tracts in a dose-dependent manner.The Drosophilaembryo extract-based RNA-silencing system has been used successfully to characterize silencing-suppressor proteins (25). This system allows the analysis of RNA-silencing complex formation and the cleavage activity of programmed RISC (42, 49). To better understand how the p122 silencing protein works, we tested the siRNA-programmed RISC activity in the presence of p122 protein. Repeated attempts to express p122 in bacteria were not successful; therefore, p122 was expressed in plants using a binary expression vector (32). We set up two sets of reactions for the RISC cleavage assay. In the direct-competition assay, the inducer siRNA, the labeled target RNA containing the sequence complementary to the inducer siRNA, the Drosoph-ilaembryo extract, and the p122-containing plant extract made from 35S-p122 agroinfiltratedN. benthamianaleaves at 3 days p.i. were added simultaneously. RISC activity was measured by quantifying the amount of 5⬘ cleavage product of the target
on November 8, 2019 by guest
http://jvi.asm.org/
RNA (75 nt) over a dilution series of the suppressor protein extract (Fig. 2, lanes 3 to 7). For the control reaction, we used empty-vector-infiltrated plant extract at the highest concentra-tion used for p122 (Fig. 2, lane 1) and we performed a reacconcentra-tion without embryo extract as a negative control (lane 2). p122 was able to inhibit the target cleavage (Fig. 2, lanes 3 to 5), likely preventing the assembly of RISC. To analyze the effect of p122 on preassembled-RISC activity (indirect competition), we pre-incubated theDrosophilaembryo extract with inducer siRNA for 20 min, and then the target and the suppressor-containing
[image:4.585.135.450.67.477.2]plant extract or mock-infiltrated plant extract were added (Fig. 2, lines 8 to 12). p122 proved to be a potent inhibitor of RISC cleavage at higher concentrations (50% inhibitory concentra-tion at 10-fold diluconcentra-tion) in the direct-competiconcentra-tion assay but had no effect on preassembled-RISC activity. The activity of pro-grammed RISC was refractory to the p122 suppressor protein regardless of the concentration. These results suggested that the siRNA sequestration model may also explain the mecha-nism of p122-mediated suppression, as was demonstrated for p19, HC-Pro, and p21 (10, 25, 46, 51, 62).
FIG. 1. Effects of cr-TMV infection and expression of the p122 silencing suppressor. (A and B) Infection ofA. thalianawith cr-TMV leads to a strong phenotype after 2 weeks (A) compared to uninfected plants (B). (C and D) Reversion of silenced GFP in cr-TMV-infected transgenic Amp⫻GFP (C) and Amp (D) plants at 14 days p.i. GFP fluorescence was assessed in the plants under UV light using a dissecting microscope, and the photographs were taken 14 days after inoculation. (E) Accumulation of virus-specific siRNAs during cr-TMV infection. Total RNA was extracted from cr-TMV-infectedN. bethamianaplants at 4 days p.i. andA. thalianaplants at 14 days p.i. and separated on denaturing agarose (for viral RNAs) and in 15% denaturing polyacrylamide gel (for siRNAs). (F) Suppression of RNA silencing by p122.N. benthamianaGFP16C leaves were agroinfiltrated with 35S-GFP, 35S-GF-IR, 35S-HcPro, and 35S-p122, as indicated. The GFP fluorescence was monitored under UV light, and the photographs were taken 3 days after agroinfiltration. (G) The p122 silencing suppressor inhibits GFP RNA degradation but does not impair primary siRNA production. Leaves of theN. benthamianaGFP16C line were infiltrated with 35S-GFP (lane 1); 35S-GFP and 35S-GF-IR (lane 2); 35S-GFP and HC-Pro (lane 3); 35S-GFP and p122 (lane 4); 35S-GFP, 35S-GF-IR, and HcPro (lane 5); 35S-GFP, 35S-GF-IR, and p122 (lane 6); and 35S-GFP, 35S-GF-IR, and sigma 3 (lane 7). The RNA samples extracted 60 h after infiltration were subjected to Northern analysis using appropriate probes to detect GFP mRNA and GF-IR RNA and GFP-, GF-, and P-specific siRNAs.
on November 8, 2019 by guest
http://jvi.asm.org/
RISC formation is impaired in vitro in the presence of p122 protein.To test our hypothesis, we analyzed the assembly of the RNA-silencing complexes with siRNAs by an electro-phoretic mobility shift assay developed by Pham et al. (42) and adapted for suppressor protein assays by Lakatos et al. (25). This technique is used to study the formation of the various stages of silencing complexes (siRNA-DCR2-R2D2, RISC loading complex, and RISC). In the direct-competition assay, we mixed inducer siRNA, Drosophila embryo extract, and p122-infiltrated plant extracts simultaneously (Fig. 3, lanes 5 to 10). In the indirect-competition assay, the embryo extract was preincubated with the labeled siRNA for 20 min and then p122-infiltrated plant extract was added at the same dilutions (Fig. 3, lanes 12 to 17). As control reactions, we incubated embryo extract with labeled siRNA (lane 2) or we added empty-vector-infiltrated plant extract at the highest concentration used for the direct and indirect competitions (lanes 11 and 18, respectively). In the direct-competition experiment, p122 was able to inhibit RISC assembly at up to a 1:16 dilution of plant extract, while in the indirect assay, p122 did not compromise the preassembled RISC in any dilutions. It is worth noting that a newly formed complex was observed running slightly above the siRNA-DCR2-R2D2 complex (Fig. 3, compare lane 3 with lanes 2 and 5). The accumulation of this complex gradually diminished as the concentration of p122 decreased. We hy-pothesized that this was probably a p122-siRNA complex con-taining some unidentified cellular factors. These results and the observation of p122-siRNA formation strongly suggested
that p122 was able to bind double-stranded siRNAs and inhib-ited RNA silencing via siRNA sequestration.
[image:5.585.330.509.67.216.2]p122 does not inhibit programmed siRISC and miRISC in vivo.The in vitro data showed that p122 could not interfere with preassembled-RISC activity but prevented new RISC complexes from being formed. To test the effect of p122 on the si/miRNA-programmed RISC in planta, we used GFP-based sensor systems developed previously (25, 37, 38).N. benthami-ana plants were infected with the p19 silencing suppressor mutant (Cym19stop) of Cymbidium ringspot virus (48). The recovered leaves of Cym19stop-infected plants developed 2 weeks after inoculation showed mild or no symptoms and con-tained RISCs that cleaved the CymRSV-specific sequences (37). These leaves were infiltrated with the GFP-Cym siRNA sensor construct, and as a negative control, we used a GFP-PoLV sensor, which expressed a GFP mRNA containing a PoLV sequence in the 3⬘untranslated region (37). This second GFP sensor was not expected to be silenced because there are no RISCs programmed against the PoLV sequence. Both GFP-Cym and GFP-PoLV were expressed at high levels after agroinfiltration into the leaves of uninfected plants (Fig. 4A, lanes 1 and 2). However, when recovered leaves of Cym19stop-infected plants were infiltrated, the GFP-Cym sensor mRNA was efficiently targeted by viral-siRNA-programmed RISC, re-ducing the levels of sensor RNA and GFP expression. On the other hand, the level of heterologous sensor Cym-PoLV re-mained high (Fig. 4A, lanes 3 and 4). The detection of a 5⬘ cleavage product of GFP-Cym further confirmed the activity of viral-siRNA-programmed RISC. As we expected from in vitro experiments, the coexpression of p122-His with the sensor GFP-Cym was not able to inhibit the cleavage of sensor RNA, similar to His-HC-Pro (Fig. 4A, lanes 5 to 8) and p19 (37).
