Foamy Virus Nuclear RNA Export Is Distinct from That of Other Retroviruses

0022-538X/11/$12.00 doi:10.1128/JVI.01518-10

Copyright © 2011, American Society for Microbiology. All Rights Reserved.

Foamy Virus Nuclear RNA Export Is Distinct from

That of Other Retroviruses

䌤

Jochen Bodem,* Tanja Schied, Richard Gabriel, Matthias Rammling, and Axel Rethwilm*

Universita¨t Wu¨rzburg, Institut fu¨r Virologie und Immunbiologie, Versbacher Str. 7, 97078 Wu¨rzburg, Germany

Received 21 July 2010/Accepted 7 December 2010

Most retroviruses express all of their genes from a single primary transcript. In order to allow expression of more than one gene from this RNA, differential splicing is extensively used. Cellular quality control mechanisms retain and degrade unspliced or partially spliced RNAs in the nucleus. Two pathways have been described that explain how retroviruses circumvent this nuclear export inhibition. One involves a constitutive transport element in the viral RNA that interacts with the cellular mRNA transporter proteins NXF1 and NXT1 to facilitate nuclear export. The other pathway relies on the recognition of a viral RNA element by a virus-encoded protein that interacts with the karyopherin CRM1. In this report, we analyze the protein factors required for the nuclear export of unspliced foamy virus (FV) mRNA. We show that this export is CRM1 dependent. In contrast to other complex retroviruses, FVs do not encode an export-mediating protein. Cross-linking experiments indicated that the cellular protein HuR binds to the FV RNA. Inhibition studies showed that both ANP32A and ANP32B, which are known to bridge HuR and CRM1, are essential for FV RNA export. By using this export pathway, FVs solve a central problem of viral replication.

The nuclear export of RNA molecules in eukaryotic cells is a tightly regulated process (18, 59, 63, 70, 71). Nuclear exit is usually allowed only for fully spliced cellular mRNAs, while intron-containing mRNAs are retained in the nucleus and sub-sequently degraded (17, 18, 59, 63, 70). This defines a specific problem in the replication of retroviruses (RVs), since they must export not only fully spliced but also unspliced or partially spliced mRNAs into the cytoplasm. For the export of the two latter RNA species, retroviruses have found ways to escape both the splicing machinery and the degradation of incom-pletely spliced mRNAs by making use of either of two strate-gies for nuclear export of mRNAs with intact splice donor (SD) and acceptor (SA) pairs.

In complex retroviruses, such as lentiviruses, some betaret-roviruses, and all deltaretbetaret-roviruses, virus-encoded regulatory proteins (Rev, Rem, and Rex, respectively) bind to the un-spliced or incompletely un-spliced viral mRNA on one hand and contact the karyopherin CRM1 on the other (1, 29, 33, 48, 49). Subsequently, this complex shuttles to the cytoplasm, where it delivers the RNA cargo in a regulated fashion that involves Ran in GTP-bound form. Normally CRM1 is used for nuclear export of ribosomal subunits, 5S rRNAs, cellular proteins con-taining a nuclear export signal (NES), and snRNAs (18, 27, 53, 63). This pathway can also be hitchhiked by endogenous hu-man retroviruses (12, 47, 74). The presence of regulatory pro-teins acting at the posttranscriptional level enables complex retroviruses to use a biphasic mode of gene expression (“early” versus “late” phase), resulting in a gain of complexity better known from DNA viruses (16).

Alternatively, more simple retroviruses, such as the

betaret-rovirus Mason-Pfizer monkey virus (MPMV), can (42) contain

acis-acting constitutive RNA transport element (CTE) that, by

directly contacting the NXF1 and NXT1 export factors, facil-itates nuclear mRNA exit (28, 42, 72, 77). The NXF1/NXT1-mediated export pathway is normally used for the nuclear exit of fully spliced cellular mRNAs (17, 36–38). For the simple gammaretrovirus murine leukemia virus (MLV), a nuclear ex-port pathway of unspliced transcripts that involves the

pack-aging sequence (⌿) at the 5⬘ end of the genomic RNA has

been suggested, and very recently for the expression of un-spliced mRNA of the simple Jaagsiekte retrovirus of sheep, a

role for theenvgene-encoded signal peptide and CRM1 has

been described (3, 14). However, for most of the simple ret-roviruses, the way unspliced mRNA exits the nucleus has not been identified yet.

Foamy viruses (FVs) constitute theSpumaretrovirus

subfam-ily of retroviruses (43, 61). They are complex retroviruses that

encode accessory proteins (Fig. 1) in the 3⬘ region of the

genome. Among these is a DNA-binding protein, the tran-scriptional transactivator Tas (7, 35, 39, 44, 62). However, despite intensive investigation, regulatory proteins acting at the RNA export level could not be identified (4, 76). The replication pathway of spumaretroviruses diverges in many ways from that of orthoretroviruses (43, 61). This aberrant replication strategy also involves the presence of two Tas-dependent promoters (8, 45, 46), differentially regulating the viral gene expression (35, 44, 61). The internal promoter (IP)

is located in theenvgene approximately 100 nucleotides

up-stream of the accessory genes (Fig. 1). This IP is driving the accessory gene expression in the early phase of viral transcrip-tion, while the U3 promoter in the long terminal repeat (LTR) overtakes it to direct the expression of structural genes in the second phase (Fig. 1). This mode of gene regulation allows a differential expression of FV genes; however, it does not cir-cumvent the central problem of all retroviruses to export spliced as well as unspliced RNAs from the nucleus.

* Corresponding author. Mailing address: Universita¨t Wu¨rzburg, Institut fu¨r Virologie und Immunbiologie, Versbacher Str. 7, 97078 Wu¨rzburg, Germany. Phone: (49) 931-201-49554. Fax: (49)-931-201-49553. E-mail for A. Rethwilm: virologie@mail.uni-wuerzburg.de. E-mail for J. Bodem: jochen.bodem@vim.uni-wuerzburg.de.

䌤_{Published ahead of print on 15 December 2010.}

2333

on November 7, 2019 by guest

http://jvi.asm.org/

In orthoretroviruses, the genes are translated from three classes of mRNAs (58). The Gag and Gag-Pol precursor pro-teins are translated from the unspliced mRNA. This mRNA is also packaged into progeny virus and serves as the template for reverse transcription (RT) in the next round of infection.

Sin-gle-spliced mRNAs specifying theenvmRNA and completely

spliced mRNAs encoding some accessory proteins of complex RVs are also generated and transferred from the nucleus to the cytoplasm (58). In FVs, the situation is even more complex, since they generate their Pol precursor protein independently of Gag from a spliced mRNA (9, 34, 75). Thus, FV gene expression involves extensive mRNA splicing (Fig. 1) that probably necessitates a kind of posttranscriptional regulation. Here we identify the potential cellular partners facilitating nuclear export of intron-containing FV mRNAs by using the prototype FV (PFV) isolate as a model.

