• No results found

Nucleotide Sequence Requirements at the 5′ End of the Influenza A Virus M RNA Segment for Efficient Virus Replication

N/A
N/A
Protected

Academic year: 2019

Share "Nucleotide Sequence Requirements at the 5′ End of the Influenza A Virus M RNA Segment for Efficient Virus Replication"

Copied!
5
0
0

Loading.... (view fulltext now)

Full text

(1)

0022-538X/09/$08.00⫹0 doi:10.1128/JVI.02513-08

Copyright © 2009, American Society for Microbiology. All Rights Reserved.

Nucleotide Sequence Requirements at the 5

End of the Influenza A

Virus M RNA Segment for Efficient Virus Replication

Makoto Ozawa,

1,2

Junko Maeda,

3

Kiyoko Iwatsuki-Horimoto,

1

Shinji Watanabe,

2

Hideo Goto,

1

Taisuke Horimoto,

1

and Yoshihiro Kawaoka

1,2,4,5

*

Division of Virology, Department of Microbiology and Immunology1and International Research Center for Infectious Diseases,

Institute of Medical Science, University of Tokyo, Shirokanedai, Minato-ku, Tokyo 108-8639, Japan5;

ERATO Infection-Induced Host Responses Project, Japan Science and Technology Agency, Saitama 332-0012, Japan4; Laboratory of Prion Diseases, Department of Prion Diseases,

Graduate School of Veterinary Medicine, Hokkaido University, Sapporo 060-818, Japan3; and Department of Pathobiological Sciences, School of

Veterinary Medicine, University of Wisconsin-Madison, Madison, Wisconsin 537062

Received 6 December 2008/Accepted 12 January 2009

The mechanism by which the influenza A virus genome is packaged into virions is not fully understood. The coding and noncoding regions necessary for packaging of the viral RNA segments, except for the M segment, have been identified. Here, we delineate the M segment regions by incorporating a reporter viral RNA into virions and by generating viruses possessing mutations in the regions. We found that, like the other segments, the M segment coding regions are essential for virion incorporation and that the nucleotide length rather than

the nucleotide sequence of the 5end of the coding region is important.

The genome of influenza A virus consists of eight negative-stranded RNA segments (20). For efficient virus replication, all eight viral RNA (vRNA) segments must be packaged into progeny viruses. Recently, for all segments except the M seg-ment, we and other groups demonstrated that the coding se-quences (1–5, 11, 14–16, 19, 21) as well as the noncoding regions (13) at both the 3⬘and 5⬘ends of the vRNA segments are required for their efficient packaging into virions. For the M segment, Hutchinson et al. (7) demonstrated that synony-mous mutations introduced into the highly conserved codons located in the terminal coding regions lead to defects in virion assembly and viral genome packaging. However, the exact nu-cleotide (nt) sequences of the M vRNA coding region critical for genome packaging remain unknown. Here, we defined the packaging signal for the M segment by using virus-like particles (VLPs) that possessed green fluorescent protein (GFP)-encod-ing M vRNAs and mutant viruses whose M vRNAs encoded M2 protein in which the carboxy (C)-terminal 11 amino acids were deleted, allowing us to modify this region without affect-ing the amino acid sequence.

To identify the packaging signal of the M vRNA, we generated infectious VLPs by A/WSN/33 (H1N1; WSN) vi-rus-based reverse genetics (17) using plasmids for mutant M vRNAs that possessed the GFP gene flanked by various lengths of the coding and/or noncoding regions (Fig. 1). The packaging efficiency of each test M vRNA into infectious

VLPs was measured as previously described (19) (Fig. 1). Briefly, we infected Madin-Darby canine kidney (MDCK) cells with the VLPs, detected virus-infected cells with an anti-WSN virus polyclonal antibody, and counted the num-ber of WSN viral antigen-expressing (representing the total number of infectious VLPs) and GFP-expressing (repre-senting the number of VLPs that possessed the test M vRNA) cells at 24 h postinfection. As the 3⬘ or 5⬘ coding region was extended, both the M vRNA packaging efficiency and the VLP number gradually increased except for those of M(0)GFP(0) (the numbers in parentheses indicate the nu-cleotide numbers for the M coding regions). These results indicate that, like the other segments (2–4, 10, 14, 16, 19, 21), both ends of the M vRNA coding region support effi-cient packaging of the vRNA segment into virions.

