The Human Cytomegalovirus IE1 Protein Antagonizes PML Nuclear Body-Mediated Intrinsic Immunity via the Inhibition of PML De Novo SUMOylation

(1)

The Human Cytomegalovirus IE1 Protein

Antagonizes PML Nuclear

Body-Mediated Intrinsic Immunity via the

Inhibition of PML

De Novo

SUMOylation

Eva-Maria Schilling,

a

Myriam Scherer,

a

Nina Reuter,

a

Johannes Schweininger,

b

Yves A. Muller,

b

Thomas Stamminger

a

Institute of Clinical and Molecular Virology, Friedrich-Alexander-Universität Erlangen-Nürnberg, Erlangen,

Germanya_{; Division of Biotechnology, Friedrich-Alexander-Universität Erlangen-Nürnberg, Erlangen, Germany}b

ABSTRACT

PML nuclear bodies (NBs) are accumulations of cellular proteins embedded

in a scaffold-like structure built by SUMO-modiﬁed PML/TRIM19. PML and other NB

pro-teins act as cellular restriction factors against human cytomegalovirus (HCMV); however,

this intrinsic defense is counteracted by the immediate early protein 1 (IE1) of HCMV. IE1

directly interacts with the PML coiled-coil domain via its globular core region and

dis-rupts NB foci by inducing a loss of PML SUMOylation. Here, we demonstrate that IE1

acts via abrogating the

de novo

SUMOylation of PML. In order to overcome reversible

SUMOylation dynamics, we made use of a cell-based assay that combines inducible IE1

expression with a SUMO mutant resistant to SUMO proteases. Interestingly, we observed

that IE1 expression did not affect preSUMOylated PML; however, it clearly prevented

de

novo

SUMO conjugation. Consistent results were obtained by

in vitro

SUMOylation

as-says, demonstrating that IE1 alone is sufﬁcient for this effect. Furthermore, IE1 acts in a

selective manner, since K160 was identiﬁed as the main target lysine. This is

strength-ened by the fact that IE1 also prevents As

2

O

3

-mediated hyperSUMOylation of K160,

thereby blocking PML degradation. Since IE1 did not interfere with coiled-coil-mediated

PML dimerization, we propose that IE1 affects PML autoSUMOylation either by directly

abrogating PML E3 ligase function or by preventing access to SUMO sites. Thus, our

data suggest a novel mechanism for how a viral protein counteracts a cellular restriction

factor by selectively preventing the

de novo

SUMOylation at speciﬁc lysine residues

with-out affecting global protein SUMOylation.

IMPORTANCE

The human cytomegalovirus IE1 protein acts as an important antagonist

of a cellular restriction mechanism that is mediated by subnuclear structures termed

PML nuclear bodies. This function of IE1 is required for efﬁcient viral replication and thus

constitutes a potential target for antiviral strategies. In this paper, we further elucidate

the molecular mechanism for how IE1 antagonizes PML NBs. We show that tight

bind-ing of IE1 to PML interferes with the

de novo

SUMOylation of a distinct lysine residue

that is also the target of stress-mediated hyperSUMOylation of PML. This is of

impor-tance since it represents a novel mechanism used by a viral antagonist of intrinsic

im-munity. Furthermore, it highlights the possibility of developing small molecules that

spe-ciﬁcally abrogate this PML-antagonistic activity of IE1 and thus inhibit viral replication.

KEYWORDS

PML nuclear bodies, human cytomegalovirus, immediate early 1,

intrinsic immunity, nuclear domain 10, sumoylation

P

romyelocytic leukemia protein (PML) is known to act as organizer of subnuclear,

matrix-associated structures which can be detected as spherical dots of

approxi-mately 0.1 to 1.0

␮

m (1). These structures, termed PML nuclear bodies (NBs) or nuclear

domain 10 (ND10), are multiprotein complexes consisting of more than 160 proteins.

Received15 October 2016Accepted28 November 2016

Accepted manuscript posted online30 November 2016

CitationSchilling E-M, Scherer M, Reuter N, Schweininger J, Muller YA, Stamminger T. 2017. The human cytomegalovirus IE1 protein antagonizes PML nuclear body-mediated intrinsic immunity via the inhibition of PMLde novoSUMOylation. J Virol 91:e02049-16. https://doi.org/10.1128/JVI.02049-16.

EditorRozanne M. Sandri-Goldin, University of California, Irvine

Address correspondence to Thomas Stamminger,

thomas.stamminger@viro.med.uni-erlangen.de.

