Polymerase chain reaction analysis of defective human T-cell leukemia virus type I proviral genomes in leukemic cells of patients with adult T-cell leukemia.

(1)

0022-538X/91/105471-06$02.00/0

Polymerase

Chain

Reaction Analysis

of

Defective

Human

T-Cell

Leukemia Virus

Type I

Proviral Genomes

in

Leukemic

Cells of Patients with Adult T-Cell Leukemia

BETTE

KORBER,lt

AKIHIKOOKAYAMA,"2RACHELDONNELLY,1 NOBUYOSHI TACHIBANA,2

AND MYRON

ESSEX'*

Department of Cancer Biology, Harvard School of Public Health, 665Huntington Avenue, Boston, Massachusetts02115,'

and Second

Department

of

Medicine,

Miyazaki

Medical

School,

Miyazaki

889-16,

Japan2

Received 18March1991/Accepted21June 1991

Human T-cell leukemia virus type I(HTLV-I) is the etiologic agent of adult T-cell leukemia, and the clonally derived leukemic cells all contain proviral genomes. Polymerase chain reaction with a variety of primers which span the HTLV-Igenome was used to determine that a significant fraction of patients (at least 32%) carry

deletedviral genomes in their leukemic cells. The pX region of the HTLV-I genome encoding the regulatory

genes tax and rex was preferentially retained. The fact that the tax coding region was retained provides supportingevidence that the tax protein contributes to leukemogenesis in vivo. The reasonablyhigh fractionof patients with adult T-cell leukemia carrying deleted genomes in their tumor cells suggests that the deletions have a role inleukemogenesis.

The human T-cell leukemiavirus type I (HTLV-I) is the causative agent of the human neoplasm adult T-cell leukemia (ATL) (13, 24, 37). The infection of a target cell with the virus is a prerequisite for transformation and the develop-mentof ATL. TheHTLV-Igenomecontains viral structural genes as well as the regulatory proteins Tax and Rex,

encodedin the pXregion ofHTLV-I(12, 19, 27, 32). The pX

region isexpressed as adoubly spliced mRNA with tax and rexutilizing two overlapping open reading frames (28). Tax acts in conjunction with cellular proteins (15, 26, 34) to

transactivate transcription from the HTLV long terminal

repeat (LTR) (7, 29, 33), as well as from cellular promoters

(4, 20,21, 25, 36, 38). Rex is aposttranscriptionalregulatory

protein that shifts viral mRNA expression from the doubly

spliced form that encodes Tax and Rex to the single and

nonspliced forms that encode the viral structural genes (5,

14).

The HTLV-I genome contains no homolog of a cellular proto-oncogene (27), and because HTLV-I does not inte-grate atpreferential sites inthe human genome,insertional

mutagenesis resultinginproviral activation ofacellulargene

is notalikelytrigger for developingATL(39). Because there

isa long latency from timeofinfectiontodisease

manifes-tationandalowlifetimeriskofgettingATLifinfectedwith

the virus, a multistep process is probably required for

oncogenesis (22). The Tax protein has been strongly

impli-catedintumorigenesis, although its precise role remains to

be elucidated. Taxexpressedfromanexpressionvectorwith the rest ofthe HTLV genome deleted is capable of

trans-forming cells in vitro (10, 35). Itcanstimulate expression of

the

lymphokine

interleukin-2 (IL-2) and the IL-2 receptor

alphachain,aswellasadditional lymphokinesand thec-fos

gene (4, 14, 20, 21, 25). Taxmayalso influence

transforma-tionthrough itscapacity to

down-regulate

beta-polymerase,

a cellular enzyme involved in host cell DNA

repair,

thus

possibly increasingthe mutation rate ininfected cells (16).

*Corresponding author.

tPresentaddress: TheoryDivision, T-10, LosAlamosNational Laboratory, LosAlamos, NM87545.

Defective HTLV-I genomes with largedeletions have been

detected in leukemic cells from patients with ATL (31, 35, 39), and inseveralcasesitwas shown that the pX regionof

the HTLV-I genome was retained (35, 39). Despite the

evidence associating tax with oncogenesis, only very low levelsofthetaxmRNA aredetected in vivo in ATL cells. In most cases, it was not detected by Northern- (RNA) blot

analysis (8) and was found in extremely low levels by

enzymaticamplificationbypolymerase chain reaction(PCR)

(17). Therefore, it has beensuggestedthattaxexpressionis

acritical component in the initiationof transformationbut is

notimportantin maintainingtumorgrowth (8).

PCRcan be usedsemiquantitativelytoestimate the

num-berofprovirusespresentinvivo(1). Weusedthistechnique

toshow that deleted HTLV genomespreferentiallyretaining

the pX region and 3' LTR are frequently found (in at least

32% ofthepatients withATLtested)in theleukemic cells of

patients with ATL.

MATERIALSANDMETHODS

Blood samplesand DNAextractions. Blood samples were

collected from 23patients withATLor

lymphoma

from the

Miyazaki Medical School, Miyazaki, Japan.