MATERIALS AND METHODS

Cells and transfections with DNA.HEK 293T cells were maintained in Dul-becco’s modified Eagle’s medium (DMEM) supplemented with 10% heat-inac-tivated fetal calf serum, 100 U of penicillin/ml, 100␮g of streptomycin/ml, and 2 mM glutamine. The medium was exchanged prior to transfection. Cells were transfected with plasmid DNA by using Polyfect (Qiagen). The transfection mix contained 0.5␮g pEGFP, 1␮g pcHSRV2 (49) or derivatives, and the amounts of the other expression plasmids indicated in the figures. The total amount was adjusted to be 3.5␮g with pUC19 DNA. Transfection efficiencies were moni-tored by enhanced green fluorescent protein (EGFP) expression, when appro-priate.

RNA preparation and analysis.Transfections of HEK 293T cells with plasmid DNA and the preparation of total or fractionated RNA were performed as described previously (13). The nuclear and cytoplasmic fractions were subjected to RNA extraction with the RNeasy kit (Qiagen) according to the manufacturer’s protocol. The RNA detection was essentially performed as described before (6). Briefly, the RNA content was determined photometrically and by gel analysis. Five micrograms of RNA was loaded onto denaturing formaldehyde gels con-taining 1% agarose and transferred to Hybond-N⫹membrane (Amersham) by capillary blotting. The blots were hybridized overnight at 60°C to specific probes (activity,⬎107

cpm), which had been labeled by random priming with the Mega-Prime kit (Amersham). The blots were washed stringently, sealed, and exposed to X-ray films. Probes were derived from the PFV 5⬘gaggene (nucleotides [nt] 531 to 930); thetas/betgenes (nt 1 to 905), which are also able to detect theenv gene mRNA; the U3 of the LTR region (nt 10052 to 11017 after the start of

transcription of the pcHSRV2 virus isolate); the human GAPDH (glyceralde-hyde-3-phosphate dehydrogenase) gene (nt 1011 to 1310); and the complete gene coding for EGFP.

Metabolic labeling.A total of 4⫻106

HEK 293T cells were transfected with 20␮g pcHSRV2 by calcium phosphate coprecipitation (5). At 40 h posttrans-fection, the medium was changed and leptomycin B (LMB) was added to a final concentration of 20 nM. After 1 h, cells were labeled for 5 h with [35_S]methionine

(2 mCi/ml; Hartmann Analytic). Subsequent to labeling, the cells were washed with phosphate-buffered saline (PBS) and lysed in radioimmunoprecipitation assay (RIPA) buffer (50 mM Tris [pH 8.0], 150 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulfate [SDS]). Cell lysates were cleared by centrifugation (13,000⫻gfor 15 min). The samples were immuno-precipitated with polyclonal rabbit anti-PFV Gag serum (4) and anti-PFV Tas serum able to detect the accessory Bet protein (4) coupled to protein A-Sepha-rose (Sigma). The immunoprecipitates were resolved by SDS-polyacrylamide gel electrophoresis (PAGE). Gels were fixed in 30% methanol–10% acetic acid and dried. Immunprecipitates were visualized by autoradiography.

Immunoblotting and antibodies.Immunoblotting was performed by standard procedures (5). The following primary antibodies were used. Mouse anti-PFV Gag (30, 32) or anti-PFV Pol (32) monoclonal antibodies (MAbs) were used at a dilution of 1:1,000 or 1:25, respectively. Mouse GFP (Sigma), anti-GAPDH (Sigma), anti-ANP32A (Santa Cruz and Abnova), and anti-HuR (In-vitrogen) MAbs and rabbit anti-ANP32B (26, Santa Cruz), anti-HuR (Sigma), and anti-Halo (Promega) antisera were used and diluted as recommended by the supplier. Immunocomplexes were stained with secondary mouse or anti-rabbit serum coupled to horseradish peroxidase (Jackson).

Recombinant DNA.Established procedures were employed to generate plas-mid DNAs (2, 64). All recombinant molecular clones were verified by nucleic acid sequencing of the relevant parts.

Plasmid pcHSRV2 (50), thepolATG-to-CTG mutant plasmid pcHSRV2-M54 (22), thegagATG-to-TTG mutant plasmid pcHSRV2-M78 (30), pNLS-NES (73), pNLS-NES-M90 (73), p3CANc (57), the codon-optimizedgagexpression plasmid pcoPG4 (69), and pEGFP (Invitrogen) have been described previously. The complete cDNAs of the ANP32A, ANP32B, and HuR genes were ob-tained from the German Resource Center for Genome Research (accession no. NM 006305, NM 006401, and NM 001419, respectively) and had already been inserted into pCMV-Sport6. The ANP32A/B and HuR genes were Halo tagged by cloning the respective open reading frames (ORFs) into the pHT-2 vector (Promega) by PCR using the primers Halo-pp32s (5⬘-CAGCTAGCATGGAG ATGGGCAGACGGATTCATTTA), Halo-pp32as (5⬘-GGCGATATCATCAT CTTCTCCCTCATCTTCAG), Halo-HuRs (5⬘-CAGCTAGCATGTCTAATGG TTATGAAGACCACATGGCC), Halo-HuRas (5⬘-GCGATATCTTTGTGGG ACTTGTTGGTTTTGAAGGA), Halo-Aprils (5⬘CAGCTAGCATGGACATG AAGAGGAGGATCCACCTG), and Halo-Aprila (5⬘CGCCCGGGATCATCT TCTCCTTCATCATCTGTTTC). The ANP32A and -B expression plasmids insensitive to RNA interference (RNAi) treatment (⌬3⬘ untranslated region [UTR] plasmids) were generated by amplifying the respective ORFs lacking the targeted sequence in the 3⬘UTR by using the oligonucleotides ANP32As (5⬘-C ACCATGGAGATGGGCAGACGGATT), ANP32Aas (5⬘-TTAGTCATCATC TTCTCCCTCATCT), ANP32Bs (5⬘-CACCATGGACATGAAGAGGAGGA TC), and ANP32Bas (5⬘-TTAATCATCTTCTCCTTCATCATCT). These amplimers were subsequently inserted into the pcDNA-3.1D-TOPO vector (In-vitrogen).

Reversible cross-linking, immunoprecipitation, and RT-PCR.The experiment followed a modified protocol described by Niranjanakumari et al. (52). In brief, HEK 293T cells were transfected with pcHSRV2 and Halo-tagged constructs by calcium phosphate coprecipitation. Two days after transfection, protein-RNA complexes were cross-linked with 1% formaldehyde for 10 min. The reaction was stopped with 0.25 M glycine. Cells were washed twice with PBS and lysed in RIPA buffer. Protein-RNA complexes were solubilized by Qiagen shredder and sonication. Immobilized complexes were bound to 20␮l HaloLink resin and washed with HaloLink buffer (Promega). Cross-linking was reversed at 65°C for 45 min, and RNAs were subsequently purified with Trizol (Invitrogen) reagent. The remaining cellular DNA was digested with 4 U RNase-free DNase I (Pro-mega) at 37°C for 45 min. Approximately 500-nt PFVpolor GAPDH gene-specific fragments were amplified by reverse transcription-PCR (RT-PCR) ap-plying 30 cycles of denaturation (94°C for 20 s), annealing (55°C for 40 s), and elongation (72°C for 30 s) with 5 pmol primers (GAPDHs, 5⬘-AGTGGATATT GTTGCCATCAATGAC; GAPDHas, 5⬘-GCCAGTAGAGGCAGGGATGAT GTTC; PFVs, 5⬘-AAACAACACCTATAGCCCTGTATTA; and PFVas, 5⬘-GC ACAACAAGTATAAAGCAGATATC). After a final elongation step, the amplimers were resolved by agarose gel electrophoresis.