FIG. 2. p122 protein inhibits siRNA-guided target cleavage. p122 inhibited target cleavage in vitro in the direct-competition assay (lanes 3 to 7) but did not interfere with preprogrammed RISC activity (indi-rect-competition assay, lanes 8 to 12). In the di(indi-rect-competition assay, Drosophilaembryo extract, target RNA (0.5 nM), labeled siRNA (5 nM), and either empty-vector-infiltrated (lane 1) or p122-infiltratedN. benthamianaplant extracts were used at different dilutions, and all components were added simultaneously. In the indirect-competition assay, siRNAs were incubated with theDrosophilaembryo extract for 20 min, and then target RNA and p122-infiltratedN. benthamiana plant extracts were added in different dilutions. The effect of p122 on RISC-mediated cleavage was monitored by the detection of cleavage products. Lane M shows RNA size markers; size is indicated in nucle-otides.
FIG. 3. In vitro RISC formation is inhibited by p122 protein. In the direct-competition (comp.) assay,Drosophilaembryo extract (extr.), labeled siRNA, and pBIN empty-vector-infiltrated (lane 11) or p122-infiltrated (lanes 5 to 10) plant extract dilutions were added at the same time. In the indirect-competition reactions, embryo extracts were preincubated with labeled siRNA prior to the addition of the pBIN-infiltrated (lane 18) or p122-pBIN-infiltrated (lanes 12 to 17) plant extracts. Control reactions were done with labeled siRNA only (lane 1), embryo extract and labeled siRNA (lane 2), and siRNA and pBIN-p122-infil-trated or empty-vector-infilpBIN-p122-infil-trated plant extract (lanes 3 and 4, respec-tively). The different forms of siRNA containing silencing-related com-plexes were separated in 3.9% native acrylamide gels. The positions of RISC, RISC loading complex (RLC), siRNA-DICER2-R2D2, and p122-siRNAs are indicated.
on November 8, 2019 by guest
http://jvi.asm.org/
To discover the effect of p122-His on miRNA-loaded RISC activity, a similar experiment was carried out using a cleavable sensor 171.1) and a noncleavable mutant sensor (GFP-171.2) construct (38). The GFP-171.1 and GFP-171.2 con-structs were infiltrated on the two sides of the same leaf to ensure the same level of miR-171-loaded RISC, and GFP fluorescence was monitored at 3 days p.i. Consistent with the previous results, the GFP mRNA and protein levels were re-duced in the GFP-171.1 sensor-infiltrated patch (Fig. 4B, lane 1) compared to the GFP-171.2 control (Fig. 4B, lane 2). This expression pattern was the same in the presence of p122 or the control HC-Pro (Fig. 4B, lanes 3 to 8). The expression of the His-HC-Pro and p122-His proteins was demonstrated by West-ern blot analysis. These results strengthen our in vitro findings and demonstrate that p122 is not able to inhibit preloaded si-or miRISC activity in vivo, as observed in the in vitro Drosoph-ilaembryo system.
p122 binds double-stranded siRNAs in a size-specific man-ner.To explore the affinity of p122 for siRNAs, we carried out a more detailed analysis of the RNA binding affinity of this protein. Electrophoretic mobility shift assays were performed using labeled synthetic single- or double-stranded RNA oligo-nucleotides in different sizes and diluted plant protein extract of 35S-p122-infiltratedN. benthamianaleaf. In these experi-ments, the well-characterized 35S-p19 ofCarnation Italian
ring-spot virus(25)-infiltratedN. benthamianaleaf extract was used
as a control (data not shown). p122 did not show any single-stranded RNA binding activity irrespective of the length of the RNA (data not shown). The relative dissociation constant (Kr) of p122 for double-stranded siRNA was in the same range as p19-infiltrated extract (not shown). p122 bound to 21-nt RNA duplexes with 2 nt of 3⬘overhang with the highest affinity (Fig.
[image:6.585.136.448.71.292.2]5A and C). The size and the 3⬘overhang of the siRNA proved to be important, because the binding affinity was slightly re-duced when 19-nt blunt (Kr/19) (Fig. 5A and C) or 21-nt blunt (Kr/21) (Fig. 5C) duplex RNAs were used (Kr/19⫽2 andKr/21⫽ 6; theKrof p122 for 21-nt-long siRNA is considered to be 1). The affinity for 24-nt siRNA species (Kr/24) (Fig. 5C) was much lower:Kr/24⫽ 20. p122 did not bind the other RNAs tested: 19-nt RNA with a 2-nt 3⬘ overhang; 26-nt RNA with a 2-nt 3⬘overhang; 49-nt duplex RNA (Fig. 5C); and 19-, 21-, and 49-nt single-stranded RNAs (data not shown). Since viral siRNAs are predominantly 21 to 22 nt long, these results sug-gest a specific adaptation of the virus to counteract the antivi-ral silencing machinery. To analyze the natuantivi-ral function of p122 during the course of virus infection, we tested the siRNA binding affinity of plant extract derived from wt cr-TMV-in-fected plants. Figure 5E shows that the plant extract from wt virus-infected plants had the same binding activity as tran-siently expressed p122: it bound 21-nt siRNAs but did not bind 49-nt siRNAs. The mobility of the p122-siRNA complex was the same as that of the wt virus protein-siRNA complex, suggesting that p122 is the only viral protein that binds siRNA and that the p178 viral replicase does not have siRNA binding activity. We were not able to directly test p178 for RNA binding because a 35S-p178-HA construct failed to express a detectable amount of p178-HA. However, indirect evidence suggesting that p178 did not bind siRNAs was obtained. We created a mutant cr-TMV in which the amber stop codon of p122 was replaced by a tyrosine codon. The mutant virus (cr-TMV-⌬122) was able to replicate, although at a lower rate than the wt (not shown), and the protein extract from cr-TMV-⌬122-infected plants did not show siRNA binding activity (Fig. 5F). This result suggests that the p178 read-through product of p122 does not have siRNA binding activity.