Peripheral

blood mononuclearcells

(PBMCs)

wereisolated from fresh

whole-blood samples by Ficoll-Hypaque separation and

washed twice in phosphate-buffered saline, and the pellet wasstoredat

-70°C

untilthe DNAwasextracted. Threeto

five HTLV-negative blood samples were obtained from a

Boston blood donorcenterandwere includedin each setof

DNA preparations to serve as negative controls for PCR.

ChromosomalDNA wasisolatedby sodium

dodecyl

sulfate

(SDS)-proteinase

K digestions of the cells at

56°C

and then

by

phenol-chloroform

extractions and ethanol

precipitation

ofDNA

(31).

DNA was

resuspended

in lx TE

(10

mMTris

[pH 7.8], 1 mM EDTA) by rocking for 24to 48 h at room

temperature, and DNA concentrations were determined

by

measuring the absorbance ratioof 260/280nm. HUT102cells (24) were used as an

HTLV-I-positive

control,

and HUT78

cells(9, 23)wereusedas an

HTLV-I-negative

control.DNA

5471

on November 10, 2019 by guest

http://jvi.asm.org/

(2)

was extracted in a tissue culture facility in an area separate from that where the PCR products were analyzed.

Amplification of DNA. A 2-,ug portion of PBMC DNA was typically used peramplification reaction (there are approxi-mately 140,000 human genomeequivalents in 1

,ig

of DNA). Each PCR experiment included a set of negative control DNAs that had been coextracted with the ATL DNA, a negative control with DNA from the uninfected cell line HUT78, and a reaction with cocktail only and no added DNA. In addition, a 10-fold dilution series was included in each set with serial dilutions of HTLV-I-infected HUT102 cell DNA diluted in a background of 2 ,ug of uninfected HUT78 DNA to determine the sensitivity of each experi-ment. (The number of HTLV-I genomes per cell in our

HUT102culture was estimated bycomparing theintensityof

the PCRamplification product signals from serial dilutions of

HUT102 cells with dilutions of a known number of

mole-cules of the HTLV-bearing plasmid pMT2, cut with the restriction enzyme PstI. Using this method, we estimated that there were seven HTLV-I genomes perHUT102 cell.) The MgCl2 and primerconcentrations were optimized for eachprimer pair.Amplification reactions containedtemplate DNA, 1.25 mM of each deoxynucleoside triphosphate, 50 mM KCl, 10 mM TrisHCI (pH 8.3), 1.5 to 4 (usually 2.5) mM

MgCl2,and 0.2 to 1 ,uMeach primer in a

100-plI

totalvolume.

Reaction mixtures were heated to 95°C for 3 min and then cycled 39 times for 1 min at 95°C, 45 s at 55°C, and 30 s at 720C, using an MJResearchthermocycler. The primer pairs had a range ofsensitivities even when optimized. All PCR experiments were assayed by viewing the product on an ethidium bromide-stained gel to ascertain that the appropri-ate-sized PCR product gave the predominant band, coupled with a dot-blot assay (3).

PCR primers and probes. Allprimers gave a strong distinct band of the appropriate molecular weight on an ethidium bromide-stained gel that reacted specifically with the appro-priate oligonucleotide probe when analyzed by Southern blotting with HUT102 cell DNA as a template (with the exception of the primers that go across the splice site). The following list of primers either gives a reference or, if the primers are described here for the first time, the 5'-3' sequence of the oligonucleotides used and the bases which define theouterboundaries of the amplified region. The base numbers correspond to the GenBank sequence, accession number J02029. Primers SK43 and SK44 amplify from the tax region and were probed with SK45 (18). SG231 and SG238 amplify from the pol region and were probed with SG232 (11). SG452 and SG453 amplify from the env region and were probed with SG228 (11). (SG452 and SG453 are essentially equivalent to SG221 and SG227, respectively, in Greenberg et al. [11], except SG452 and SG453 are both lacking the first three 5' bases ofSG221 and SG227.) Primers RM3 andRM4 amplify from the LTRs (bases 420 to 720) and were probed with RM3/4: RM3, GCCATCCACGCCGGT

TGAGTCGCGTTCTGC; RM4, CCAACGGAGTCGCCGG

TACTTGGCCGTGGG; RM3/4, GTGCCTCCTGAACTGC

TGCTGCCGCCGTCTAGG. Primers BKgagl and BKgag2

amplify across the border of the 5' LTR in the gag region (bases 660 to 910) and were probed with RM4: BKgagl,

CCCTTTCATTCACGACTGACTGCCGGCTTG;

BKgag2,

CTGGAGGAAGTTAAGCCAGTGATGAGCGGC.

BKprol and BKpro2 amplify from theprotease region (bases 2180 to 2380) and were probed with BKprol/2: BKprol, CATTA

GATCCCGCCCGTCGGCCCG; BKpro2, GAGGTGAGCT

TAAAGTGATCTTGG; BKprol/2, GTTCTCAAGTAATA

CTCCCTCAAAAATACATCCGTATTAGG.

BKtaxl and

BKtax2

amplify

across theborder of the 3' LTR within the

tax gene

(bases

8101 to

8320)

and were

probed

with BK

taxl/2:

BKtaxl,

GGCCTAAAGATGGCCAGCCATCTTT

AG; BKtax2,

GGGGCTCATGGTCATTGTCATCTGCC;

BKtaxl/2,

TACTCTCACACGGCCTCATACAGTACTCTT

CCTTTC.