To further define the nucleotide sequences of the M vRNA coding region critical for virus replication, we focused on the coding sequence at the 5⬘end. Previously, we have shown that an 11-amino-acid deletion at the M2 C terminus (Mstop) (Fig. 2A) does not severely affect virus replication in cell culture (8). The Mstop vRNA harbors a 29-nt sequence (at positions 979 to 1007) that normally encodes part of the M2 C terminus but in this mutant becomes noncoding due to the double stop codons introduced immediately upstream of the 29 nt. We exploited this 29-nt sequence at the 5⬘end of the Mstop vRNA to further define the requirements in this region for genome packaging without further altering the amino acid sequence of the virus.

To investigate whether a specific nucleotide(s) of the 29-nt sequence in the Mstop vRNA plays a critical role in virus replication, a plasmid library for mutant M vRNAs that

pos-* Corresponding author. Mailing address: Institute of Medical Science, University of Tokyo, Shirokanedai, Minato-ku, Tokyo 108-8639, Japan. Phone: 81-03-5449-5310. Fax: 81-03-5449-5408. E-mail: [email protected].

Published ahead of print on 21 January 2009.

3384

on November 8, 2019 by guest

http://jvi.asm.org/

(2)

sessed randomized 29-nt sequences (Mrdm) (Fig. 2A) was constructed and used for reverse genetics. The transfectant supernatant was subjected to plaque assays on MDCK cells. Although the pool size of the Mrdm vRNA (1.5⫻ 103; see

legend to Fig. 2 for details) was much smaller than the total possible sequence variation (4291011), this approach allowed

us to find any sequence trend(s) in this region that favored efficient virus replication.

We analyzed 38 plaque-purified viruses and found 25 dif-ferent nucleotide sequences of M vRNAs (Table 1). None of these 25 sequences were identical to the sequence found in the original Mstop vRNA. All of the viruses possessing these different nucleotide sequences in their 29-nt sequence grew efficiently (107 to 108 PFU/ml) and maintained the

se-quences after three passages, with the exception of clone number 13. In this clone, we found a uracil inserted at the 5⬘ end of the randomized nucleotides in the M vRNA after three passages (data not shown). No other mutations were found in these mutant M vRNAs. The ratios of adenine and uracil were much higher than those of guanine and cytosine in these mutant M vRNAs; however, this AT-rich tendency was likely an artifact, since a similar nucleotide bias was also found in the plasmid pool used to generate the Mrdm vRNA (Table 2).

Analyses of the 25 sequences found in the 29-nt regions of the mutant M vRNA segments neither identified consensus sequences nor predicted secondary structures, except for two uracils at the 5⬘end (Table 1). The 5⬘end of influenza vRNAs contains a series of uracils, the so-called poly(U) signal se-quence (9, 12). This nucleotide sese-quence, which allows the

addition of the poly(A) tail at the 3⬘end of the viral mRNAs, plays a role in vRNA transcription (9, 12). For WSN M vRNA, which we used as a template in this study, the poly(U) se-quence comprises two uracils in stop codons and an additional four uracils (Fig. 2A). The two uracils at the 5⬘end of the M vRNAs conserved among the viral clones obtained from the randomized pool suggest that a series of six uracils are needed for the efficient transcription of M vRNA for virus replication. To test this possibility, we prepared a plasmid for Mstop-cc vRNA (Fig. 2A) in which two cytosines replaced the two con-served uracils at the 5⬘end of the coding sequence. To assess the transcription/replication efficiency of the Mstop-cc vRNA, the plasmid was transfected into 293T cells together with four plasmids for the expression of PB2, PB1, PA, and NP, which are necessary and sufficient for vRNA transcription and repli-cation (18). Twenty-four hours posttransfection, the expression of M1 and M2 in the cell lysates was analyzed by Western blotting with monoclonal antibodies specific for each protein (Fig. 2B). Under these conditions, the protein expression of the Mstop-cc vRNA was much lower than that of the wild-type M and Mstop vRNAs, demonstrating that these two conserved uracils likely support the efficient transcription/replication of the M vRNAs for virus replication.