FIG. 1. Genome organization and transcripts of PFV. Horizontal arrows indicate the U3 LTR and the internal promoter (IP). The vertical arrows indicate the position of frequently used 5⬘and 3⬘splice sites.

on November 7, 2019 by guest

http://jvi.asm.org/

siRNAs and transfections.HEK 293T or HT1080 cells (as indicated in the figure legends) were transfected with small interfering RNAs (siRNAs), using HiPerFect (Qiagen) according to the manufacturer’s protocols. siRNAs were obtained from Qiagen (ANP32A-1, 5⬘-CGGAGCTGGTTGAGCCTTCAA; ANP32A-2, 5⬘-AACGTTGCTGTGGGAACGAGA; ANP32B-3, 5⬘-CAGAAA CAGAACTGTTCAGTA; ANP32B-4, 5⬘-ACCGTCTGTGGCTACCAGTTA; and HuR-5, 5⬘-AAGTAGCAGGACACAGCTTGG) and from Santa Cruz (or-der number for the unspecific control siRNA targeting glutathioneS-transferase [GST], sc-37007). Transfection was repeated after 2 days, followed by transfec-tion of pcHSRV2 with Fugene6 (Roche) as described before (15). Cells were harvested 2 days after plasmid transfection, and cellular lysates were analyzed for ANP32A, ANP32B, HuR, PFV Gag, EGFP, and GAPDH expression by immu-noblotting or RNA analysis. For ANP32A and -B rescue experiments, siRNAs (ANP32A-1 and ANP32B-4) that targeted the 3⬘UTR of the respective cDNAs and the plasmids pANP32A-⌬3⬘UTR and pANP32B-⌬3⬘UTR were used.

RESULTS

Nuclear export of PFVgagmRNA depends on CRM1. To investigate whether nuclear export of unspliced PFV mRNA follows either of the two pathways previously characterized for orthoretroviruses (see above), we analyzed viral gene expres-sion by blocking experiments. To abrogate the CRM1 pathway, we incubated HEK 293T cells transfected with the infectious molecular clone pcHSRV2 (50) 48 h previously in 20 nM specific CRM1 inhibitor (LMB) for 1 h. The pcHSRV2 plas-mid expresses hybrid promoter-derived RNAs in a Tas-inde-pendent way (50). Subsequent to transfection, the cells were

metabolically labeled with [35_{S]methionine/cysteine for 5 h and}

viral Gag and Bet proteins were immunoprecipitated with spe-cific rabbit antisera (4). As depicted in Fig. 2A, the expression of Bet, which is translated from a subgenomic fully spliced mRNA (4, 10, 51), was independent of LMB treatment of cells, while a strong reduction in Gag protein synthesis upon LMB incubation was observed.

This finding was suggestive of a CRM1-dependent nuclear

export pathway of PFVgagmRNA. To further elucidate this,

we studied the amounts of total and cytoplasmic PFV RNA by Northern blotting. After transfection of HEK 293T cells with pcHSRV2 and an enhanced green fluorescent protein (EGFP)-encoding control plasmid (pEGFP), cells were incu-bated for 16 h with medium containing 10 nM LMB. RNA was extracted from the different cellular compartments and

hybrid-ized to agaggene-specific probe. As shown in Fig. 2B, almost

similar amounts of full-length transcripts were detected re-gardless of the presence of LMB in the fractions of total RNA.

In the absence of LMB, PFVgagRNA could be easily detected

in the cytoplasmic RNA fraction, while this transcript was significantly reduced in LMB-treated cells. Rehybridization of the membrane by using GAPDH- or EGFP-specific probes revealed the cytoplasmic accumulation of both mRNAs to be unaffected by LMB treatment (Fig. 2B). Subsequent

rehybrid-ization to atas/bet-specific probe revealed the independence of

nuclear export of these mRNAs from LMB treatment.

Fur-thermore, since the probe also detects theenvgene transcript,

we can conclude that this singly spliced mRNA was as affected

by LMB as thegagtranscript (Fig. 2B). The expression levels of

tasandbetgenes were low in untreated and LMB-treated cells,

probably due to the poor efficiency of the Tas-mediated trans-activation of the IP in HEK 293T cells.

Nuclear export of unspliced PFV mRNA is independent of viral proteins.Up to now, a CRM1-dependent nuclear export

pathway of retroviral mRNAs had only been described in con-junction with a virus-encoded regulatory protein (18, 19). Pre-vious searches for such a protein within the PFV genome were futile (4, 76). Expression of unspliced PFV mRNA is indepen-dent of Env and the accessory Tas and Bet proteins (4, 5, 25, 31, 65). However, Gag and/or Pol proteins could potentially, via an autoregulatory loop, positively regulate their own ex-pression in the context of the wild-type genome. In PFV, both proteins have been reported to have a nuclear phase (32, 61, 66), which would be consistent with nuclear-cytoplasmic shut-tle proteins. To address this question, we separately cotrans-fected cells with proviral constructs, in which either the start

codon of thegag open reading frame (ORF) or thepolORF

ATG were mutated to TGG and CTG (22, 30), respectively, together with pUC or the pNLS-NES construct that blocks the CRM1-dependent pathway (73), and analyzed them for Gag and Pol proteins by immunoblotting.

As shown in Fig. 3A and B, the prevented expression of

either thegagorpolgene did not alter the dependence on the

FIG. 2. Dependence of PFV Gag protein expression on CRM1. (A) Treatment of cells transfected with the replication-competent pro-viral plasmid pcHSRV2 with LMB and subsequent [35_S]methionine

labeling resulted in a strong reduction of Gag protein that could be immunoprecipitated from the cellular lysate, while the expression of Bet protein, translated from a completely spliced mRNA, remained unaffected. (B) Northern blot of total and cytoplasmic (Cyto.) PFV mRNAs upon treatment of transfected cells with LMB. Blocking CRM1-dependent nuclear export resulted in a reduction to hardly detectable levels of unspliced PFVgagmRNA in the cytoplasm. Fur-thermore, the singly splicedenvmRNA was similarly affected, while thetas/betmessage, derived from a multiply spliced mRNA, remained unchanged, as were the total mRNA content and the cytoplasmic appearance of the mRNAs for GAPDH (internal control) and for EGFP (derived from pEGFP). Total RNA of untransfected 293T cells was analyzed to prove the specificity of probes. The cytoplasmic RNA was analyzed in duplicate. Blots were hybridized to a PFVgag gene-derived probe and subsequently to thetas/betprobe (also able to detect

envmRNA) and GAPDHand EGFP probes.

on November 7, 2019 by guest

http://jvi.asm.org/

CRM1 pathway to express the other gene. Furthermore, co-transfection of cells with the pcHSRV2 mutants and the pNLS-NES-derived pM90 control plasmid (73) had no significant impact on the generation of the respective PFV proteins; how-ever, cotransfection of cells with the p3CANc construct that blocks the CRM1-dependent pathway (11) severely impacted the detection of PFV Pol protein (Fig. 3B).