BKpoll

and

BKpol2 amplify

from the

pol

gene

(bases 3385 to 3505) and were

probed

with BKpoll/2: BK

poll, TACAAAGGCATACTGATCCC; BKpol2, CAGGGT

TTGGACTAGTCTA;

BKpoll/2,

AGTTCAATCATTAGTG

CAGCTGCGGCAGGCCCTGTCACAGAACTGCC. The

primerpairRM3and

spl

would

amplify

acrossthefirst

splice

junction

if cDNA made from a

properly spliced

mRNAwas

present(base421tothe

splice donor, splice

acceptortobase

5163) and were

probed

with

BKspll,

which crosses the

splice junction:

spl,

CCGACGGGTCTTGGGCATGCAGC

TCGC; BKspll, CGTCCGCCGTCTAGCTTCCTGGTC.

Southernblot and dotblot.

Hybridizations

were

performed

by standard

techniques

(3). Reinforced nitrocellulose

(Opti-bind; Schleicher&

Schuell)

wasused for

blotting,

and DNA

was bound to the nitrocellulose by using a Stratagene UV cross-linker. For dotblots, 30

p.l

of the 100-p.1 PCR

product

was used. Dot blots were probed with T4 polynucleotide

kinase

32P-end-labeled

oligonucleotideprobes. Stringencyof the wash was determined

empirically

foreach primer

pair-probe combination to ensure that the negative control

reac-tions did not give an inappropriate background.

Generally,

three20-minwashes in2x SSC(1x SSC is 0.15 MNaCl

plus

0.015 M sodium

citrate)-0.2%

SDS at55°C wereused. After

autoradiography, spotswere cutfromthe nitrocellulose, and

theirradioactivity was counted forquantitation. For

South-ernblotsofPCRproduct,20 p.1of thePCRproductwasused per lane and probed with oligonucleotide probes. Genomic Southern blots used 20 p.g of DNApurifiedfrom PBMCs and cut with PstI and were probed with the HTLV-I-bearing

plasmid pMT2radiolabeled with 32P by nick translation (3).

Quantitative PCR. For the more stringent

quantitation,

three PCR reactions were done on each patient sample,

using 10,000, 1,000,and 100cellequivalents ofinputDNAto

serve as the initial PCR template. The intensities of the

signals were compared with those of PCR reactions with

2,

20, 200, 2,000, 20,000, and 200,000 molecules of input

HTLV-I DNAina background of 10,000cell equivalents of DNA from HUT78 cells, each reaction done in triplicate.

Duplicatedot blots were performedfor each reaction. After

autoradiography, the spots were cut out and their

radioac-tivitywascounted, and the number of HTLV molecules ina

patient samplewasestimatedby comparisonwith the HTLV

dilutions.

RESULTS

DNA samples derived from PBMCs of nine patients with ATL (patients 1 to9, Table 1) were screened with a set of

eightPCRprimers that span the HTLV-I genome(Fig. 1). In

a semiquantitative assay in which the PCR signal amplified from 1 p.g of PBMC DNA was compared with 10-fold serial dilutions of HUT102 cell DNA, a trend became obvious: some samples gave strong PCR signals only from primers chosen from the 3' (pX or LTR) region of the genome and faintsignals from the gag-pol region (samples 2, 7, 8, and 9). Other samples (1, 3, 4, 5, and 6) gave strong signals from all parts of the HTLV-I genome. Strong signals would be expected because at least 10%of the PBMCs in patients with ATL are leukemic cells that carry the virus. This indicated that in fourof nine samples, the 5' gag andpol regions of the genome were deleted in the clonally derived

on November 10, 2019 by guest

http://jvi.asm.org/

(3)

[image:3.612.66.560.89.332.2]

TABLE 1. ClinicalstatusandPCR results from 23HTLV-1antibody-positive patients

Clinical PCR"

Patient

Healthstatusb Leukocytes/,ul %Ab' tax pro enm, LTR gag polBK polSG taxBK

1 ATL 214,200 80 40 100 80 ++ ++ ++ ++ ++

2 ATL 39,200 72 95 0.8 100 + + - + + + +

3 ATL 14,300 10 33 90 60 ++ ++ ++ ++ ++

4 ATL 25,800 21 68 82 60 ++ ++ ++ ++ ++

5 ATL 17,200 53 100 100 100 ++ ++ ++ ++ ++

6 ATL 80,500 78 100+ 100+ 100+ ++ +++ +++ +++ +++

7 ATL 188,800 87 100 6 7 + + + + ++

8 ATL 26,900 54 100 7 80 ++ ± + + ++

9 ATL 31,700 13 100 0 0 ++ - + + ++

10 Chronic 8,100 13 13 37 10 + + NT NT NT

11 ATL 279,600 >90 100 100 60 + + + + NT NT NT

12 ATL 33,000 25 67 67 60 + + + + NT NT NT

13 Smoldering 11,200 1 67 4 60 + + ± NT NT NT

14 ATL 24,000 65 30 56 60 + + + + NT NT NT

15 ATL 25,000 10 12 0 0 + + - NT NT NT

16 ATL 50,200 24 10 20 10 + + + NT NT NT

17 ATL 17,100 15 1 3 1 + ± NT NT NT

18 Chronic 33,100 64 100 100 100 + + + + NT NT NT

19 Lymphoma 17,000 4 1 100 100 ++ ++ NT NT NT

20 Lymphoma 4,500 1 0.2 3 1 + + NT NT NT

21 ATL 100 100 100 ++ ++ NT NT NT

22 Lymphoma 8,700 0 0.003 0 0 0 ± NT NT NT

23 Chronic 11,800 31 6.3 9 10 + ++ NT NT NT

a The PCR primers correspondto thefollowing: tax,SK43andSK44;pro,BKproland BKpro2;