FIG. 4. p122 protein does not inhibit preassembled siRISC or miRISC activity in vivo. (A) GFP-Cym or GFP-PolV sensor constructs were infiltrated into Cym19stop-infected recovered leaves. GFP mRNA and protein were analyzed 3 days p.i. in Northern blot and Western immunoblot assays, respectively. (B) Preprogrammed miRISC activity is not affected by the presence of p122. The sensor construct GFP-171.1, bearing a perfect target site for miR171, is cleaved irrespective of the presence of the p122 protein. Noncleavable GFP-171.2 sensor, which bears a mutation in the target site, was used as a control. HC-Pro coinfiltration was also used as a control. For Western blot analysis, anti-GFP and anti-His antibodies were applied.
on November 8, 2019 by guest
http://jvi.asm.org/
p122 binds miRNA duplexes and interferes with miRNA accumulation and 3ⴕ-terminal methylation. It is becoming clear that not only do viruses suppress RNA silencing, but the virus-encoded silencing suppressors can also interfere with cel-lular functions that are controlled by plant small RNAs. This interference can contribute to viral symptoms, as suggested previously for P1/HC-Pro ofTurnip mosaic virus (23). How-ever, considering our findings that p122 has a specific affinity for bona fide 21-nt double-stranded siRNA only in a narrow size range, it could not be predicted whether p122 was able to inhibit miRNA pathways by binding double-stranded miRNA intermediates, since these miRNA-miRNA* duplexes contain
mismatches and bulges, which can modify the structure of miRNA duplexes compared to a perfectly matched siRNA duplex. To this end, we tested synthetic miR171a, miR171b, and miR171c RNA duplexes having slightly different predicted structures (47, 55, 58) and mi171 siRNA having a perfectly matched star strand in a p122 binding assay. We found that the binding affinities of p122 for the three miRNA-miRNA* (miR171a, miR171b, and miR171c) duplexes were in the same range (Kr ⫽ 1.1, 1.6, and 1.9, respectively) and only slightly reduced compared to the 171 siRNA perfect duplex (Kr⫽1) (Fig. 5B and D).
To explore the possible effect of p122 on miRNA pathways,
FIG. 5. Affinities of p122 protein for different RNA duplexes. Twenty-one-nucleotide bona fide siRNA and 19-nt blunt-ended RNA duplexes (A) or 21-nt siRNA and miR171 duplexes (B) were incubated with a dilution series of p122-infiltrated plant extracts and loaded on a 5% native 0.5⫻Tris-borate-EDTA gel. (C) Determination of relative binding affinities of p122 extract for different RNA molecules. (D) Relative affinities of p122 protein for miRNA duplexes miR171a, miR171b, and miR171c compared with siR171. (E) Binding affinities for 21-nt siRNA and for 49-nt dsRNA using pBIN-p122-infiltrated or cr-TMV-infected plant extract. The complexes formed ran at the same mobility. Control reactions are shown without protein extract or with empty-vector-infiltrated plant extract. (F) Plant extracts infected with mutant virus not coding for p122 do not show any binding.
on November 8, 2019 by guest
http://jvi.asm.org/
[image:7.585.81.508.68.506.2]A. thaliana Columbia-0 plants were infected with cr-TMV. After 14 days, we observed severe mottling of systemically infected leaves, and the edges of the leaves became serrated (Fig. 1A), similar to those of plants in which the miRNA pathways were compromised by mutation (36) or silencing-suppressor proteins were expressed (15). This observation sug-gested that p122 may also interfere with miRNA pathways. We hypothesized that if p122 could bind miRNA-miRNA* du-plexes in vivo, the accumulation of miRNA* would increase because the miRNA duplexes would be stabilized by p122 binding, similarly to the previously reported silencing suppres-sors, which bind miRNA duplexes (10, 25, 26). Indeed, upon cr-TMV infection, both mature and star strands of all tested endogenous miRNAs (miR160c, miR162a, miR171c, miR168a, and miR172) accumulated to a higher level than in the mock-infected control plants (Fig. 6A). These observations are in line with our in vitro findings and strengthen the idea that p122 can interfere with miRNA pathways by sequestering miRNA duplexes and stabilizing them. However, virus infection itself without silencing-suppressor protein can also increase the ac-cumulation of miRNAs (Burgyan, unpublished). Interestingly the accumulation of miR168 was particularly high in cr-TMV-infected plants. This result prompted us to analyze the expres-sion of AGO1, which is controlled by miR168, since it was recently reported that the expression of miR168 and its target, AGO1, are coregulated as a consequence of AGO1 homeosta-sis (52). Indeed, the expression of AGO1 in cr-TMV-infected plants was also elevated similarly to miR168, and the high level of AGO1 was neither influenced by the lack of methylation in
ahen1-1 plant (11) nor in anhst-15plant (59) in which the
miRNA nuclear export was affected (39) (Fig. 6B). It is worth noting that although miR162 (Fig. 6A), which regulates DCL1, accumulated at higher levels in virus-infected plants, we did not observe significant downregulation ofDCL1mRNA using quantitative RT-PCR analysis (data not shown). The finding that miR162* also accumulated at higher levels in virus-in-fected plants (Fig. 6A) suggests that p122 binds miR162/ miR162* duplexes and thus prevents the miR162-mediated downregulation of DCL1.
The effect of virus infection on the accumulation of tasiRNAs was particularly interesting, since tasiRNA biogenesis involves an initial miRNA-guided cleavage of the primary transcript of
trans-acting siRNAs (TAS) RNA transcript, which identifies
the starting point for RDR6-directed complementary-strand synthesis. Then, the double-stranded product of RDR6 is pro-cessed by DCL4 into mature tasiRNAs. These tasiRNAs guide RISCs to cleave mRNAs that have sequences complementary to tasiRNA (3, 53, 63). We expected that p122 expressed dur-ing virus infection might interfere with the biogenesis of tasiR-NAs, similarly to other silencing-suppressor proteins expressed transgenically (33). The miRNAs (miR173 for siR255 and miR390 for TAS3D7⫹) involved in tasiRNA biogenesis, simi-larly to the other tested miRNAs, accumulated at higher levels in cr-TMV-infected plants than in mock-inoculated, unin-fected plants (Fig. 6A). However, the accumulation of tasiRNAs (siR255 and TAS3D7⫹) regulated by these miRNAs was re-duced compared to mock-inoculated plants (Fig. 6A). These results indicate an inhibitory effect of p122 on tasiRNA bio-genesis.
We have also shown that p122 recognized the 3⬘2-nt
over-hangs of siRNA duplexes, predicting that p122 may interfere with 3⬘-end methylation of endogenous small RNAs and viral siRNAs. Plant short RNAs are likely methylated by HEN1 methyltransferase at their 3⬘-terminal nucleotides at the 2⬘ -hydroxyl group (7, 65). The methylation appears to protect them from oligouridilation and subsequent degradation (27), and it is present in all species of the small-RNA family (siRNA, miRNA, tasiRNA, and sense- and hairpin transgene-derived and transposon- and repeat-derived siRNAs). The methylation statuses of small RNAs can be assessed by treatment of the RNAs with sodium periodate, followed by-elimination. The free 2⬘-OH groups are sensitive to the chemical modification, which results in the elimination of the last nucleotide from the RNA. The resulting molecules migrate faster in gel electro-phoresis.