[image:2.585.92.494.67.232.2]

Our finding of only limited conservation of the sequence in the 29-nt region in the M vRNA among our viral clones indi-cated that the nucleotide sequence in this region can be highly diverse without disrupting efficient virus replication, except for the two uracils at the 5⬘end. To confirm the relaxed stringency of the nucleotide sequence at the 5⬘end of the Mstop vRNA

FIG. 1. Identification of domains in the 3⬘or the 5⬘coding region of the M vRNA important for genome packaging and virion formation. (A) Schematic diagrams of test M vRNAs. The numbers in parentheses indicate the nucleotide numbers for the M coding regions. The noncoding and coding regions are represented by gray and green bars, respectively, while the dashed lines indicate nucleotides deleted from the M coding regions. The GFP open reading frame (green bar) was inserted in frame into the M open reading frame. All mutants are shown in the negative-sense orientation. (B) Efficiencies of genome packaging and virion formation. To generate WSN strain-based infectious VLPs possessing the test M vRNAs given in panel A, plasmids for each test M vRNA were transfected into 293T cells with seven plasmids for the remaining vRNAs and six plasmids for the expression of PB2, PB1, PA, NP, M1, and M2. Forty-eight hours posttransfection, the supernatants were transferred to MDCK cells. The numbers of WSN viral antigen-expressing (representing the total number of infectious VLPs) and GFP-expressing (representing the number of VLPs that possessed the test M vRNA) cells at 24 h postinfection were determined, and the packaging efficiency of each test M vRNA into VLP was calculated by dividing the number of M vRNA-positive VLPs by the total number of VLPs. The numbers of VLPs with and without test M vRNAs are shown by green and gray bars, respectively. The results shown are representative of three independent experiments.

on November 8, 2019 by guest

http://jvi.asm.org/

(3)

for efficient virus replication, we designed a mutant vRNA containing uracils at all positions from 979 to 1005 (Fig. 2A). However, the transcription/replication efficiency of this mutant vRNA was quite low (Fig. 2B).

We therefore designed four M vRNA mutants whose non-coding 27-nt regions for the M2 C terminus (except for the last two uracils) were deleted (Fig. 2A) or replaced with random-ized sequences (Fig. 2A). The nucleotide compositions of the 27-nt sequence regions of these latter three M vRNAs were the same as those of the Mstop vRNA, but the nucleotide se-quences were randomized. The transcription/replication effi-ciencies of these mutant M vRNAs were comparable to those of the wild-type M and Mstop vRNAs (Fig. 2B). While infectious viruses possessing the Mscr-1, -2, and -3 and Mstop vRNAs were readily generated by reverse genetics,

we could not rescue infectious virus that possessed the Mdel vRNA. Although all of the viruses that possessed the scram-bled sequences in their M vRNAs grew more slowly than the Mstop virus, their maximum titers were comparable to those of the Mstop virus (Fig. 3A). These results indicate that the nucleotide length, rather than the nucleotide sequence, at the 5⬘ end of the Mstop vRNA is critical for virus replica-tion.

To determine the packaging efficiency of each M vRNA into virions, MDCK cells infected with these mutant viruses at a low (⬍0.1) multiplicity of infection were fixed at 12 h postinfection and M1-, NP-, or hemagglutinin (HA)-expressing cells were identified with anti-M1, -NP, or -HA monoclonal antibodies, respectively; virus-infected cells were identified with anti-WSN virus polyclonal antibody. The packaging efficiencies were