enm,

SG452 andSG453; LTR,RM3 andRM4;gag,BKgagl and BKgag2; polBK, BKpoll andBKpol2;polSG,SG231 andSG238;and taxBK, BKtaxl and BKtax2. The numbers under thePCRprimer columnstax, pro, andenvreferto an approximateestimate:(number of viral genomes/number of human genomes)x 100%. ++, veryintense,saturatedsignal; +,strongsignal; ±, faint signal;-, nosignal; NT,nottested. Thesensitivity ofeachreaction(minimumnumber ofinput moleculesrequired forapositive PCR)wasasfollows: tax, 2; pro, 20;enm,20; LTR, 200;gag,200;polBK,200;polSG,200;taxBK,200.

bHealth statusreferstoclinicalstatus at thetimeblood sample was drawn. ATL, acute type;chronic,achronic type;lymphoma,T-celllymphomawithor

withoutleukemic change; smoldering, smoldering type. ' Percentageof abnormal cells in peripheralblood.

ing leukemic cells, with the 3' region preferentially pre-served. Previous instances ofdeleted genomes in samples

frompatients withATLhave been described (2, 31,39).We

obtainedanadditional 14samples frompatientstoattempt to

determine how frequently the deleted genome occurred in

ATLpatients and theapproximate boundariesof the deleted

region, usingthe PCR mapping technique described above.

A subsetof five PCRprimers that wererepresentative of

sd

CAP

2074 2784

proI

thesetthat had been used on the

original

nine

samples

was

used on the entire set of 23

samples (Table 1).

In three

samples,

thetumorcells were not presentin the

peripheral

blood in

adequate

numbers to be differentiated from

back-ground

HTLV-infected nontumor

peripheral

blood cells

(samples 17, 20,

and

22),

andforanadditionalcase

(sample

21),

hematological

information was not available. Of the

remaining

19

samples,

6

(32%)

had the 5' endoftheir genome

5202 6668 7324 8381

env tax

sasd

I I

aaa

I l t- ll

23 777 824 21132243

pol

sa

LTR 51

5209 8300 9054

SG231/ RM3/4 BKgagl/2 BKPro1/2 238 BKPol1/2

_I

[E

421-720 660-881 2180-2380 2800- 3385-3505

3038

SG4521

RM3/spl 453

421-sd; 5796-6106 sa-5163

SK43144

-U-7358-7516

BKtaxl/2

RM3/4 8101-8320

FIG. 1. Map oftheHTLV-Iproviralgenomeindicatinglocationsofamplification products.Theboundaries and locations of the LTRs and the gag,pol,env, tax, andprotease(pro)genesaregivenin the upperdrawing.Thelocations ofthesplicedonor(sd)andspliceacceptor (sa) sitesaremarked.Directly belowarethelocations andouterboundaries ofthePCR

amplification

products

for eachofthenine

primer

pairs

used. Theblack boxes areprimersthatreactedstrongly with all samplesfrompatientswith ATL. Boxes filled in with dots indicate PCR

primersthatlie in the deletedregion,whichreactedweaklyin 6 of 19ATLpatients. SG452/453wasretained in one-half of thepatientswith

deletedHTLV genomes and wasdeleted in the other half. Theblankbox forRM3/splindicates the primersthatamplifyacross thesplice

junctionwhichgavenoPCRproductforanypatientsampletested.

on November 10, 2019 by guest

http://jvi.asm.org/

[image:3.612.157.470.526.664.2]

(4)

1 2 3 4 5 6 7 8 9 10 11 12

RM3/4 * *. **.:.*.*@ ***

gag // * *... ...#4..

13 14 15 16 17 18 19 20 21 22 23

RiM3/4* @@** * *

-24 25 26 RM3/4

BKWGf/12

27 28 29 30 31 32 33 34 35 RY 3/4 *

Bfgog//2_

FIG. 2. Dot blot showing semiquantitative PCR results with DNAfrom patients with ATL. Spots 1to23arePCRproductsfrom the DNA from patients with ATL, correspondingto the numbers given in Table 1. Spots 19, 20, and 22arefrom DNA frompatients

with lymphoma with low levels of HTLV-infected tumor cells

amongtheir PBMCs. Spots 24to26arenegative controls with DNA

derived from healthy blood donors. Spots 27 to 33 are serial

dilutions of HUT102 cell DNA into HUT78 cell DNA. They contained, respectively, approximately 1,000,000, 200,000, 20,000, 2,000, 200, 20, and 2 copies of HTLV-I input DNA. (Longer

exposuresof this blot revealed specific PCR product withasfewas

200copies of HTLV-I [spot 31]), butsomeof thecontrastwaslost in thesamples from patients with ATLatthis exposure;therefore,

alightexposureisshown which doesnotshowsignal in all dots in whichasignalcanbe detectedwith longer exposures.) Spot 34 isa