To test whether p122 is able to interfere with the methyl-ation of small RNAs, we checked the methylmethyl-ation statuses of several miRNAs, tasiRNAs, and viral siRNAs generated upon virus infection or in agroinfiltration transient assays. In virus-infectedA. thalianaleaf RNA extracts, the tested miRNAs and tasiRNAs showed a partial inhibition in the 3⬘-methylation level compared to mock-inoculated plants (Fig. 6A). All miRNAs tested were fully methylated in mock-inoculated plants, while miRNAs, both mature and star strands, derived from cr-TMV-infected plants were partially nonmethylated, which was indicated the by the faster migration of miRNAs that underwent -elimination (Fig. 6A). Interestingly, the methylation of miR160c, miR171c, and miR168a* was only slightly affected in the presence of cr-TMV. Moreover, the mature strands, as well as the star strands, of mir172a migrated in three different size classes in virus-infected plants in contrast to mock-inoculated plants, in which only the 21-nt miR172a accumulated. The appearance of the 22- and 23-nt species was not DCL2 or DCL3 dependent (data not shown). Similarly to miR172a, the 22- and 23-nt-long species of miR168a, miR159a, miR160c, miR162a, and miR171c or shorter forms of miR171c were also observed (data not shown). The partial inhibition of miRNA and viral-siRNA methylation in the virus-infected plants was somewhat surprising, since HEN1 has been sug-gested to be localized in the nucleus while cr-TMV replicates exclusively in the cytoplasm (20). Furthermore, we can rule out the existence of other, unidentified methylases that may oper-ate in the cytoplasm, since none of the miRNAs or siRNAs were methylated in the inhen1-1plants. These findings sug-gested that HEN1 is active either in the nucleus or in the cytoplasm. Moreover, the ability of virus to interfere with miRNA methylation may suggest that miRNAs exported from the nucleus to the cytoplasm are in both methylated and non-methylated forms. To better understand the effect of virus infection on the methylation of miRNAs and siRNAs,hst-15
plants, in which miRNA nuclear export is affected (39), were also infected with cr-TMV. The virus infection resulted in elevated accumulation of all tested miRNAs, including both mature and star strands. More importantly, these miRNAs were completely methylated, suggesting that the virus infection could not inhibit the methylation of miRNAs (Fig. 6A). This finding could be a consequence of the fact that the nuclear export of miRNAs to the cytoplasm is compromised. In con-trast to miRNAs, the methylation of virus siRNAs was partially inhibited, similarly to the wt, suggesting that the inactivated
on November 8, 2019 by guest
http://jvi.asm.org/
HST has no role in virus siRNA biogenesis. The methylation status of tasiRNA (siR255) was similar to those of miRNAs in wt plants. siR255 was fully methylated in the mock-inoculated plants and partially methylated in the virus-infected plants (we were not able to analyze TAS3D7⫹RNA because it accumu-lated at a very low level in virus-infected plants). However, siR255 behaved differently in virus-infected hst-15 plants, in which siR255 methylation was partially inhibited, suggesting that siR255 duplexes were available for p122, since they were generated in the cytoplasm, similarly to viral siRNAs. These results further support HEN1 activity in the cytoplasm.
[image:9.585.44.273.71.712.2]We have shown that p122 efficiently binds double-stranded siRNAs and miRNA intermediates, which strongly suggests that the small-RNA binding activity of p122 is responsible for the inhibition of small-RNA methylation. To further sup-port our hypothesis, p122 was coexpressed with 35S–pri-miRNA171c hairpin (which generates 35S–pri-miRNA171c duplexes) using agroinfiltration. As a control, 35S–pri-miRNA171c was also coinfiltrated with 35S-HC-Pro or empty vector. When 35S–pri-miRNA171c was coinfiltrated with the empty vector, the generated miR171c mature and miR171c* RNAs were resistant to the-elimination treatment. It is worth noting that the amount of miRNA in the infiltrated patch was in high excess compared to the natural miRNA levels, but even in this case, the methylation was 100% (Fig. 7A, lanes 3 and 4), suggesting that this step in miRNA biogenesis is very efficient. Importantly, the-elimination reaction was complete, as dem-onstrated by the synthetic oligonucleotide controls (Fig. 7A, lanes 9 to 12). The coexpressed p122 partially inhibited miR171c methylation (Fig. 7A, lanes 7 and 8), similarly to virus-infected plants (Fig. 6) and to HC-Pro (Fig. 7, lanes 5 and 6). Interestingly, the miR171c* strand was fully methylated in p122-infiltrated plants, suggesting that one of the two termini of miR171c-miR171c* is not protected by p122 and is accessi-ble for HEN1-mediated methylation (Fig. 7A, lanes 7 and 8). We also tested the effects of p122 on transgene-derived siRNAs and found that p122 was able to interfere most with the methylation of 21-nt-long species, affected only very slightly the methylation of 22-nt siRNA, and did not interfere with the methylation of 24-nt siRNA (Fig. 7B, lane 6). Our finding that p122 binds 24-nt siRNAs with much lower effi-ciency than 21-nt siRNA could explain why p122 did not block the methylation of 24-nt siRNAs.
FIG. 6. Accumulation and 3⬘-terminal methylation of miRNAs and siRNAs upon cr-TMV infection. (A) Elevated accumulation of the different miRNAs and miRNA*s have been observed in cr-TMV-infected plants. Total RNAs were extracted from cr-TMV-cr-TMV-infected or uninfected wt or mutantA. thalianaplants as indicated. For hybrid-ization, labeled locked nucleic acid oligonucleotides complementary to the indicated miRNA and miRNA* were used. For virus-derived siRNAs and for U6 as a loading control, labeled complementary tran-scripts were applied as probes. For the identification of the methylation statuses of miRNAs and siRNAs, total RNAs from infected and unin-fected plants were subjected (⫹) or not (⫺) to the -elimination reactions. (B) Northern analysis of AGO1 mRNA from mock- and virus-infectedA. thalianawt and mutant plants. Mouse total RNA was used as a control.
on November 8, 2019 by guest
http://jvi.asm.org/
DISCUSSION
The p122 protein of cr-TMV is a homologue of the previ-ously reported p126 protein of TMV, which is the subunit of the viral replicase complex (20). p126 forms a complex with the p183 protein, the read-through product of p126, at a one-to-one ratio (56). However, it was also shown that p126 is ex-pressed in approximately 10 times molar excess to p183, sug-gesting that the p126 protein has other important functions in the virus life cycle (56).