VIRUS-CELL INTERACTIONS

crossm

on November 7, 2019 by guest

http://jvi.asm.org/

(2)

PML NBs are implicated in several cellular processes: transcription, apoptosis,

senes-cence, response to DNA damage, and antiviral defense (2). The last is mediated by PML

itself and further NB-associated proteins, which act as cellular restriction factors,

thereby forming the ﬁrst line of antiviral defense, the so-called intrinsic immunity.

Several viruses from different families, including herpes-, adeno-, polyoma-, rhabdo-,

and retroviruses, have been shown to be repressed by the NB-mediated intrinsic

immunity (3, 4).

In humans, there are 7 isoforms (I to VII) of PML (TRIM19), which are characterized

by one common feature at their N terminus: the TRIM/RBCC motif, consisting of a RING

domain, B boxes, and a coiled-coil region (5). It has been suggested that PML initiates

NB

de novo

formation by dimerization and subsequent oligomerization via this RBCC

motif. However, the maintenance and maturation of this structure, as well as the

recruitment of further proteins such as hDaxx and Sp100, highly depend on

posttrans-lational modiﬁcation of PML by small ubiquitin-like modiﬁers (SUMOs) (2, 6–8). This

modiﬁcation occurs on three major lysine residues (K65, K160, and K490) by covalent

attachment of SUMO molecules which exist in paralogs, termed SUMO1 to -4 and the

recently identiﬁed SUMO5 (9–12). While SUMO2 and SUMO3 share a high similarity and

therefore are commonly referred to as SUMO2/3, SUMO1 displays only 50% sequence

identity with SUMO2/3. SUMO2/3 efﬁciently forms polySUMO chains due to the internal

residue K11, which enables conjugation to itself and other SUMO paralogs. SUMO1, in

contrast, which is devoid of K11, is conjugated to its substrates only as single SUMO1

protein, or it can serve as a SUMO chain terminator at the end of a polySUMO chain (13).

Covalent attachment of the 11-kDa SUMO moiety to its substrate requires a four-step

enzymatic process (14). First, immature SUMO is processed by cellular SUMO proteases

(SENPs) to expose a diglycine motif required for conjugation. Second, mature SUMO is

activated in an ATP-dependent manner by the E1-activating enzyme, a heterodimer of

SAE1 and SAE2 in mammals. Third, SUMO is passed to the E2-conjugating enzyme UBC9

and ﬁnally conjugated to its substrate at the SUMO consensus sites (

␺

-K-X-E/D, where

␺

is a large hydrophobic amino acid and X is any amino acid). The last step is

accomplished by substrate-speciﬁc SUMO E3 ligases which play an important role for

conferring selectivity and efﬁciency of the SUMOylation reaction. Interestingly, PML

itself has been suggested to possess SUMO E3 ligase activity because of its ability to

interact with SUMO and Ubc9 as well as to stimulate SUMOylation in yeast and

mammalian cells (15–17). Therefore, the SUMOylated species of PML may arise at least

partially via autoSUMOylation, as also suggested by Shen and colleagues (18). The

dynamics between SUMOylation and deSUMOylation of NB-associated PML are

pro-posed to be indispensable for NB architecture and function (19). These dynamics are

fostered by the presence of all components of the SUMOylation machinery and also

SENPs, which are required both for processing of immature SUMO and for

deconjuga-tion of SUMO proteins (20). In addideconjuga-tion to physiological changes, there are several

stimuli that affect PML SUMOylation (2). The most extensively studied substance,

arsenic trioxide (As

2

O

3

), provokes the hyperSUMOylation of PML, which is followed by

recruitment of the SUMO-targeted ubiquitin ligase (STUbL) RNF4 and the subsequent

ubiquitin-dependent proteasomal degradation of PML (21).

Viruses have evolved several mechanisms to overcome PML NB-mediated intrinsic

immunity by exploiting the host cell SUMOylation system (22). For example, the herpes

simplex virus 1 (HSV-1) immediate early protein ICP0 acts as a STUbL which targets

SUMOylated PML and Sp100 as well as other SUMOylated factors for proteasomal

degradation (23, 24). The immediate early protein 1 (IE1) of human cytomegalovirus

(HCMV) also induces the loss of SUMOylated forms of PML, which is followed by the

disruption of NBs, and it has been shown by several studies that this correlates with the

antagonization of PML NB-mediated intrinsic immunity (25–31). For IE1, no such STUbL

activity has been reported (32). Since IE1 is SUMOylated itself, the hypothesis has been

raised that it acts as a decoy substrate by competing for SUMO (32, 33). However, this

idea was disproved in earlier studies, as a SUMOylation-negative mutant of IE1 is still

able to induce a loss of PML SUMOylation (32). Importantly, the direct binding of IE1 to

http://jvi.asm.org/

(3)

PML seems to be a prerequisite for mediating the loss of SUMOylated PML (29, 34).