cal-FIG. 2. Construction of mutant M vRNAs and their packaging efficiencies into virions. (A) Schematic diagrams of wild-type and mutant M vRNAs. The nucleotide sequences at the 5⬘end (positions 972 to 1013) of wild-type, Mstop, Mrdm, Mstop-cc, M-27U, Mdel, and Mscr-1, -2, and -3 vRNAs are shown. For the construction of a plasmid pool for Mrdm vRNA, we performed inverse PCR with plasmid for Mdel vRNA as a template and primers containing randomized nucleotides at positions 979 to 1007. The self-ligated PCR products were used to transform Escherichia coli DH5␣, resulting in 5.0 ⫻ 103 transformants. The InvivoGen small interfering RNA Wizard (http://www .sirnawizard.com/scrambled.php) was used to create the randomized sequences of the Mscr-1, -2, and -3 vRNAs. The noncoding and coding regions are represented in gray and black, respectively. Stop codons and the altered nucleotides from the authentic sequence are shown in red and blue, respectively. Note that the amino acid sequences of M2 encoded on the listed M vRNAs are identical except for the wild-type M vRNA. (B) Transcription/replication efficiencies of wild-type and mutant M vRNAs. An RNA polymerase I-driven plasmid for M vRNA synthesis was transfected into 293T cells together with four plasmids for the expression of PB2, PB1, PA, and NP, which are necessary and sufficient for vRNA transcription and replication. Twenty-four hours posttransfection, the expression of M1, M2, and␤-actin (as an internal control) in the cell lysates was analyzed by Western blotting with monoclonal antibodies specific for each protein. The results shown are representative of three independent experiments.

on November 8, 2019 by guest

http://jvi.asm.org/

(4)

culated by dividing the number of monoclonal antibody-posi-tive cells by the number of polyclonal antibody-posiantibody-posi-tive cells (Fig. 3B). The packaging efficiencies of the NP and HA vRNAs into all viruses were greater than 90%. On the other hand, those of the M vRNAs into the Mscr-1, -2, and -3 viruses (72%,

[image:4.585.302.538.78.489.2]

P⫽0.03; 79%,P⫽0.17; and 79%,P⫽0.37, respectively) were lower than that into the Mstop virus (82%); thus, a statistically significant difference was observed only with the Mscr-1 virus. These results indicate that the nucleotide sequence scrambling

FIG. 3. Characterization of mutant viruses possessing a scrambled se-quence in their M vRNAs. (A) Growth comparison of Mstop and Mscr-1, -2, and -3 viruses. MDCK cells were infected with each virus at a multiplicity of infection of 0.01. The culture supernatants harvested at the indicated times postinfection were subjected to plaque assay on MDCK cells. Error bars indicate the standard deviations of three independent experiments. (B) Pack-aging efficiencies of HA, NP, and M vRNAs into wild-type, Mstop, and Mscr-1, -2, and -3 viruses. MDCK cells were infected with the indicated viruses at a low (⬍0.1) multiplicity of infection. Twelve hours postinfection, the cells were fixed with 4% paraformaldehyde in phosphate-buffered saline (PBS) for 30 min and M1-, NP-, or HA-expressing cells were identified with anti-M1, -NP, or -HA monoclonal antibodies; virus-infected cells were iden-tified with an anti-WSN virus polyclonal antibody. The packaging efficiency of each vRNA was determined by dividing the numbers of monoclonal anti-body-positive cells (representing the number of infectious virions that pos-sessed M, NP, or HA vRNA, respectively) by the number of polyclonal antibody-positive cells (representing the number of all infectious virions). Error bars indicate the standard deviations of three independent experiments. (C) Formation efficiency of infectious virions possessing wild-type, Mstop, Mdel, and Mscr-1, -2, and -3 viruses. The indicated viruses were generated in 293T cells by reverse genetics using a plasmid for the NA vRNA that pos-sesses a mutation from lysine to arginine at the C terminus. MDCK cells were infected with the transfectant viruses and fixed with 4% paraformaldehyde in PBS, and virus-infected cells were identified with an antiserum to WSN virus. Error bars indicate the standard deviations of three independent experiments. TABLE 1. Nucleotide sequences of viruses possessing M vRNAs