Indeed, our finding demonstrated that the p122 protein of cr-TMV (the protein corresponding to p126) also functions as a silencing-suppressor protein, apart from its function in virus replication. The combination of replicase and silencing-sup-pression functions in the same protein is likely to be
advanta-geous for the virus, since the replicating RNA is probably the form of the viral genome most exposed to silencing-mediated RNA degradation.
In this work, we presented an extensive characterization of the silencing function of the cr-TMV p122 protein.
The p122 protein of cr-TMV efficiently suppresses RNA si-lencing by siRNA sequestration.The analysis of the effect of the p122 silencing suppressor in agroinfiltration assays indi-cated that p122 inhibits RNA silencing triggered by both sense RNAs and dsRNAs. We propose that the molecular basis of inhibition in both cases relies on the ability of p122 to seques-ter siRNA duplexes. Indeed, when GFP RNA was coexpressed with GF-IR and p122, Dicer activity was clearly not inhibited, although p122 efficiently blocked GFP RNA targeting, proba-bly by inhibiting siRNA incorporation in RISCs via siRNA binding. Moreover, we also showed in this experiment that p122 inhibited the accumulation of secondary siRNAs (Fig. 1G, P-specific siRNAs), which requires the action of RDR6 (33). We also suggest that p122 inhibits the action of RDR6 in the case of GFP sense RNA silencing by binding the minute amount of primary siRNA, which is essential for RDR6-me-diated amplification of RNA silencing through the production of secondary siRNAs. In agreement with our observation, it was shown very recently that several silencing-suppressor pro-teins expressed transgenically inhibited RDR6-dependent steps in the RNA-silencing pathways (33). In line with our siRNA sequestration model, we also showed that p122 inhib-ited RNA silencing in a quantitative manner, which can explain our observation that the silencing of GFP expression in Amp plants was complete, while in Amp⫻GFP plants it was only partially suppressed. In the case of Amp⫻GFP, the silencing is much more robust and generates a much higher level of GFP-specific siRNAs (12), and it is very likely that the large amount of siRNA cannot be sequestered completely by p122. This may suggest that in the veins of Amp⫻GFP plants, the level of GFP siRNAs is lower (as low as in Amp plants) than in the interveinal tissue.
[image:10.585.44.282.69.392.2]Our in vivo and in vitro studies further demonstrated that p122 acts upstream of the RISC-programming step, since the loaded siRISC and miRISC cannot be inhibited by the pres-ence of the p122 protein. This feature resembles the ToMV suppressor p130, which has been suggested to suppress GFP silencing but cannot interfere with the preprogrammed RNA-silencing machinery (24). Indeed, our results demonstrated that the molecular basis of silencing suppression by p122 is the sequestration of siRNAs, thus preventing the assembly of siRNA-containing effector complexes in the antiviral silencing response. We have shown that p122 selects for bona fide siRNA for binding, similarly to p19 of tombusviruses and HC-Pro ofTobacco etch virus(25, 32). This finding further supports the model of siRNA-RISC-mediated targeting of viral RNA (37, 66), in contrast to the theoretical possibility that Dicer activity alone could control efficient viral invasion. Since p122 is part of the replicase complex, it is interesting that p122 does not bind 49-nt-long double-stranded or single-stranded RNA molecules, although it is possible that in the replicase complex p122 has different RNA binding activity or that another com-ponent of the viral replicase complex binds the replicating long viral RNAs.
FIG. 7. Effect of p122 protein on the methylation of GFP-derived siRNA and overexpressed miRNA 171c. Total RNA extracts were subjected (⫹) or not (⫺) to-elimination reactions, and the blots were hybridized as for Fig. 6. (A) GFP-IR-derived siRNAs are fully meth-ylated in the absence of suppressor proteins. HC-Pro completely in-hibited the methylation of 21-nt-long siRNAs and partially inin-hibited the methylation of 22-nt siRNAs (lane 6). p122 protein partially inter-fered with the methylation of 21- and 22-nt-long siRNA species (lane 8). Neither suppressor blocked the methylation of 24-nt siRNA mol-ecules (lanes 6 and 8). Nonmethylated synthetic RNA oligonucleotides were used as positive controls for-elimination reactions (lanes 9 and 10). (B) Overexpressed miR171c and miR171c*are fully methylated in the absence of silencing suppressors (line 4). HC-Pro and p122 pro-teins partially inhibited the methylation of miR171c (lanes 6 and 8) but not that of miR171c*. Positive controls for the-elimination test are shown in lanes 10 and 12.
on November 8, 2019 by guest
http://jvi.asm.org/
cr-TMV infection enhances the accumulation of miRNAs and downregulates tasiRNAs. p122 efficiently binds double-stranded miRNA intermediates in vitro, and the simultaneous accumulation of miRNA-miRNA* in cr-TMV-infected plants suggests that p122 also binds miRNA duplexes in planta. The symptoms of cr-TMV-infected plants may indicate that the miRNA pathways are compromised. The in vitro band shift assay demonstrated that the miRNA mismatches did not sig-nificantly alter the binding affinity of the p122 protein for miRNA duplexes, which is in line with the finding that the accumulation of tested miRNAs and miRNA*s was increased in virus-infected plants. It is not clear whether this is due to stabilization of the miRNA duplexes in the miRNA-p122 com-plex or whether the large amounts of viral siRNAs alter the synthesis-degradation equilibrium of miRNA biogenesis. The miRNAs are produced by the DCL1 protein, which is regu-lated through a feedback loop by miR162 RNA (61). An ele-vated level ofDCL1mRNA was detected indcl1andhen1-1
mutant plants and in plants expressing a viral suppressor, TuMV P1/HC-Pro, which inhibits miRNA-guided degradation
of DCL1 mRNA (61). In cr-TMV-infected leaves, both
miR162a and miR162a*, similarly to other miRNA-miRNA* pairs, accumulated at a higher level. Their methylation was partially blocked, suggesting that p122 binds miR162a-miR162a* duplexes in vivo, which can lead to stabilization and thus the increased accumulation of these miRNAs. Alterna-tively or additionally, the elevated level of miRNAs might also be the consequence of enhanced DCL1 enzyme activity upon viral infection and not simply the result of p122 expression. However, p122 may mask the effect of enhanced miRNA levels by sequestering many of the miRNA duplexes, including miR162, thus blocking the downregulation ofDCL1mRNA.
Mir168a and its corresponding target, AGO1, accumulated at particularly high levels during the development of virus infection, suggesting that AGO1 homeostasis (52) keeps the balance between miR168 and AGO1 expression.