Since Renault et al. (60) recently proposed a model in which Gag supports the export of PFV genomic RNA, we sought to investigate the role of this protein in FV RNA export in par-ticular.

293T cells were transfected with thegagATG mutant (M78)

mentioned above and M78, together with pcoPG4, a CMV

promoter-driven codon-optimizedgagexpression plasmid.

Cy-toplasmic RNAs were prepared and hybrized to a U3-specific probe by Northern blotting and to Gag antibody by Western blotting. As shown in Fig. 4A, we detected no difference con-cerning the nuclear export of full-length RNA between the samples with or without heterologous Gag protein. The spec-ificity of both the Gag antiserum and U3 probe were analyzed in parallel (Fig. 4B).

From these experiments and previous results (4, 5, 25, 31, 65, 76), it can be concluded that no viral protein is involved in facilitating nuclear export of unspliced PFV mRNA, leaving the possibility of the involvement of a viral RNA element and so far unknown cellular factors different from those interacting

with the MPMV CTE. As far as the viral element is concerned,

an RNA element located in the 3⬘ pol genomic region and

enabling the Rev/Rev-responsive element (RRE)-independent

expression of human immunodeficiency virus (HIV)gag has

been suggested for PFV (73). However, potential functional aspects of PFV nuclear mRNA export and the role of cellular proteins were not further investigated in that study.

Identification of cellular molecules mediating nuclear ex-port of unspliced PFV mRNA.It has been reported recently that the cellular RNA-binding protein HuR and the adapter protein ANP32B were responsible for the CRM1-dependent nuclear export of CD83 mRNA (26). To investigate whether these proteins may also be involved in the nuclear export of unspliced PFV mRNA, we initially used an RNA-protein cross-linking and immunoprecipitation approach. The HuR and the CRM1 adapter proteins ANP32A and -B were Halo tagged by inserting the respective cDNAs into the pHt2 vector. HEK 293T cells were cotransfected with pcHSRV2 and pHt2, pHt2-ANP32A/B, or pHt2-HuR. Two days posttransfection, cells were harvested, cross-linked with formaldehyde, and lysed through sonication. Following precipitation with Halo resin, the cross-linked complexes were resolved and analyzed for the presence of PFV or GAPDH mRNAs as a control by reverse transcription (RT)-PCR with specific primers for GAPDH and

PFVpol-derived fragments. For additional control reactions,

RNA was isolated from 10% of the lysates and used as a

FIG. 3. The nuclear export of unspliced PFVgagand single-splicedpolmRNA does not depend on PFV Gag and Pol proteins. HEK 293T cells were cotransfected with the two pcHSRV2 mutants M54 and M78, disabling the translation of Gag and Pol proteins, respectively, and the plasmids pNLS-NES and p3CANc, which block the CRM1 pathway, or the pNLS-NES M90 control plasmid, and cellular lysates were analyzed by immunoblotting for PFV Gag protein in case of thepolATG mutant M54 (A) and for Pol protein in case of thegagATG mutant M78 (B). WT, wild type.⫺, no CRM1 blocking expression plasmid was added to the transfection cocktail.

FIG. 4. Western and Northern blotting of HEK 293T cells transfected with the pcHSRV2-Gag-ATG mutant (M78) and pcoPG4, a codon-optimized Gag expression plasmid, in duplicates. The proteins (bottom panel) and RNA (upper panel) were extracted. Nuclear and cytoplasmic RNA fractions were prepared, and the cytoplasmic RNA was analyzed with a U3-derived LTR probe for PFVgagmRNA. Cellular RNAs of 293T cells and cells transfected with either pcoPG4 or HSRV were used to prove the specificity of the probe. Hybridization of a GAPDH-specific probe served as a loading control. Cellular lysates were analyzed for PFV Gag protein and for GAPDH. The coexpression of Gag protein did not lead to accumulation of unspliced PFV RNA. To prove the specificity of the Gag antiserum or the U3 probe, total lysates and RNA of 293T cells and cells transfected with either pcoPG4 or HRSV were analyzed by Western or Northern blotting.

on November 7, 2019 by guest

http://jvi.asm.org/

template in control RT-PCRs. As shown in Fig. 5, we could amplify FV-specific RNAs after precipitation with Halo-ANP32A/B and -HuR, but not with the Halo protein alone. In addition, neither Halo alone nor any of the Halo-tagged pro-teins precipitated GAPDH RNA. The Halo-HuR and -ANP32A/B expression was monitored by Western blotting (Fig. 5B). The strong PCR products after ANP32B transfec-tion prompted us to analyze whether higher ANP32B levels would influence Gag expression (Fig. 5C). This Western blot-ting analyses of increasing amounts of pHt-ANP32B showed

that indeed Gag expression is ANP32B dependent (2␮g of the

pHt vector was transfected as a control). Similar titrations of ANP32A and HuR did not result in significantly higher Gag levels (data not shown).

This result suggested that PFV mRNA exists in a complex with HuR and both ANP32A and -B and that this complex may be responsible for PFV unspliced mRNA nuclear export. To substantiate this assumption, additional experiments employ-ing siRNAs were performed.

Essential role of ANP32A/B and HuR for nuclear export of unspliced PFV mRNA.Two different siRNAs (siRNA1 and -2)

to downregulate the expression ofanp32Awere designed. The

transfection with specifically targeted siRNA1, but not with an unspecific control siRNA, led to a reduction in amounts of ANP32A, as detected by immunoblotting (Fig. 6A). As shown in Fig. 6A, the generation of normal levels of PFV Gag protein depended on normal levels of ANP32A. To prove that the reduction in Gag expression was due to a specific siRNA-mediated effect, we generated an ANP32A clone

(pcANP32A-⌬3⬘UTR), not targeted by the siRNA1. Reconstitution of

ANP32A expression in treated cells with this

siRNA-insensitive clone restored thegagexpression to wild-type levels

(Fig. 6A).