derived from a pool of mutant M vRNA segmentsa

Mstop Nucleotide sequence at position 972–1007 (3⬘to 5⬘) No. of

samplesb

ACUCACUCAGUAAAACAGUUGUAUCUCGACCUCAUU

1 ACUCACUACCCUCUUUUUCCCGAUGUGCUUUUUAUU 1

2 ACUCACUACUAGAUUACUAACUAAAUUAAAGCUAUU 2

3 ACUCACUUUUACAAUUUUUUAUCACAAAUUUCACUU 1

4 ACUCACUUAACACUUUCAACCAUGACUAAGCUUAUU 4

5 ACUCACUCACUAACAUUAUAAUUACUCCAGACUAUU 2

6 ACUCACUCCUUAAUUACCAAAAAUGCAAUUUGUAUU 5

7 ACUCACUCAAUGGCUGCAAUACUUUUCAUCACCUUU 1

8 ACUCACUAUACAAAAUCCUUUCUCUGAUUAAGUAUU 1

9 ACUCACUACGCAUUAUAUCAUAUCAUCGUAAACAUU 2

10 ACUCACUUAAUACAUUAGAUCUUUUUCGAGUACAUU 1

11 ACUCACUACCUAUUAUUACAUAAUAUUUUGCAUAUU 2

12 ACUCACUAAUCCACAUCACUACAUUCCUCUUUCCUU 1

13 ACUCACUUCUUAAUCAUAAUAUUUACUAGUCAACAU 1

14 ACUCACUUAAUUUAUAUAUAUUUAAUAUCUAGUAUU 2

15 ACUCACUUUCACAAUAUUUUAUACACUCAAUACAUU 1

16 ACUCACUACCCAAUUUUCAUCUAUCUGUCUAGUGUU 1

17 ACUCACUCAAUUUAAAUUUAGGUUCCUUUUUGUCUU 1

18 ACUCACUCCGAUUUAAUCAAUUUCGAAUGCUAGAUU 1

19 ACUCACUAUUAUAUAUUAAACCCUCUACAGACUCUU 1

20 ACUCACUUAUAAACCUAAUUAAUCUACUAGAUUAUU 2

21 ACUCACUUUUACAGUAGCAUUUUUCCUCACACCAUU 1

22 ACUCACUAACUUUUAUGUACGUCAUUACAAAUUAUU 1

23 ACUCACUCCAAUCAAGACCUUUAAAACACACCACUU 1

24 ACUCACUGCAUCAAGACGUCAACACUAGUUAACAUU 1

25 ACUCACUACAUGAUUAGUAAUGAAAGAUUAUACCUU 1

a

Reverse-transcription PCR products from mutant viruses were sequenced directly. Nucleotides identical to the wild-type are roman, stop codons are

underlined, and the conserved uracils at the 5⬘end (see text for details) are

bold.

b

[image:4.585.48.280.90.353.2]

Number of clones possessing the indicated sequence.

TABLE 2. Nucleotide biases found at nucleotide positions 979 to 1007 in plasmids and in vRNAs from rescued viruses

Nucleotide

% of nucleotides for: Randomized pool

(at plasmid

level)a

Selected clones (at vRNA

level)b Wild type

b

A 33.4 34.6 31

U 38.5 39.8 31

G 9 6.4 13.8

C 19 19.2 24.1

aEscherichia coliDH5 was transformed with a plasmid pool for Mrdm

vRNA. Plasmids for Mrdm vRNAs were recovered from 22 randomly selected colonies to determine the nucleotide sequences. The percentages of nucleotides

corresponding to the nucleotide sequences at the 5⬘end (positions 979 to 1007)

of the M vRNAs in the selected plasmids are shown.

bThe percentages of nucleotides at positions 979 to 1007 of M vRNAs derived

from 38 plaque-purified and wild-type viruses are shown.

on November 8, 2019 by guest

http://jvi.asm.org/

[image:4.585.43.282.568.656.2]
(5)

somewhat reduced the packaging efficiency of the M vRNA into infectious virions.