HUT78 DNAnegative control, andspot35 isa zeroDNAnegative control. A2-rig portion of DNAwasused for each PCR.

deletedinthe leukemiccells (Table 1, samples 2, 7, 8, 9, 13,

and 15). Lowlevels ofintactgenome were present inthese

samples, presumably owing to the very low number of HTLV-infected nontumor cells circulating in the periphery

and amplified by the PCR technique. Three of six samples

retained the DNA amplified by the env primers, and the

other three were deleted in that region. All 19 gave strong

signals with LTR or taxprimers. It was not clear whether anyof the 5' LTR was present. The primer pair RM3 and

RM4amplifywithinthe LTR, and the PCR signal from these primers could be generated entirely by the 3' LTR. The BKtaxland BKtax2 primer pair amplify across the 3' LTR

border in the taxgene and gave a strong reaction with all samples tested (Table 1; Fig. 2). The BKgagl and BKgag2 primer pair amplify in the gag gene at the border of the5'

LTR;thissequence wasnotpresentin thetumorcells ofthe

patients with deletedgenomes (Table 1; Fig. 2).

An example ofa PCR experiment with the primer pairs

RM3 and RM4 and BKgagl andBKgag2isshownin Fig. 2. Amorestringent quantitativetestwasdoneonall 23 samples

(Table 1;seeMaterials andMethods) with the primers SK43

andSK44, which amplify from thetaxregionpresent in the tumorcells of allsamples; the primersBKprol and BKpro2,

which amplify from the protease region embedded in the deleted region; and the primers SG452 and SG453, which amplify in theenvregion thatwasretained in one-half ofthe

cases with partial genomes. These primers were chosen

becausethey were the most sensitive (SK43 and SK44are

abletodetectasfewas2 initialinput HTLV molecules, and BKprol and BKpro2 and SG452 and SG453 are able to detect 20 molecules) and they represented each class of result.

Clinical datawereavailable for all butonepatient, includ-ing the leukocyte count (Table 1). In some cases, this number was very high (e.g., samples 1, 7, and 11), which indicates that the PBMCs are composed almost entirely of

leukemic cells. Patient 7(Table 1)showsaparticularlyclear

example of a deleted HTLV-I genome in tumor cells

be-cause,despite theextremely high number of leukemic cells and the intense PCR signal from the taxand LTRprimers,

thePCRprimersfrom the 5' portionof the genome display

only a weak response. The other five patients who carried

deleted genomes in their tumor cells, while having a less

overwhelming number of leukemic cells in theirperipheral

blood, still showeda clearquantitative contrastwhen

com-paringPCRamplification products from differentregions of

the genome.

Aldovini etal. (2)reported an instance in whicha

defec-tive HTLV-Iwascloned withadeletion thatsuggesteditwas

an integrated cDNA that had been copied from a properly

spliced RNA. To determine whether this had occurred in

someofthedeletedgenomesdescribedhere,wetested PCR

primers that amplify across the first splice site (RM3 and spl). Noneofthesamples fromthe23patientswithdefective

orintactgenomesreacted with this

primer pair.

Although it islikelythat severalpatients havemorethan

onecopyofHTLV DNAintegrated into their leukemic cell genomes(39),patient6wasinteresting in that DNA derived from this patient, with all primers tested in

comparisons

made by serial dilutions, repeatedly gave a more intense

PCR signal than HUT102 DNA. We estimated that our

HUT102linecontainssevenHTLVcopiespercell.Patient 6 may have had 10 or more copies of HTLV

provirus

per

leukemic cell.

Southern blot

analysis

of DNA from

patients

with ATL

wasdone on threesamplesthatcontained defectivegenomes andonthreesamplesthatcontained intactgenomes

(Fig.

3).

Genomic DNA was cut with the restriction enzyme PstI,

which yields fourconserved DNAfragmentsthat lie within the HTLV genome (31).Thesefragmentswerepreserved in thegenomesthat thePCRresults indicatedwereintact. The

Pstlfragments which represent the 5'portion of the HTLV

genome were lost in thedefective viruses.

DISCUSSION

The preferential retention ofthe 3' part of the HTLV-I

genome in leukemic cells ofpatients with ATL who carry

defective genomes in their leukemic cells points to the

potential importance ofthetaxregioninoncogenesisinvivo.

Itis possible thatgeneration ofa defective proviruscan in

some casescontribute to oncogenesis because the tax

pro-tein may be freed from the regulatory constraints of the intactHTLV-Igenome. Thenormal modulatinginfluence of

the rex gene product (6), which switches viral expression

fromtaxandrextotheviral structuralproteins by

posttran-scriptional regulation (5, 6, 14, 30), may be lostin someof

thedeleted genomes. Other constraints that may normally be

imposed by regulated transcriptionfrom the viral LTR may

beoverriddenby transcription ofthedeletedvirus pXregion from cellular promoters proximal to the proviral insertion

site.