To analyze whether this effect was due to a nuclear cytoplas-mic transport defect of the unspliced PFV transcript, the

rel-ative amounts of unspliced PFV transcripts in nuclear and cytoplasmic fractions were analyzed by Northern blotting with

a gag gene-specific probe after cotransfection of cells with

either ANP32A-specific siRNAs or control siRNA and pcHSRV2. The result presented in Fig. 6B revealed that while large amounts of PFV RNA were detected in nuclear fractions, the use of the ANP32A siRNAs led to a significant reduction in its cytoplasmic accumulation, while the unrelated siRNA was not able to prevent the detection of full-length PFV mRNA in the cytoplasm. Furthermore, the cytoplasmic levels of the cellular GAPDH mRNA remained unchanged by using the specific siRNAs, indicating an ANP32A-independent nu-clear export of this mRNA (Fig. 6B).

During this study, we discovered that ANP32A also interacts with the viral transactivator Tas. The ANP32A siRNA treat-ment led to a decrease in transactivation of the PFV IP by Tas

(our unpublished observation). Therefore, and because thebet

mRNA levels are generally low in HEK 293T cells (see above), this mRNA was hardly detectable in both the total and cyto-plasmic fractions (data not shown). However, to exclude

influ-ences on the CMV promoter drivinggag gene expression of

pcHSRV2, we cotransfected the cells with pEGFP. Levels of EGFP mRNA were not altered by siRNA treatment (Fig. 6B), demonstrating that the CMV promoter activity and the nuclear export of mRNA coding for EGFP are not ANP32A depen-dent.

To analyze this involvement, ANP32B-specific siRNAs were designed that efficiently inhibited ANP32B mRNA translation (Fig. 6C). The siRNAs were used for cotransfection of HEK 293T cells together with pcHSRV2 and pEGFP. Lysates were prepared and analyzed for the presence of PFV Gag and EGFP. Figure 6C illustrates that the detection of PFV Gag protein was ANP32B dependent, while amounts of EGFP were unaffected, likely because the EGFP mRNA is using a different nuclear export pathway. To exclude unspecific side effects of

FIG. 5. Detection of HuR and ANP32A and -B in a complex with PFV RNA was suggestive of a functional role of these proteins in nuclear export of viral mRNA. (A) RT-PCR results with PFVpol-or GAPDH gene-specific primers to amplify approximately 500 bp of PFV or GAPDH sequences from 10% of the input lysate or after precipitation of complexes with Halo-tagged HuR, ANP32A (32A), and ANP32B (32B) proteins or with Halo (pHt) alone. (B) The Halo-tagged HuR and ANP32A/B expression was monitored by Western blotting with a Halo-specific antibody. (C) Effects of ANP32B overexpression on Gag levels. 293T cells were cotransfected with pcHSRV2 and increasing amounts of pHt-ANP32B or with 2␮g of the pHt vector as a control.

on November 7, 2019 by guest

http://jvi.asm.org/

the siRNA treatment, we used an ANP32-specific siRNA and constructed an siRNA-insensitive ANP32B mutant clone

(pcANP32B-⌬3⬘UTR), lacking the siRNA-targeted 3⬘UTR of

ANP32B. While again Gag protein in ANP32B siRNA-treated cells was significantly reduced, the reconstitution of ANP32B by cotransfection of siRNA-treated cells with

pcANP32B-⌬3⬘UTR and pcHRSV2 did indeed restore PFVgaggene

ex-pression to wild-type levels (Fig. 6C). GAPDH exex-pression was analyzed by immunoblotting as a loading control and remained unchanged irrespective of the siRNA treatment. This result was highly suggestive of both proteins ANP32A and -B essen-tially contributing to the cytoplasmic export out of the nucleus of unspliced PFV mRNA.

ANP32A and -B do not posses RNA-binding motifs, but both are known adapter proteins with functional NESs. They interact with CRM1 on the one side and the RNA-binding shuttle protein HuR on the other (23, 24, 57). The latter is involved in protecting mRNAs with AU-rich elements (AREs)

in their 3⬘UTR from rapid cytoplasmic degradation by

coun-teracting the degradation-enhancing activity of other ARE-binding proteins (24). Thus, HuR has a strong protective effect on certain cellular mRNAs (24). To substantiate the finding that HuR is indeed involved in nuclear-cytoplasmic shuttling of unspliced PFV mRNA, we cotransfected cells with pcHSRV2 and an HuR siRNA or an unrelated siRNA as a control. As illustrated in Fig. 6D, only the specific siRNA led to down-regulation of HuR and PFV Gag protein, whereas the detec-tion of GAPDH protein remained unaffected, as was the de-tection of the EGFP mRNA derived from the pEGFP plasmid, which was used for cotransfection of cells.

DISCUSSION

In this report, we describe the identification and partial characterization of a novel retroviral RNA export pathway. So far, two independent mechanisms for nuclear RNA export of incompletely spliced retroviral RNAs have been described in detail. One is specified as CTE and NXF1/NXT1 dependent, while the other is virus-encoded regulatory protein and re-sponse element and CRM1 dependent. FVs appear to make use of a third distinctive pathway that has acquired features of both previously characterized nuclear exit strategies. The PFV pathway is CRM1 dependent without involving a virus-en-coded regulatory protein. Instead, incompletely spliced PFV mRNA appears to be transported into the cytoplasm by con-tacting the cellular RNA-binding shuttle protein HuR and

FIG. 6. Dependence of PFV gag mRNA nuclear export on ANP32A (A and B), ANP32B (C), and HuR (D), as revealed by siRNA inhibition experiments. The experiments in panels A, C, and D are shown in duplicates. (A) siRNA1 abrogates ANP32A and PFV Gag protein expression, in contrast to unspecific control siRNA and rescue of Gag detection by reconstitution of ANP32A expression in siRNA1-treated cells with an siRNA-insensitive clone (⌬3⬘UTR). Analysis of GAPDH expression served as a loading control. (Both panels were derived from the same gel.) (B) ANP32A siRNA1 and -2 led to nuclear retention of unspliced PFV RNA. HEK 293T cells were transfected with pcHSRV2 and the indicated siRNAs, and nuclear (Nucl.) and cytoplasmic (Cyto.) fractions were prepared and analyzed by Northern blotting for PFV RNA with agaggene-derived probe. An rRNA loading control was used for the nuclear fraction, and GAPDH or EGFP was used for hybridization for loading and transfection effi-ciency control of the cytoplasmic (cyto.) fraction. Two different expo-sures of the cytoplasmic gag Northern blot are shown; the shorter exposure corresponds to the upper panel. (C) Detection of PFV Gag requires ANP32B. HEK 293T cells were transfected with siRNA4 targeting ANP32B or an irrelevant control siRNA, pcHSRV2, and

pEGFP. Cellular lysates were analyzed for ANP32B, PFV Gag, and EGFP by immunoblotting. The additional ANP32B-specific siRNA4 also downregulated PFV Gag protein detection, while this was re-stored with an untargeted ANP32B clone (⌬3⬘UTR) and siRNA4. Analysis of GAPDH and EGFP expression served as a loading, spec-ificity, and transfection control. (D) Role of the cellular RNA-binding protein HuR for the expression of structural PFV proteins. HT1080 cells were cotransfected with siRNA5 targeting HuR mRNA or an irrelevant siRNA (control), pcHSRV2, and pEGFP. Cellular lysates were prepared and analyzed for HuR, PFV Gag, GAPDH, and EGFP by immunoblotting. The PFV lane contains lysate from a culture in-fected with PFV.

on November 7, 2019 by guest

http://jvi.asm.org/

further adapter molecules. Although formal proof is still lack-ing, our results suggest a direct contact between HuR and supposedly PFV-specific HuR-interacting RNA elements. HuR has been shown previously to bind to a region of 150 nt adopting a stable RNA stem-loop in the CD83 mRNA (57). This interaction results in CRM1-dependent nuclear export (57).