To elucidate the effect of the nucleotide sequence scram-bling on infectious virion formation, we generated, by reverse genetics, Mscr-1, -2, and -3 viruses whose NA vRNA encoded arginine at the carboxyl-terminal position 453 instead of lysine. This mutation prevents trypsin-independent cleavage of WSN virus HA via the interaction between NA and plasminogen (6) and multiple cycles of virus replication in plasmid-transfected cells. To determine the efficiency of infectious virion forma-tion, we titrated the transfectant viruses in the supernatant of the plasmid-transfected cells (Fig. 3C). The Mscr-1, -2, and -3 virus titers were more than 10-fold lower than those of the wild-type WSN and Mstop viruses, indicating that the nucleo-tide sequence scrambling reduced the efficiency of infectious virion formation.

In summary, here we demonstrated that both ends of the coding regions of the M vRNA are required for its efficient packaging into virions as has been shown for the other seven vRNAs (2–4, 10, 14, 16, 19, 21). We also found that the 27-nt sequence at the 5⬘end of the coding region in the M vRNA can accommodate highly diverse sequences compromising virus replication to only a limited extent and that the length, rather than the sequence, of nucleotides in this region is important for virus replication.

Synonymous mutations introduced into the highly conserved M2 codons at positions 90 to 92 (nucleotide positions 981 to 989 of M vRNA) (7) caused a more severe reduction in virus titer in MDCK cells compared with that found with our Mscr-1, -2, and -3 viruses. However, the results of both studies indicate that the nucleotide sequence of the 5⬘ end of the coding region in the M vRNA, but not the amino acid se-quence of the corresponding gene product, affects virus repli-cation efficiency. These findings further our understanding of the packaging mechanism of influenza A virus vRNA segments into virions.

We thank Susan Watson and Krisna Wells for editing the manu-script.

This work was supported by the Exploratory Research for Advanced Technology (ERATO) grant from Japan Science and Technology Agency and by grants-in-aid from the Ministries of Education, Culture, Sports, Science, and Technology and of Health, Labor, and Welfare of Japan and by research grants from the National Institute of Allergy and Infectious Diseases, Public Health Service.

REFERENCES

1.de Wit, E., M. I. Spronken, G. F. Rimmelzwaan, A. D. Osterhaus, and R. A. Fouchier.2006. Evidence for specific packaging of the influenza A virus

genome from conditionally defective virus particles lacking a polymerase

gene. Vaccine24:6647–6650.

2.Dos Santos Afonso, E., N. Escriou, I. Leclercq, S. van der Werf, and N. Naffakh.2005. The generation of recombinant influenza A viruses expressing a PB2 fusion protein requires the conservation of a packaging signal

over-lapping the coding and noncoding regions at the 5⬘end of the PB2 segment.

Virology341:34–46.

3.Fujii, K., Y. Fujii, T. Noda, Y. Muramoto, T. Watanabe, A. Takada, H. Goto, T. Horimoto, and Y. Kawaoka.2005. Importance of both the coding and the segment-specific noncoding regions of the influenza A virus NS segment for

its efficient incorporation into virions. J. Virol.79:3766–3774.

4.Fujii, Y., H. Goto, T. Watanabe, T. Yoshida, and Y. Kawaoka.2003. Selective incorporation of influenza virus RNA segments into virions. Proc. Natl.

Acad. Sci. USA100:2002–2007.

5.Gog, J. R., S. Afonso Edos, R. M. Dalton, I. Leclercq, L. Tiley, D. Elton, J. C. von Kirchbach, N. Naffakh, N. Escriou, and P. Digard.2007. Codon con-servation in the influenza A virus genome defines RNA packaging signals.

Nucleic Acids Res.35:1897–1907.

6.Goto, H., and Y. Kawaoka.1998. A novel mechanism for the acquisition of

virulence by a human influenza A virus. Proc. Natl. Acad. Sci. USA95:

10224–10228.

7.Hutchinson, E. C., M. D. Curran, E. K. Read, J. R. Gog, and P. Digard.2008.