In contrast to the enhanced accumulation of miRNAs, the accumulation of the tested tasiRNAs was reduced in cr-TMV-infected plants. Although the levels of miRNAs, including miR173 and miR390, were higher in virus-infected plants, their biological activities were likely inhibited by p122 sequestration, as suggested by the low level of tasiRNA accumulation, which requires the cleavage of TAS1 and TAS3 RNAs mediated by miR173 and miR390, respectively. In addition to inhibition of miR173 and miR390 actions, p122 may interfere with tasiRNA biogenesis at an additional stage. Indeed, we showed that the tested tasiRNAs were only partially methylated in cr-TMV-infected plants, demonstrating that the virus infection inter-feres with tasiRNA-mediated pathways at different steps. Our findings are in line with recent observations that tasiRNAs (siR255) are downregulated and partially unmethylated in plants infected by another tobamovirus,Oilseed rape mosaic
virus(6).
p122 inhibits the 3ⴕmethylation of small RNAs. Previous results demonstrated that transgenically expressed silencing-suppressor proteins, which are able to bind siRNAs, inhibit 3⬘-terminal methylation (64). In addition, inhibition of HEN1-mediated methylation of small RNAs has been observed in
Oilseed rape mosaic virus-infectedArabidopsisplants (1, 6).
We have shown in this study that the methylation of viral
siRNAs, transgene-derived siRNAs, and miRNAs is inhibited by p122, likely through the binding of miRNA-siRNA du-plexes. Our results also demonstrated that HEN1 operates in both the nucleus and cytoplasm, since cr-TMV, like many other positive-strand RNA viruses, replicates in the cytoplasm and the virus-derived siRNAs were partially methylated (Fig. 6). Importantly, we can exclude the activity of another, uniden-tified methylase that may operate in the cytoplasm, since all miRNAs and siRNAs were not methylated inhen1-1 plants. The ability of the replicating virus to interfere with miRNA methylation suggests that miRNAs are exported from the nu-cleus to the cytoplasm in both methylated and nonmethylated forms. The infection ofhst-15plants, in which miRNA nuclear export might be compromised, resulted in the elevated accu-mulation of all tested miRNAs, and these miRNAs were com-pletely methylated. This demonstrated that the virus infection could not inhibit the methylation of miRNAs, likely because they were separated in different compartments, while the methylation of virus siRNAs was partially inhibited (as in wt plants), since they accumulated in the same compartment where the virus replicated. Indeed, the activity of HEN1 in the cytoplasm was supported by a recent report, which demon-strated that HEN1 is present in both the nucleus and the cytoplasm (16).
Another puzzling result was the asymmetrical methylation of the miRNAs upon virus infection. In some cases, the mature strand was protected by the methyl group and the star strand was not (miR159-mir159*) (not shown), while in other cases we observed the opposite situation, in which miR171c methyl-ation was partially blocked but that of miR171* was not (Fig. 7). The asymmetrical methylation could be a consequence of two-step kinetics of the HEN1 enzyme. In this scenario, the suppressor binds the miRNA after the first step, in which one of the strands is methylated. It is also possible that the p122-miRNA complex is not symmetrical, and therefore, HEN1 and/or p122 recognizes the ends of miRNA duplexes asym-metrically. The difference in the suppression of the methyl-ation of different species could be due to a spatial and tempo-ral compartmentalization of the different miRNAs and the p122 protein.
We also observed that the transgene-derived 21-nt siRNAs were sensitive to the-elimination reaction in the p122-infil-trated tissue, indicating that they were not methylated, while the 24-nt siRNAs were fully methylated. These results are likely the consequence of the preferential binding of 21-nt siRNAs versus 24-nt siRNAs by the p122 suppressor protein, further supporting our finding that p122 binds siRNA duplexes in a size-specific manner.
In conclusion, the multifunctional p122 protein of cr-TMV is a very potent silencing-suppressor protein that blocks the in-termediate steps of antiviral and endogenous silencing path-ways, preventing the assembly of DCL enzyme-generated si/ miRNA duplexes into effector molecules, such as RDR6, HEN1, and RISC.
ACKNOWLEDGMENTS
We are grateful to Olivier Voinnet for providing the miR171.1 and miR171.2 sensor constructs. We thank David Baulcombe for the seeds of 16C plants. We also thank Gyo¨rgy Szittya for critical reading and Lora´nt Lakatos for valuable advice during the work.
on November 8, 2019 by guest
http://jvi.asm.org/
T.C. was the recipient of a grant from the Ministry of Education and Culture for Hungarians Abroad (A/3-2004008). J.B. and T.D. received an International Joint Project grant (2006/3) from the Royal Society and Hungarian Academy of Science. This research was supported by grants from the Hungarian Scientific Research Fund (OTKA T046728 and OTKA NK60352) and the SIROCCO EU project LSHG-CT-2006-037900.
REFERENCES
1.Akbergenov, R., A. Si-Ammour, T. Blevins, I. Amin, C. Kutter, H. Vander-schuren, P. Zhang, W. Gruissem, F. Meins, Jr., T. Hohn, and M. M. Pooggin.
2006. Molecular characterization of geminivirus-derived small RNAs in dif-ferent plant species. Nucleic Acids Res.34:462–471.
2.Alefelder, S., B. K. Patel, and F. Eckstein.1998. Incorporation of terminal phosphorothioates into oligonucleotides. Nucleic Acids Res.26:4983–4988. 3.Allen, E., Z. Xie, A. M. Gustafson, and J. C. Carrington.2005. MicroRNA-directed phasing during trans-acting siRNA biogenesis in plants. Cell121:
207–221.
4.Baulcombe, D.2004. RNA silencing in plants. Nature431:356–363. 5.Baumberger, N., and D. C. Baulcombe.2005. Arabidopsis ARGONAUTE1
is an RNA Slicer that selectively recruits microRNAs and short interfering RNAs. Proc. Natl. Acad. Sci. USA102:11928–11933.
6.Blevins, T., R. Rajeswaran, P. V. Shivaprasad, D. Beknazariants, A. Si-Ammour, H. S. Park, F. Vazquez, D. Robertson, F. Meins, Jr., T. Hohn, and M. M. Pooggin.2006. Four plant Dicers mediate viral small RNA biogenesis and DNA virus induced silencing. Nucleic Acids Res.34:6233–6246. 7.Boutet, S., F. Vazquez, J. Liu, C. Beclin, M. Fagard, A. Gratias, J. B. Morel,
P. Crete, X. Chen, and H. Vaucheret.2003. Arabidopsis HEN1. A genetic link between endogenous miRNA controlling development and siRNA con-trolling transgene silencing and virus resistance. Curr. Biol.13:843–848. 8.Brodersen, P., and O. Voinnet.2006. The diversity of RNA silencing
path-ways in plants. Trends Genet.22:268–280.
9.Chao, J. A., J. H. Lee, B. R. Chapados, E. W. Debler, A. Schneemann, and J. R. Williamson.2005. Dual modes of RNA-silencing suppression by Flock House virus protein B2. Nat. Struct. Mol. Biol.12:952–957.
10.Chapman, E. J., A. I. Prokhnevsky, K. Gopinath, V. V. Dolja, and J. C. Carrington.2004. Viral RNA silencing suppressors inhibit the microRNA pathway at an intermediate step. Genes Dev.18:1179–1186.