However, the secondary structure involved in the CD83 mRNA-HuR interaction (57) is not present in the PFV ge-nome, suggesting a different mode of binding. Furthermore, contrary to a previous study on the nuclear export of CD83 mRNA that indicated the requirement of only ANP32B (26), the results presented here strongly suggest the essential in-volvement of both adapter proteins ANP32A (pp32) and ANP32B (April), in facilitating nuclear export of unspliced PFV mRNA. Especially overexpression of ANP32B resulted in higher cellular Gag levels (Fig. 5C), indicating that ANP32B might be a limiting factor for Gag expression.

For the MLV-related intracisternal A-type particle (IAP), an RNA element (IAPE) has been described that maps to the

3⬘polgene region (73). IAPE was found to be required for IAP

gaggene expression and also allowed the expression of HIV-1

gag independently of the Rev/RRE pathway (73).

Conse-quently, IAPE-mediated nuclear export of viral RNA de-pended on NXF1/NXT1 and was independent of CRM1 (73).

A structural and functional homology between a PFVpolgene

fragment and IAPE was noted, the PFV fragment was shown

to facilitate HIV-1gaggene expression, and a CTE for PFV

was suggested (73). However, our results strongly indicate that the PFV-specific nuclear export pathway is CRM1 dependent, suggesting that more than one RNA element in the PFV ge-nome may exist to direct the nuclear export of unspliced mRNA by using alternative pathways or that the proposed CTE acts differently, as suggested in reference 73.

This study shows that the unspliced gag mRNA of PFV

makes use of the newly identified nuclear export pathway. Although we did not investigate this point in detail, it is likely

that this also applies to the singly splicedpolandenvmRNAs,

because additional and, during viral replication, often used SD-SA pairs are present within and downstream of these genes

(Fig. 1). In addition, the export of the PFVenvmRNA is LMB

sensitive (Fig. 2), supporting a CRM1-dependent export path-way and suggesting an (additional) HuR binding motif

con-tained in the env mRNA. This point should be resolved by

future experiments.

FVs make use of a replication strategy that functionally bridges that of orthoretroviruses and hepadnaviruses (41, 43, 61), with respect to the way nuclear RNA export hepadnavi-ruses make use of various pathways (68). While posttranscrip-tional regulatory elements (PREs) have been identified in both the human and woodchuck hepatitis B viruses (HPRE and WPRE, respectively), their modes of action appear to be dif-ferent, and the cellular proteins interacting with the elements are elusive (68). The nuclear export pathway specified by HPRE is CRM1 independent, and the pathway specified by WPRE depends on CRM1 (54, 56). However, both elements adopt an elaborated secondary structure (21, 55, 67, 73), and it remains to be seen where a probably structured element inter-acting with nuclear export factors is located within the FV (pre-) genome.

In complex orthoretroviruses, the use of the CRM1-depen-dent and virus-encoded posttranscriptional regulatory protein plus regulatory RNA element-dependent pathway serves at least the following four functions. (i) It enables the virus to differentially regulate its gene expression (16). As described above, FVs accomplish this by using two viral promoters (44). (ii) It facilitates the nuclear export of unspliced and singly spliced mRNAs, which would otherwise be retained and de-graded (18). FVs appear to make use of the newly discovered mRNA export pathway to do this. (iii) It specifically speeds up the nuclear export of certain viral mRNAs by using a different NXF1/NXT1-independent pathway that might not be satu-rated by cellular mRNAs (38). FVs might also benefit from using an alternative CRM1-dependent pathway. Finally, (iv) evidence has been presented that at least in the Rev-RRE interaction of HIV-1 mRNAs encoding the structural proteins, there exists an enhancement effect on translational, in addition to the nuclear export component (20, 40). By exploitation of the HuR-mediated nuclear export of mRNA, FVs appear to have found an elegant way to translate their structural mRNAs preferentially over cellular mRNAs.

HuR had been described initially as a protein protecting certain cellular mRNAs from degradation and enhancing their cytoplasmic translation (24). An additional function in medi-ating the nuclear export of rare cellular mRNAs emerged only recently (57). Although far from being completely analyzed, the finding that structural gene expression of a retroviral sub-family member completely relies on HuR now points to the importance of what has so far been regarded as the minor function of this cellular protein.

ACKNOWLEDGMENTS

We thank J. Hauber and J. Chemnitz for the precious ANP32B antiserum, J. Bohne and H.-G. Kra¨usslich for plasmids, and Melanie Wunram for technical assistance.

This work was supported in part by DFG grants (SFB479, RE627/7, RE627/8, and BO3006/1-2).

REFERENCES

1.Ahmed, Y. F., S. M. Hanly, M. H. Malim, B. R. Cullen, and W. C. Greene. 1990. Structure-function analyses of the HTLV-I Rex and HIV-1 Rev RNA response elements: insights into the mechanism of Rex and Rev action. Genes Dev.4:1014–1022.

2.Ausubel, F. M., et al.1987. Current protocols in molecular biology. John Wiley, New York, NY.

3.Basyuk, E., S. Boulon, F. Skou Pedersen, E. Bertrand, and S. Vestergaard Rasmussen.2005. The packaging signal of MLV is an integrated module that mediates intracellular transport of genomic RNAs. J. Mol. Biol.354:330– 339.

4.Baunach, G., B. Maurer, H. Hahn, M. Kranz, and A. Rethwilm.1993. Functional analysis of human foamy virus accessory reading frames. J. Virol. 67:5411–5418.

5.Bieniasz, P. D., O. Erlwein, A. Aguzzi, A. Rethwilm, and M. O. McClure. 1997. Gene transfer using replication-defective human foamy virus vectors. Virology235:65–72.

6.Bodem, J., et al.2000. TIF-IA, the factor mediating growth-dependent con-trol of ribosomal RNA synthesis, is the mammalian homolog of yeast Rrn3p. EMBO Rep.1:171–175.

7.Bodem, J., Y. Kang, and R. M. Flu¨gel.2004. Comparative functional char-acterization of the feline foamy virus transactivator reveals its species spec-ificity. Virology318:32–36.

8.Bodem, J., M. Lo¨chelt, H. Delius, and R. M. Flu¨gel.1998. Detection of subgenomic cDNAs and mapping of feline foamy virus mRNAs reveals complex patterns of transcription. Virology244:417–426.