Previous studies identiﬁed a central large core region of IE1 as being sufﬁcient for

interaction with PML; however, further attempts to narrow down the binding region by

using mutations and deletions failed (29, 30, 34–38). Indeed, the crystal structure of the

rhesus cytomegalovirus IE1

CORE

, which was recently solved by our group, provided

strong evidence that IE1

CORE

consists of a single contiguous domain which is very

sensitive to deletion mutagenesis (30). The crystal structure further revealed a similarity

between the crystal structure of IE1

CORE

and that of TRIM coiled-coil domains.

Inter-estingly, experiments from our group and others demonstrated that IE1 targets the

coiled-coil domain of PML and also interacts with other members of this protein family,

such as TRIM5

␣

and TRIM33 (30, 39). This led the authors to propose a model whereby

IE1 targets PML via an extended binding surface which involves coiled-coil interactions,

thereby interfering with PML SUMOylation (30).

In the present study, we set out to further clarify the mechanism that leads to a loss

of PML SUMOylation by IE1. By using

in vivo

as well as

in vitro

studies, we found that

IE1 alone is sufﬁcient to inhibit the

de novo

SUMOylation of PML without affecting

preSUMOylated PML. This clearly demonstrates that IE1 exclusively inhibits the on-rate

of SUMO modiﬁcation. Interestingly, IE1 seems to selectively modulate the

SUMOyla-tion of lysine 160, which is also known to be the main SUMO target site during

As

2

O

3

-mediated PML degradation. Indeed, we could observe that the effect of IE1 on

PML SUMOylation is evident not only under physiological conditions but also under

stress conditions. Taken together, our data suggest a novel mechanism for how a viral

antagonistic protein counteracts a cellular restriction factor by selectively preventing

the

de novo

SUMOylation at speciﬁc lysine residues without affecting global protein

SUMOylation.

RESULTS

IE1 induces the loss of PML polySUMOylation.

The antiviral activity of PML NBs is

known to be disturbed by HCMV in an IE1-dependent manner (27, 34). It is supposed

that the ability of IE1 to inhibit the accumulation of SUMO-conjugated forms of PML is

crucial for this effect, since SUMOylated PML is essential for assembling genuine NB

structures (1, 6, 7, 18, 28, 29). To get further insights into the exact mechanism of

IE1-mediated loss of PML SUMOylation, we performed infection experiments using

primary human foreskin ﬁbroblast (HFF) cells. For this, we conducted time course

analyses with the HCMV strain AD169 at a multiplicity of infection (MOI) of 3. In

accordance with previous studies, PML was found to be partially deSUMOylated upon

infection (Fig. 1 A) (29, 40). While most high-molecular-weight bands of PML

disap-peared, one presumably modiﬁed species of PML seemed to be resistant against IE1

action (Fig. 1A, asterisk). The same was true in HFF cells with inducible expression of IE1,

thereby demonstrating a direct effect of IE1 on PML polySUMOylation (Fig. 1 B). Since

we speculated that the unaffected band may correspond to a SUMO-modiﬁed form of

PML, we reintroduced a FLAG-tagged version of PML (F-PML) I into PML knockdown

(PML-kd) HFFs by lentiviral transduction. Indeed, consistent results were obtained with

this PML isoform upon infection: while most SUMOylated PML species disappeared, one

isoform remained unaffected (Fig. 1C). To conﬁrm that this resistant isoform

corre-sponds to a SUMO-modiﬁed form of PML, we conducted immunoprecipitation studies

with the F-PML I-expressing PML-kd HFFs. Cells were either mock infected or infected

with AD169, lysed at 24 h postinfection, and subjected to immunoprecipitation under

denaturing conditions. Modiﬁcation of F-PML I with endogenous SUMO proteins was

subsequently detected with a SUMO2/3-speciﬁc antibody. Strikingly, while several

SUMOylated species of F-PML I were observed in mock-infected cells, the infected cells

displayed only one distinct band (Fig. 1D, right panel, compare lanes 2 and 4). Since this

band exhibited an approximately 15-kDa shift in molecular mass compared to

unmod-iﬁed F-PML I, we assume that it corresponds to a monoSUMOylated F-PML I. Hence, our

data provide evidence that IE1 selectively affects PML polySUMOylation, while a

monoSUMOylated isoform of PML appears to be resistant.