11.Chen, X.2005. MicroRNA biogenesis and function in plants. FEBS Lett.
579:5923–5931.
12.Dalmay, T., A. Hamilton, E. Mueller, and D. C. Baulcombe.2000. Potato virus X amplicons in arabidopsis mediate genetic and epigenetic gene silenc-ing. Plant Cell12:369–379.
13.Dalmay, T., L. Rubino, J. Burgyan, A. Kollar, and M. Russo.1993. Func-tional analysis of cymbidium ringspot virus genome. Virology194:697–704. 14.Dorokhov, Y. L., P. A. Ivanov, V. K. Novikov, A. A. Agranovsky, S. Morozov, V. A. Efimov, R. Casper, and J. G. Atabekov.1994. Complete nucleotide sequence and genome organization of a tobamovirus infecting cruciferae plants. FEBS Lett.350:5–8.
15.Dunoyer, P., C. H. Lecellier, E. A. Parizotto, C. Himber, and O. Voinnet.
2004. Probing the microRNA and small interfering RNA pathways with virus-encoded suppressors of RNA silencing. Plant Cell16:1235–1250. 16.Fang, Y., and D. L. Spector.2007. Identification of nuclear Dicing bodies
containing proteins for microRNA biogenesis in livingArabidopsisplants. Curr. Biol.17:818–823.
17.Goregaoker, S. P., D. J. Lewandowski, and J. N. Culver.2001. Identification and functional analysis of an interaction between domains of the 126/183-kDa replicase-associated proteins of tobacco mosaic virus. Virology282:320– 328.
18.Haley, B., G. Tang, and P. D. Zamore. 2003. In vitro analysis of RNA interference inDrosophila melanogaster. Methods30:330–336.
19.Herr, A. J., M. B. Jensen, T. Dalmay, and D. C. Baulcombe.2005. RNA polymerase IV directs silencing of endogenous DNA. Science308:118–120. 20.Hull, R.2002. Matthews’ plant virology, 4th ed. Academic Press, San
Diego, CA.
21.Ishikawa, M., T. Meshi, F. Motoyoshi, N. Takamatsu, and Y. Okada.1986. In vitro mutagenesis of the putative replicase genes of tobacco mosaic virus. Nucleic Acids Res.14:8291–8305.
22.Kanno, T., B. Huettel, M. F. Mette, W. Aufsatz, E. Jaligot, L. Daxinger, D. P. Kreil, M. Matzke, and A. J. Matzke.2005. Atypical RNA polymerase sub-units required for RNA-directed DNA methylation. Nat. Genet.37:761–765. 23.Kasschau, K. D., Z. Xie, E. Allen, C. Llave, E. J. Chapman, K. A. Krizan, and J. C. Carrington.2003. P1/HC-Pro, a viral suppressor of RNA silencing, interferes withArabidopsisdevelopment and miRNA function. Dev. Cell
4:205–217.
24.Kubota, K., S. Tsuda, A. Tamai, and T. Meshi.2003. Tomato mosaic virus replication protein suppresses virus-targeted posttranscriptional gene silenc-ing. J. Virol.77:11016–11026.
25.Lakatos, L., T. Csorba, V. Pantaleo, E. J. Chapman, J. C. Carrington, Y. P. Liu, V. V. Dolja, L. F. Calvino, J. J. Lopez-Moya, and J. Burgyan.2006. Small
RNA binding is a common strategy to suppress RNA silencing by several viral suppressors. EMBO J.25:2768–2780.
26.Lakatos, L., G. Szittya, D. Silhavy, and J. Burgyan.2004. Molecular mech-anism of RNA silencing suppression mediated by p19 protein of tombusvi-ruses. EMBO J.23:876–884.
27.Li, J., Z. Yang, B. Yu, J. Liu, and X. Chen.2005. Methylation protects miRNAs and siRNAs from a 3⬘-end uridylation activity inArabidopsis. Curr. Biol.15:1501–1507.
28.Lichner, Z., D. Silhavy, and J. Burgyan.2003. Double-stranded RNA-bind-ing proteins could suppress RNA interference-mediated antiviral defences. J. Gen. Virol.84:975–980.
29.Lippman, Z., and R. Martienssen.2004. The role of RNA interference in heterochromatic silencing. Nature431:364–370.
30.Mallory, A. C., and H. Vaucheret.2006. Functions of microRNAs and re-lated small RNAs in plants. Nat. Genet.38(Suppl.):S31–S36.
31.Matranga, C., Y. Tomari, C. Shin, D. P. Bartel, and P. D. Zamore.2005. Passenger-strand cleavage facilitates assembly of siRNA into Ago2-contain-ing RNAi enzyme complexes. Cell123:607–620.
32.Merai, Z., Z. Kerenyi, S. Kertesz, M. Magna, L. Lakatos, and D. Silhavy.
2006. Double-stranded RNA binding may be a general plant RNA viral strategy to suppress RNA silencing. J. Virol.80:5747–5756.
33.Moissiard, G., E. A. Parizotto, C. Himber, and O. Voinnet.2007. Transitivity inArabidopsiscan be primed, requires the redundant action of the antiviral Dicer-like 4 and Dicer-like 2, and is compromised by viral-encoded suppres-sor proteins. RNA13:1268–1278.
34.Molnar, A., T. Csorba, L. Lakatos, E. Varallyay, C. Lacomme, and J. Burgyan.2005. Plant virus-derived small interfering RNAs originate pre-dominantly from highly structured single-stranded viral RNAs. J. Virol.
79:7812–7818.
35.Onodera, Y., J. R. Haag, T. Ream, P. C. Nunes, O. Pontes, and C. S. Pikaard.
2005. Plant nuclear RNA polymerase IV mediates siRNA and DNA meth-ylation-dependent heterochromatin formation. Cell120:613–622. 36.Palatnik, J. F., E. Allen, X. Wu, C. Schommer, R. Schwab, J. C. Carrington,
and D. Weigel.2003. Control of leaf morphogenesis by microRNAs. Nature
425:257–263.
37.Pantaleo, V., G. Szittya, and J. Burgyan.2007. Molecular bases of viral RNA targeting by viral small interfering RNA-programmed RISC. J. Virol.81:
3797–3806.
38.Parizotto, E. A., P. Dunoyer, N. Rahm, C. Himber, and O. Voinnet.2004. In vivo investigation of the transcription, processing, endonucleolytic activity, and functional relevance of the spatial distribution of a plant miRNA. Genes Dev.18:2237–2242.
39.Park, M. Y., G. Wu, A. Gonzalez-Sulser, H. Vaucheret, and R. S. Poethig.