9.Bodem, J., et al.1996. Characterization of the spliced pol transcript of feline foamy virus: the splice acceptor site of the pol transcript is located in gag of foamy viruses. J. Virol.70:9024–9027.

10.Bodem, J., M. Zemba, and R. M. Flu¨gel.1998. Nuclear localization of the

on November 7, 2019 by guest

http://jvi.asm.org/

functional Bel 1 transactivator but not of the gag proteins of the feline foamy virus. Virology251:22–27.

11.Bogerd, H. P., A. Echarri, T. M. Ross, and B. R. Cullen.1998. Inhibition of human immunodeficiency virus Rev and human T-cell leukemia virus Rex function, but not Mason-Pfizer monkey virus constitutive transport element activity, by a mutant human nucleoporin targeted to Crm1. J. Virol.72:8627– 8635.

12.Bogerd, H. P., H. L. Wiegand, J. Yang, and B. R. Cullen.2000. Mutational definition of functional domains within the Rev homolog encoded by human endogenous retrovirus K. J. Virol.74:9353–9361.

13.Bohne, J., and H. Kra¨usslich.2004. Mutation of the major 5⬘ splice site renders a CMV-driven HIV-1 proviral clone Tat-dependent: connections between transcription and splicing. FEBS Lett.563:113–118.

14.Caporale, M., et al.2009. The signal peptide of a simple retrovirus envelope functions as a posttranscriptional regulator of viral gene expression. J. Virol. 83:4591–4604.

15.Cigler, P., et al.2005. From nonpeptide toward noncarbon protease inhib-itors: metallacarboranes as specific and potent inhibitors of HIV protease. Proc. Natl. Acad. Sci. U. S. A.102:15394–15399.

16.Cullen, B. R.1991. Human immunodeficiency virus as a prototypic complex retrovirus. J. Virol.65:1053–1056.

17.Cullen, B. R.2003. Nuclear mRNA export: insights from virology. Trends Biochem. Sci.28:419–424.

18.Cullen, B. R.2003. Nuclear RNA export. J. Cell Sci.116:587–597. 19.Cullen, B. R.2002. Using retroviruses to study the nuclear export of mRNA.

Results Probl. Cell Differ.35:151–168.

20.D’Agostino, D. M., B. K. Felber, J. E. Harrison, and G. N. Pavlakis.1992. The Rev protein of human immunodeficiency virus type 1 promotes poly-somal association and translation of gag/pol and vpu/env mRNAs. Mol. Cell. Biol.12:1375–1386.

21.Donello, J. E., J. E. Loeb, and T. J. Hope.1998. Woodchuck hepatitis virus contains a tripartite posttranscriptional regulatory element. J. Virol. 72: 5085–5092.

22.Enssle, J., I. Jordan, B. Mauer, and A. Rethwilm.1996. Foamy virus reverse transcriptase is expressed independently from the Gag protein. Proc. Natl. Acad. Sci. U. S. A.93:4137–4141.

23.Fan, X. C., and J. A. Steitz.1998. HNS, a nuclear-cytoplasmic shuttling sequence in HuR. Proc. Natl. Acad. Sci. U. S. A.95:15293–15298. 24.Fan, X. C., and J. A. Steitz. 1998. Overexpression of HuR, a

nuclear-cytoplasmic shuttling protein, increases the in vivo stability of ARE-contain-ing mRNAs. EMBO J.17:3448–3460.

25.Fischer, N., et al.1998. Foamy virus particle formation. J. Virol.72:1610– 1615.

26.Fries, B., et al.2007. Analysis of nucleocytoplasmic trafficking of the HuR ligand APRIL and its influence on CD83 expression. J. Biol. Chem.282: 4504–4515.

27.Gorlich, D., and U. Kutay.1999. Transport between the cell nucleus and the cytoplasm. Annu. Rev. Cell Dev. Biol.15:607–660.

28.Gruter, P., et al.1998. TAP, the human homolog of Mex67p, mediates CTE-dependent RNA export from the nucleus. Mol. Cell1:649–659. 29.Hanly, S. M., et al.1989. Comparative analysis of the HTLV-I Rex and

HIV-1 Rev trans-regulatory proteins and their RNA response elements. Genes Dev.3:1534–1544.

30.Heinkelein, M., et al. 2002. Improved primate foamy virus vectors and packaging constructs. J. Virol.76:3774–3783.

31.Heinkelein, M., et al.1998. Characterization of a cis-acting sequence in the Pol region required to transfer human foamy virus vectors. J. Virol.72:6307– 6314.

32.Imrich, H., M. Heinkelein, O. Herchenro¨der, and A. Rethwilm.2000. Pri-mate foamy virus Pol proteins are imported into the nucleus. J. Gen. Virol. 81:2941–2947.

33.Indik, S., W. H. Gunzburg, B. Salmons, and F. Rouault.2005. A novel, mouse mammary tumor virus encoded protein with Rev-like properties. Virology337:1–6.

34.Jordan, I., J. Enssle, E. Guttler, B. Mauer, and A. Rethwilm.1996. Expres-sion of human foamy virus reverse transcriptase involves a spliced pol mRNA. Virology224:314–319.

35.Kang, Y., W. S. Blair, and B. R. Cullen.1998. Identification and functional characterization of a high-affinity Bel-1 DNA binding site located in the human foamy virus internal promoter. J. Virol.72:504–511.

36.Kang, Y., H. P. Bogerd, and B. R. Cullen.2000. Analysis of cellular factors that mediate nuclear export of RNAs bearing the Mason-Pfizer monkey virus constitutive transport element. J. Virol.74:5863–5871.

37.Kang, Y., H. P. Bogerd, J. Yang, and B. R. Cullen.1999. Analysis of the RNA binding specificity of the human tap protein, a constitutive transport ele-ment-specific nuclear RNA export factor. Virology262:200–209. 38.Kang, Y., and B. R. Cullen.1999. The human Tap protein is a nuclear

mRNA export factor that contains novel RNA-binding and nucleocytoplas-mic transport sequences. Genes Dev.13:1126–1139.

39.Keller, A., et al.1991. Characterization of the transcriptional trans activator of human foamy retrovirus. J. Virol.65:2589–2594.

40.Lawrence, J. B., A. W. Cochrane, C. V. Johnson, A. Perkins, and C. A. Rosen.

1991. The HIV-1 Rev protein: a model system for coupled RNA transport and translation. New Biol.3:1220–1232.

41.Lecellier, C. H., and A. Saib.2000. Foamy viruses: between retroviruses and pararetroviruses. Virology271:1–8.

42.Li, Y., et al.2006. An intron with a constitutive transport element is retained in a Tap messenger RNA. Nature443:234–237.

43.Linial, M. L.2007. Foamy viruses. Lippincott Williams & Wilkins, Philadel-phia, PA.

44.Lo¨chelt, M.2003. Foamy virus transactivation and gene expression. Curr. Top. Microbiol. Immunol.277:27–61.