Kinoshita et al. (17) used PCR to detect mRNA from

on November 10, 2019 by guest

http://jvi.asm.org/

[image:4.612.68.282.79.290.2]

(5)

[image:5.612.95.266.83.154.2]

-M_ eg 4 4 _

FIG. 3. Southern blot analysis of genomic DNA from PBMCs from patients with ATL. Lane pMT2 is plasmid pMT2cutby the restriction enzyme PstI. The 2.3-, 1.6-, and 1.3-kb fragments are

internal fragments from the HTLV genome. The 0.5-kbfragment

frequently found in HTLV DNA (26) (see lanes 1 to 6) is not conserved in pMT2. The 4.8- and 0.9-kb fragments contain both HTLV-I DNA andvectorDNA. A20-,ug portion ofDNAcutwith PstIwasused for each of thefollowing lanes. The lanemarkedneg

used DNA from a blood sample from a noninfected blood donor.

Lanes 1 to 3 were PBMC DNAs from patients who carry intact

HTLV genomes in theirleukemic cells (patients 1, 5, and 6),and lanes 4 to 6 were DNAs from patients with deleted genomes

(patients 2, 7, and 9). The internal Pstl sites correspond tobases 1392to3036 (1.6 kb), 3035to4316 (1.3 kb), 4330to6755 (2.3kb), and 6755to7294(0.5kb). The 2.3-kb band is derived fromen'sequences

andthe end of the polgene. Lanes 4 and 6 showaconserved 2.3-kb

bandbuthave lost the 1.6- and 1.3-kb bands. Lane 4 is derivedfrom DNAfrom patient 10,which doesnot reactwiththe envprimers,so

itislikely that the band in thiscaseis duetoanewPstIlsite. Lane

5 has lost alltypical Pstlbands, gaininga newbandat3kb. Alllanes retained the 0.5-kbband. Other bands of various sizesareprobably

atinsertion sites andarecomposed ofboth HTLV DNA and human

flankingsequence DNA.

patients with ATL and from healthy HTLV-I-infected indi-viduals; the PCR primer pair used crossed the second splice

site in the HTLV-I genome. Only low levels oftranscript wereobserved, and inatleastonepatient withATL, notax mRNAwasdetected.Thedefectivegenomesdescribedhere

may generate tax transcripts that may not be properly spliced and would not be detected by PCR primers that

flankedthe splice site. It would beinteresting todetermine

whether thelevel oftaxmRNAobservedinthe PBMCs from

patients with ATL may be higher in some cases with tax primersthatdo notcrossthe splice junction.

Because of the potential for the presence of several HTLV-I proviralgenomesin ATL leukemic cell DNA(39),

it ispossiblethatdefectiveprovirusispresentinsomeof the

leukemic cells that also contain intact genomes. The pres-ence of the defective genome would be masked and not detected by PCRorthe Southern blot analysis. Therefore,

the 32% of patients with ATL that we found harboring

defectivegenomeintheir leukemic cells is alower estimate. The frequency with which deleted genomes are observed suggeststhat such deletions contributetodevelopingATL in

somecases.Ifderegulationof thetaxgenethroughmutation

or deletion of cis-acting regulatory sequences can be a

contributing factor to leukemogenesis, it could help to

ex-plainthelong latencyfrom viral infectiontodisease. Appro-priate mutagenic events and deletions would be rare; thus,

infected individuals would havealow lifetimerisk of

devel-opingATL onceinfectedwith HTLV-I. ACKNOWLEDGMENTS

This work was supported by Public Health Service grants CA39805and HL33774 from the National Institutesof Health. Bette Korberwas aLeukemiaSocietyof Americafellow.

We thank Mary Fran McLane for assistance and advice and Tun-Hou Lee and Garth Ehrlich for useful scientificdiscussions. We

alsothankEdward Hamiltonfor editorialassistance andmanuscript

preparation.

REFERENCES

1. Abbott,M.A.,B.J. Poiesz,B.C.Byrne, S. Kwok, J. J.Sninsky, andG. D. Ehrlich. 1988.Enzymaticgeneamplification:

qualita-tive and quantitative methods fordetecting proviralDNA

am-plified in vitro.J. Infect.Dis. 158:1158-1168.

2. Aldovini, A., A. DeRossi, M. Feinberg, F. Wong-Staal, and G. Franchini. 1986. Molecular analysis of a deletion mutant provi-rus of type I human T-cell lymphotropic virus: evidence ofa doubly spliced X-lor mRNA. Proc. Natl. Acad. Sci. USA 83:38-42.

3. Berger, S. L., and A. R. Kimmel. 1987. Guide to molecular cloning techniques. Methods Enzymol. 152:582-587.

4. Cross, S. L., M. B. Feinberg, J. B. Wolf, N. J. Holbrook, F. Wong-Staal,andW.J.Leonard. 1987.Regulation ofthe human interleukin-2 receptor alpha chain promoter: activation of a non-functional promoter by the transactivatorgene ofHTLV-I. Cell49:47-56.

5. Dokhelar, M.-C.,H.Pickford, J. Sodroski, and W. A.Haseltine. 1989. HTLV-Ip27rex regulates gag and env proteinexpression. J. Acquired Immune Defic. Syndr. 2:431-440.