2005. Nuclear processing and export of microRNAs inArabidopsis. Proc. Natl. Acad. Sci. USA102:3691–3696.
40.Pazhouhandeh, M., M. Dieterle, K. Marrocco, E. Lechner, B. Berry, V. Brault, O. Hemmer, T. Kretsch, K. E. Richards, P. Genschik, and V. Ziegler-Graff.2006. F-box-like domain in the polerovirus protein P0 is required for silencing suppressor function. Proc. Natl. Acad. Sci. USA103:1994–1999. 41.Pfeffer, S., P. Dunoyer, F. Heim, K. E. Richards, G. Jonard, and V.
Ziegler-Graff.2002. P0 of beet Western yellows virus is a suppressor of posttran-scriptional gene silencing. J. Virol.76:6815–6824.
42.Pham, J. W., J. L. Pellino, Y. S. Lee, R. W. Carthew, and E. J. Sontheimer.
2004. A Dicer-2-dependent 80s complex cleaves targeted mRNAs during RNAi inDrosophila. Cell117:83–94.
43.Qi, Y., A. M. Denli, and G. J. Hannon.2005. Biochemical specialization withinArabidopsisRNA silencing pathways. Mol. Cell19:421–428. 44.Schwarz, D. S., G. Hutvagner, T. Du, Z. Xu, N. Aronin, and P. D. Zamore.
2003. Asymmetry in the assembly of the RNAi enzyme complex. Cell115:
199–208.
45.Silhavy, D., and J. Burgyan.2004. Effects and side-effects of viral RNA silencing suppressors on short RNAs. Trends Plant Sci.9:76–83. 46.Silhavy, D., A. Molnar, A. Lucioli, G. Szittya, C. Hornyik, M. Tavazza, and
J. Burgyan.2002. A viral protein suppresses RNA silencing and binds si-lencing-generated, 21- to 25-nucleotide double-stranded RNAs. EMBO J.
21:3070–3080.
47.Sunkar, R., and J. K. Zhu.2004. Novel and stress-regulated microRNAs and other small RNAs fromArabidopsis. Plant Cell16:2001–2019.
48.Szittya, G., A. Molnar, D. Silhavy, C. Hornyik, and J. Burgyan.2002. Short defective interfering RNAs of tombusviruses are not targeted but trigger post-transcriptional gene silencing against their helper virus. Plant Cell14:
359–372.
49.Tomari, Y., T. Du, B. Haley, D. S. Schwarz, R. Bennett, H. A. Cook, B. S. Koppetsch, W. E. Theurkauf, and P. D. Zamore. 2004. RISC assembly defects in theDrosophilaRNAi mutant armitage. Cell116:831–841. 50.Tomari, Y., and P. D. Zamore.2005. Perspective: machines for RNAi. Genes
Dev.19:517–529.
51.Vargason, J., G. Szittya, J. Burgyan, and T. M. Hall.2003. Size selective recognition of siRNA by an RNA silencing suppressor. Cell115:799–811. 52.Vaucheret, H., A. C. Mallory, and D. P. Bartel.2006. AGO1 homeostasis
entails coexpression of MIR168 and AGO1 and preferential stabilization of miR168 by AGO1. Mol. Cell22:129–136.
on November 8, 2019 by guest
http://jvi.asm.org/
53.Vazquez, F., H. Vaucheret, R. Rajagopalan, C. Lepers, V. Gasciolli, A. C. Mallory, J. L. Hilbert, D. P. Bartel, and P. Crete.2004. Endogenoustrans -acting siRNAs regulate the accumulation ofArabidopsismRNAs. Mol. Cell
16:69–79.
54.Voinnet, O.2005. Induction and suppression of RNA silencing: insights from viral infections. Nat. Rev. Genet.6:206–220.
55.Wang, X. J., J. L. Reyes, N. H. Chua, and T. Gaasterland.2004. Prediction and identification ofArabidopsis thalianamicroRNAs and their mRNA tar-gets. Genome Biol.5:R65.
56.Watanabe, T., A. Honda, A. Iwata, S. Ueda, T. Hibi, and A. Ishihama.1999. Isolation from tobacco mosaic virus-infected tobacco of a solubilized tem-plate-specific RNA-dependent RNA polymerase containing a 126K/183K protein heterodimer. J. Virol.73:2633–2640.
57.Wesley, S. V., C. A. Helliwell, N. A. Smith, M. B. Wang, D. T. Rouse, Q. Liu, P. S. Gooding, S. P. Singh, D. Abbott, P. A. Stoutjesdijk, S. P. Robinson, A. P. Gleave, A. G. Green, and P. M. Waterhouse.2001. Construct design for efficient, effective and high-throughput gene silencing in plants. Plant J.
27:581–590.
58.Xie, Z., E. Allen, N. Fahlgren, A. Calamar, S. A. Givan, and J. C. Carrington.
2005. Expression ofArabidopsisMIRNA genes. Plant Physiol.138:2145– 2154.
59.Xie, Z., E. Allen, A. Wilken, and J. C. Carrington.2005. DICER-LIKE 4 functions intrans-acting small interfering RNA biogenesis and vegetative phase change inArabidopsis thaliana. Proc. Natl. Acad. Sci. USA102:12984– 12989.
60.Xie, Z., L. K. Johansen, A. M. Gustafson, K. D. Kasschau, A. D. Lellis, D. Zilberman, S. E. Jacobsen, and J. C. Carrington.2004. Genetic and func-tional diversification of small RNA pathways in plants. PLoS Biol.2:e104. 61.Xie, Z., K. D. Kasschau, and J. C. Carrington.2003. Negative feedback
regulation of Dicer-Like1 inArabidopsisby microRNA-guided mRNA deg-radation. Curr. Biol.13:784–789.
62.Ye, K., L. Malinina, and D. J. Patel.2003. Recognition of small interfering RNA by a viral suppressor of RNA silencing. Nature3:3.
63.Yoshikawa, M., A. Peragine, M. Y. Park, and R. S. Poethig.2005. A pathway for the biogenesis oftrans-acting siRNAs inArabidopsis. Genes Dev.19:
2164–2175.
64.Yu, B., E. J. Chapman, Z. Yang, J. C. Carrington, and X. Chen.2006. Transgenically expressed viral RNA silencing suppressors interfere with microRNA methylation inArabidopsis. FEBS Lett.580:3117–3120. 65.Yu, B., Z. Yang, J. Li, S. Minakhina, M. Yang, R. W. Padgett, R. Steward,
and X. Chen.2005. Methylation as a crucial step in plant microRNA bio-genesis. Science307:932–935.
66.Zhang, X., Y. R. Yuan, Y. Pei, S. S. Lin, T. Tuschl, D. J. Patel, and N. H. Chua.2006. Cucumber mosaic virus-encoded 2b suppressor inhibits Arabi-dopsisArgonaute1 cleavage activity to counter plant defense. Genes Dev.
20:3255–3268.
67.Zilberman, D., X. Cao, and S. E. Jacobsen.2003. ARGONAUTE4 control of locus-specific siRNA accumulation and DNA and histone methylation. Sci-ence299:716–719.