45.Lo¨chelt, M., M. Aboud, and R. M. Flu¨gel.1993. Increase in the basal tran-scriptional activity of the human foamy virus internal promoter by the ho-mologous long terminal repeat promoter in cis. Nucleic Acids Res.21:4226– 4230.

46.Lo¨chelt, M., W. Muranyi, and R. M. Flu¨gel.1993. Human foamy virus genome possesses an internal, Bel-1-dependent and functional promoter. Proc. Natl. Acad. Sci. U. S. A.90:7317–7321.

47.Lo¨wer, R., R. R. To¨njes, C. Korbmacher, R. Kurth, and J. Lo¨wer.1995. Identification of a Rev-related protein by analysis of spliced transcripts of the human endogenous retroviruses HTDV/HERV-K. J. Virol.69:141–149. 48.Malim, M. H., J. Hauber, R. Fenrick, and B. R. Cullen.1988.

Immunode-ficiency virus rev trans-activator modulates the expression of the viral regu-latory genes. Nature335:181–183.

49.Mertz, J. A., M. S. Simper, M. M. Lozano, S. M. Payne, and J. P. Dudley. 2005. Mouse mammary tumor virus encodes a self-regulatory RNA export protein and is a complex retrovirus. J. Virol.79:14737–14747.

50.Moebes, A., et al.1997. Human foamy virus reverse transcription that occurs late in the viral replication cycle. J. Virol.71:7305–7311.

51.Muranyi, W., and R. M. Flu¨gel.1991. Analysis of splicing patterns of human spumaretrovirus by polymerase chain reaction reveals complex RNA struc-tures. J. Virol.65:727–735.

52.Niranjanakumari, S., E. Lasda, R. Brazas, and M. Garcia-Blanco.2002. Reversible cross-linking combined with immunoprecipitation to study RNA-protein interactions in vivo. Methods26:182–190.

53.Ohno, M., M. Fornerod, and I. W. Mattaj.1998. Nucleocytoplasmic trans-port: the last 200 nanometers. Cell92:327–336.

54.Otero, G. C., M. E. Harris, J. E. Donello, and T. J. Hope.1998. Leptomycin B inhibits equine infectious anemia virus Rev and feline immunodeficiency virus rev function but not the function of the hepatitis B virus posttranscrip-tional regulatory element. J. Virol.72:7593–7597.

55.Patzel, V., and G. Sczakiel.1997. The hepatitis B virus posttranscriptional regulatory element contains a highly stable RNA secondary structure. Bio-chem. Biophys. Res. Commun.231:864–867.

56.Popa, I., M. E. Harris, J. E. Donello, and T. J. Hope.2002. CRM1-dependent function of a cis-acting RNA export element. Mol. Cell. Biol.22:2057–2067. 57.Prechtel, A. T., et al.2006. Expression of CD83 is regulated by HuR via a novel cis-active coding region RNA element. J. Biol. Chem. 281:10912– 10925.

58.Rabson, A. B., and B. J. Graves.1997. Synthesis and processing of viral RNA, p. 205–261.InJ. M. Coffin, S. H. Hughes, and H. E. Varmus (ed.), Retro-viruses. Cold Spring Harbor Laboratory Press, Plainview, NY.

59.Reed, R.2003. Coupling transcription, splicing and mRNA export. Curr. Opin. Cell Biol.15:326–331.

60.Renault, N., A. Coiffic, and A. Saib. 2008. L’export nucle´aire des ARN messagers re´troviraux. Virologie12:429–437.

61.Rethwilm, A.2005. Foamy viruses, p. 1304–1321.InB. W. J. Mahy and V. ter Meulen (ed.), Topley & Wilson’s microbiology and microbial infections— virology, 10th ed., vol. 2. Hodder Arnold, London, United Kingdom. 62.Rethwilm, A., O. Erlwein, G. Baunach, B. Maurer, and V. ter Meulen.1991.

The transcriptional transactivator of human foamy virus maps to the bel 1 genomic region. Proc. Natl. Acad. Sci. U. S. A.88:941–945.

63.Rodriguez, M. S., C. Dargemont, and F. Stutz.2004. Nuclear export of RNA. Biol. Cell96:639–655.

64.Sambrook, J., and D. W. Russell.2001. Molecular cloning: a laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

65.Schenk, T., J. Enssle, N. Fischer, and A. Rethwilm.1999. Replication of a foamy virus mutant with a constitutively active U3 promoter and deleted accessory genes. J. Gen. Virol.80:1591–1598.

66.Schliephake, A. W., and A. Rethwilm.1994. Nuclear localization of foamy virus Gag precursor protein. J. Virol.68:4946–4954.

67.Smith, G. J., III, J. E. Donello, R. Luck, G. Steger, and T. J. Hope.1998. The hepatitis B virus post-transcriptional regulatory element contains two con-served RNA stem-loops which are required for function. Nucleic Acids Res. 26:4818–4827.

68.Sommer, G., and T. Heise.2008. Posttranscriptional control of HBV gene expression. Front. Biosci.13:5533–5547.

69.Stirnnagel, K., et al.2010. Analysis of prototype foamy virus particle-host cell interaction with autofluorescent retroviral particles. Retrovirology7:45. 70.Vinciguerra, P., and F. Stutz.2004. mRNA export: an assembly line from

genes to nuclear pores. Curr. Opin. Cell Biol.16:285–292.

on November 7, 2019 by guest

http://jvi.asm.org/

71.Weis, K.2003. Regulating access to the genome: nucleocytoplasmic trans-port throughout the cell cycle. Cell112:441–451.

72.Wiegand, H. L., et al.2002. Formation of Tap/NXT1 heterodimers activates Tap-dependent nuclear mRNA export by enhancing recruitment to nuclear pore complexes. Mol. Cell. Biol.22:245–256.

73.Wodrich, H., J. Bohne, E. Gumz, R. Welker, and H. G. Kra¨usslich.2001. A new RNA element located in the coding region of a murine endogenous retrovirus can functionally replace the Rev/Rev-responsive element system in human immunodeficiency virus type 1 Gag expression. J. Virol.75:10670– 10682.

74.Yang, J., et al.1999. An ancient family of human endogenous retroviruses

encodes a functional homolog of the HIV-1 Rev protein. Proc. Natl. Acad. Sci. U. S. A.96:13404–13408.

75.Yu, S. F., et al.1996. The carboxyl terminus of the human foamy virus Gag protein contains separable nucleic acid binding and nuclear transport do-mains. J. Virol.70:8255–8262.

76.Yu, S. F., and M. L. Linial.1993. Analysis of the role of the bel and bet open reading frames of human foamy virus by using a new quantitative assay. J. Virol.67:6618–6624.

77.Zolotukhin, A. S., D. Michalowski, S. Smulevitch, and B. K. Felber.2001. Retroviral constitutive transport element evolved from cellular TAP(NXF1)-binding sequences. J. Virol.75:5567–5575.

on November 7, 2019 by guest

http://jvi.asm.org/