6. Dokhelar, M.-C., H.Pickford, J. Sodroski,and W. A.Haseltine. 1989. The potentialforhomeostatic regulation of the Xregion proteinsofthe humanTcell leukemia virus typeI. J. Acquired Immune Defic. Syndr. 2:588-594.

7. Felber, B.K.,H. Paskalis, C. Kleinman-Ewing, F. Wong-Staal, and G. N. Pavlakis. 1985. The pX protein of HTLV-I is a transcriptional activator of its long terminal repeat. Science 229:675-679.

8. Franchini, G., F. Wong-Staal, and R. C. Gallo. 1984. Human T-cellleukemia virus (HTLV-I) transcripts in fresh andcultured cells ofpatients withadult T-cell leukemia. Proc. Natl. Acad. Sci. USA81:6207-6211.

9. Gazdar, A. F.,D. N. Carney, P. A. Bunn, E. K. Russell, E. S. Jaffe, G. P. Schecter, and D. W. Guccion. 1980. Mitogen requirements for the in vitro propagation ofcutaneous T-cell lymphomas. Blood55:409-417.

10. Grassmann, R., C. Dengler,I. Muller-Fleckenstein, B. Flecken-stein,K. McGuire, M.-C. Dokhelar, J. Sodroski, and W. Hasel-tine. 1989. Transformation to continuous growth of primary human T lymphocytes by human T-cell leukemic virus type I X-region genes transduced by a herpesvirus saimiri vector. Proc. Nat]. Acad. Sci. USA 86:3351-3355.

11. Greenberg, S. J., G. D. Ehrlich, M. A. Abbott, B. J. Hurwitz, T. A.Waldmann, and B.J.Poiesz. 1989. Detection ofsequences homologous to human retroviral DNA in multiple sclerosis by geneamplification. Proc. Natl. Acad. Sci. USA86:2878-2882. 12. Haseltine, W. A., J. G. Sodroski, R. Patricia, D. Briggs, D.

Perkins, and F. Wong-Staal. 1984. Structure of the 3' terminal region of type ll human T lymphotropic virus: evidence fora new coding region. Science 225:419-421.

13. Hinuma, Y., K. Nagata, M. Hanaoka, M. Nakai, T.Matsumoto, K. Kinoshita, S. Shirakawa, and I. Miyoshi. 1981. Adult T-cell leukemia:antigeninanATL cell line and detection of antibodies to the antigen in human sera. Proc. Natl. Acad. Sci. USA 78:6476-6480.

14. Inoue, J.-I., M. Yoshida, and M. Seiki. 1987. Transcriptional (p4Ox) and posttranscriptional(p27x-III) regulators are required for the expression and replication of human T-call leukemia virus type I genes. Proc. Natl. Acad. Sci. USA 84:3653-3657. 15. Jeang, K. T., I. Boros, J. Brady, M. Radonovich, and G.

Khoury. 1988. Characterization of cellular factors that interact with the human T-cell leukemia virus type I p4Ox-responsive 21-base-pair sequence. J. Virol. 62:4499-4504.

16. Jeang, K.-T., S. G. Widen, 0. J. Semmes, and S. H. Wilson. 1990. HTLV-I trans-activator protein, tax, is atrans-repressor of the human beta-polymerase gene. Science 247:1082-1084. 17. Kinoshita, T., M. Shimoyama, K. Tobinai, M. Ito, S.-I. Ito, S.

Ikeda, K. Tajima, K. Shimotohno, and T. Sugimura. 1989. Detection of mRNA for the taxl/rexl gene of human T-cell leukemia virus type-I in fresh peripheral blood mononuclear

on November 10, 2019 by guest

http://jvi.asm.org/

(6)

cellsofadult T-cellleukemia patients and viralcarriersbyusing the polymerase chain reaction. Proc. Natl. Acad. Sci. USA 86:5620-5624.

18. Kwok, S., G. Ehrlich, B. Poiesz, R. Kalish, and J. J. Sninsky. 1988. Enzymatic amplification ofHTLV-Iviralsequences from peripheralblood mononuclearcells andinfected tissues. Blood 72:1117-1123.

19. Lee, T.-H., J. E.Coligan, J. G. Sodroski, W. A. Haseltine, S. Z. Salahuddin, F. Wong-Staal, R. C. Gallo, and M. Essex. 1984. Antigens encoded by the 3'-terminal region of human T-cell leukemia virus: evidence for a functional gene. Science 226:57-61.

20. Maruyama, M., H. Shibuya, H. Harada, M. Hatakeyama, M. Seiki, T. Fujita, J. Inoue, M. Yoshida, and T. Taniguchi. 1987. Evidence foraberrant activation oftheinterleukin-2autocrine loop by HTLV-I encoded p4Ox andT3/Ti complex triggering. Cell 48:343-350.

21. Nagata, K., K. Ohtani, M. Nakamura, and K. Sugamura. 1989. Activation ofendogenous c-fos proto-oncogene expression by human T-cellleukemiavirustypeI-encodedp40" protein in the human T-cell line, Jurkat.J. Virol. 63:3220-3226.