Mutational analysis ofcis-acting RNA signals in segment 7 of influenza A

virus. J. Virol.82:11869–11879.

8.Iwatsuki-Horimoto, K., T. Horimoto, T. Noda, M. Kiso, J. Maeda, S. Watanabe, Y. Muramoto, K. Fujii, and Y. Kawaoka.2006. The cytoplasmic tail of the influenza A

virus M2 protein plays a role in viral assembly. J. Virol.80:5233–5240.

9.Li, X., and P. Palese.1994. Characterization of the polyadenylation signal of

influenza virus RNA. J. Virol.68:1245–1249.

10.Liang, Y., Y. Hong, and T. G. Parslow.2005.cis-acting packaging signals in the

influenza virus PB1, PB2, and PA genomic RNA segments. J. Virol.79:10348–

10355.

11.Liang, Y., T. Huang, H. Ly, T. G. Parslow, and Y. Liang.2008. Mutational analyses of packaging signals in influenza virus PA, PB1, and PB2 genomic

RNA segments. J. Virol.82:229–236.

12.Luo, G. X., W. Luytjes, M. Enami, and P. Palese.1991. The polyadenylation signal of influenza virus RNA involves a stretch of uridines followed by the

RNA duplex of the panhandle structure. J. Virol.65:2861–2867.

13.Luytjes, W., M. Krystal, M. Enami, J. D. Pavin, and P. Palese.1989. Amplification,

expression, and packaging of foreign gene by influenza virus. Cell59:1107–1113.

14.Marsh, G. A., R. Hatami, and P. Palese.2007. Specific residues of the influenza A virus hemagglutinin viral RNA are important for efficient

pack-aging into budding virions. J. Virol.81:9727–9736.

15.Marsh, G. A., R. Rabadan, A. J. Levine, and P. Palese.2008. Highly con-served regions of influenza a virus polymerase gene segments are critical for

efficient viral RNA packaging. J. Virol.82:2295–2304.

16.Muramoto, Y., A. Takada, K. Fujii, T. Noda, K. Iwatsuki-Horimoto, S. Watanabe, T. Horimoto, H. Kida, and Y. Kawaoka.2006. Hierarchy among viral RNA (vRNA) segments in their role in vRNA incorporation into

influenza A virions. J. Virol.80:2318–2325.

17.Neumann, G., T. Watanabe, H. Ito, S. Watanabe, H. Goto, P. Gao, M. Hughes, D. R. Perez, R. Donis, E. Hoffmann, G. Hobom, and Y. Kawaoka.

1999. Generation of influenza A viruses entirely from cloned cDNAs. Proc.

Natl. Acad. Sci. USA96:9345–9350.

18.Neumann, G., T. Watanabe, and Y. Kawaoka.2000. Plasmid-driven

forma-tion of influenza virus-like particles. J. Virol.74:547–551.

19.Ozawa, M., K. Fujii, Y. Muramoto, S. Yamada, S. Yamayoshi, A. Takada, H. Goto, T. Horimoto, and Y. Kawaoka.2007. Contributions of two nuclear localization

signals of influenza A virus nucleoprotein to viral replication. J. Virol.81:30–41.

20.Palese, P. A., and M. L. Shaw.2007.Orthomyxoviridae: the viruses and their

replication, p. 1647–1689.InD. M. Knip et al. (ed.), Fields virology, 5th ed.

Lippincott-Raven Publishers, Philadelphia, PA.

21.Watanabe, T., S. Watanabe, T. Noda, Y. Fujii, and Y. Kawaoka.2003. Exploi-tation of nucleic acid packaging signals to generate a novel influenza virus-based

vector stably expressing two foreign genes. J. Virol.77:10575–10583.

on November 8, 2019 by guest

http://jvi.asm.org/

Figure

FIG. 1. Identification of domains in the 3�(A) Schematic diagrams of test M vRNAs. The numbers in parentheses indicate the nucleotide numbers for the M coding regions
TABLE 1. Nucleotide sequences of viruses possessing M vRNAsderived from a pool of mutant M vRNA segmentsa

References

Related documents