22. Okamoto, T., Y. Ohno, S. Tsugane, S. Watanabe, M. Shi-moyama, K. Tajima, M. Miwa, and K. Shimotohno. 1989. Multi-step carcinogenesismodel for adult T-cellleukemia.Jpn. J. CancerRes. 80:191-195.

23. Poeisz, B. J., F.Ruscetti, J. Mier, A. Woods, and R. C. Gallo. 1980.T-celllines established fromhuman T-lymphocyte neopla-sias by direct response to T-cell growth factor(mycosis fun-goides, Sdzary syndrome and acute lymphocytic leukemia). Proc. Natl. Acad. Sci. USA 77:6815-6819.

24. Poiesz, B. J., F. W. Ruscetti, A. F. Gazadar,0. A. Bunn, J. D. Minna, and R. C.Gallo.1980.Detectionandisolationof type C retrovirus particles from fresh and cultured lymphocytes of a patient withcutaneousT-celllymphoma.Proc. Natl.Acad.Sci. USA77:7415-7419.

25. Ruben, S., H.Poteat, T. H. Tan, K. Kawakami, R. Roeder, W. Haseltine, and C. Rosen. 1988. Identification of cellular tran-scription factors required for regulationofinterleukin2receptor gene expression by the human Tcell leukemiavirus tat gene product. Science 241:89-92.

26. Ruben, S. M., A. Perkins, and C. A. Rosen. 1989. Activation of NF-KB bytheHTLV-I trans-activator protein tax requires an additional factorpresent in lymphoid cells. New Biol. 1:275-284.

27. Seiki, M., S. Hattori, Y. Hirayama, and M. Yoshida. 1983. Human adult T-cell leukemia virus: complete nucleotide se-quenceof theprovirusgenomeintegratedinleukemiacell DNA. Proc. Natl.Acad.Sci. USA80:3618-3622.

28. Seiki, M., A. Hikikoshi, T. Taniguchi, and M. Yoshida. 1985. Expression ofthe pXgeneof HTLV-I: general splicing mech-anism in theHTLVfamily. Science 228:1532-1534.

29. Seiki, M., J. Inoue,T. Takeda, and M. Yoshida. 1986. Direct evidence thatp4Ox of human T-cell leukemia virustype I isa trans-acting transcriptional activator. EMBOJ. 5:561-565. 30. Seiki, M., J.-I. Inoue, M. Hidaka, and M. Yoshida. 1988. Two

cis-acting elements responsible for posttranscriptional trans-regulation ofgene expression ofhuman T-cell leukemiavirus type I.Proc.Natl. Acad. Sci. USA85:7124-7128.

31. Siomi, H., T. Nosaka, T. Saida, H. Miwa, Y. Hinuma, S. Shirakawa, N.Miyamoto, T. Konko, K.Araki,M. Ichimaru,A. Miura, and M. Hatanaka.1988.Twomajorsubgroups ofhuman T-cellleukemia virus type-IinJapan. Virus Genes 1:377-383. 32. Slamon, D. J., K.Shimotohno, M.J. Cline, D. W. Golde, and

I. S. Y. Chen. 1984. Identificationofthe putativetransforming protein of the human T-cell leukemia viruses HTLV-I and HTLV-II. Science 226:61-65.

33. Sodroski, J.G.,C. A. Rosen, W. C.Goh,and W. A. Haseltine. 1985. A transcriptional activator protein encoded by the x-lor region ofthe human T-cell leukemia virus. Science 228:1430-1434.

34. Tan, T. H., M.Horikoshi, and R. Roeder.1989.Purification and characterization of multiple nuclear factors that bind to the TAX-inducible enhancer withinthe humanT-cellleukemiavirus type I longterminalrepeat. Mol.Cell. Biol.9:1733-1745. 35. Tanaka, A., C. Takahashi, S. Yamaoka, T. Nosaka, M.

Masa-toshi, and M. Hatanaka. 1990.Oncogenic transformationby the tax geneofhuman T-cell leukemiavirus type I invitro. Proc. Natl. Acad.Sci. USA 87:1071-1075.

36. Wano, Y., M.Feinberg, J. Hosking, H. Bogerd, and W. Greene. 1988.Stable expression of thetaxgene oftypeIhumanT-cell leukemia virus inhumanT-cellsactivatesspecific cellulargenes involvedingrowth.Proc. Natl. Acad. Sci. USA 85:9733-9737. 37. Yoshida, M., I. Miyoshi, and Y. Hinuma. 1982. Isolation and characterization of retrovirus from cell lines of human adult T-cell leukemiaand itsimplication in thedisease. Proc. Natl. Acad. Sci. USA 79:2031-2035.

38. Yoshida, M., and M. Seiki. 1987. Recent advances in the molecular biology of HTLV-I: trans-activation of viral and cellulargenes. Annu. Rev. Immunol. 5:541-559.

39. Yoshida, M., M. Seiki, S. Hattori, and T. Watanabe. 1984. Genome structure of human T-cell leukemia virus and its involvement inthe development ofadultT-cell leukemia/lym-phoma,p.141-148.In R.Gallo, M. Essex, and L.Gross(ed.), Human T-cell leukemia/lymphoma virus. Cold Spring Harbor Laboratory, Cold Spring Harbor,N.Y.