HCMV IE1 Inhibits PMLDe NovoSUMOylation Journal of Virology

http://jvi.asm.org/

(4)

IE1 speciﬁcally affects the SUMOylation of PML K160.

As depicted in Fig. 2A, PML

is modiﬁed mainly at three lysine residues, K65, K160, and K490. Each of these residues

can be either monoSUMOylated or polySUMOylated (10). To analyze whether the

IE1-resistant, monoSUMOylated PML species corresponds to a deﬁned lysine residue,

we generated SUMOylation site mutants by changing the respective lysine to arginine.

Next, we characterized the SUMOylation patterns of single, double, and triple SUMO

site mutants of PML in HEK293T cells. As expected, due to the absence of all major

SUMOylation sites, expression of the triple mutant (3KR) did not result in any

slower-migrating, SUMOylated forms of PML (Fig. 2A, lane 8). Consistent results were obtained

with the K160R/K490R mutant (Fig. 2A, lane 7), as SUMOylation of K65 is tightly linked

to SUMOylation of K160 (21). The K65R/K490R mutant displayed one SUMO-modiﬁed

band (Fig. 2A, lane 6), corresponding to the SUMOylation of K160 (Fig. 2A, marked by

a circle), which obviously is the main SUMO conjugation site in wild-type PML (PML WT)

(Fig. 2A, lane 1). The K65R/K160R (Fig. 2A, lane 5) and the K160R (Fig. 2A, lane 3)

mutants revealed one distinct band presumably corresponding to the SUMOylation of

K490 (marked by an asterisk), which is in turn lacking in all K490R mutants (Fig. 2A, lanes

4, 6, 7, and 8). The K490R mutant (Fig. 2A, lane 4) displayed one additional

SUMO-modiﬁed species besides K160-SUMO, corresponding to the SUMOylation of K65/160

FIG 1IE1 induces the loss of polySUMOylated PML. (A and C) HFF cells (A) or PML-kd HFFs stably expressing F-PML I (C) were either mock infected or infected with AD169 at an MOI of 3. At the indicated time points postinfection, cells were harvested and analyzed by Western blotting for IE1,␤-actin, and PML (A) or F-PML (C). (B) HFF F-IE1 cells with doxycycline-inducible expression of F-IE1 were either not induced or induced with 0.5␮g/ml doxycycline. Cells were harvested at the indicated time points and analyzed by Western blotting for PML, F-IE1 and␤-actin. Asterisks indicate the residual monoSUMOylated PML species. (D) PML-kd HFFs stably overexpressing F-PML I were either mock infected or infected with AD169 at an MOI of 3. At 24 h postinfection the cells were lysed under denaturing conditions in the presence of 20 mM NEM and subjected to immunoprecipitation using anti-FLAG antibody or mouse IgG Fc fragment as a control. Lysates (left panel) and immunoprecipitates (IP) (right panel) were analyzed by Western blotting to detect SUMO2/3 and F-PML I. Lysates were additionally analyzed to detect IE1 as an infection control and␤-actin as a loading control.

http://jvi.asm.org/

[image:4.585.42.397.74.389.2]

(5)

(marked by a diamond). Interestingly, PML K490-SUMO migrates approximately 15 kDa

higher than the unmodiﬁed PML and seems to be exclusively monoSUMOylated. Thus,

we speculated that PML K490-SUMO represents the monoSUMOylated species that is

unaffected by IE1. To prove this hypothesis, we cotransfected an IE1 expression plasmid

FIG 2IE1 speciﬁcally affects the SUMOylation of PML K160. (A and B) HEK293T cells were transfected with expression plasmids encoding myc-tagged PML (M-PML) variants (A) or cotransfected with expression plasmids encoding M-PML variants and IE1 (B) as indicated. At 48 h posttransfection, the cells were harvested and analyzed by Western blotting for the detection of M-PML, IE1, and␤-actin. Asterisks indicate the residual monoSUMOylated PML species referring to K490 SUMOylation. Circles and diamonds indicate the disappearing SUMOylated PML species referring to K160 and K65/160 SUMOylation, respectively. (C to F) HFFs stably expressing F-PML VI WT (C), F-PML VI K160R (D), F-PML VI K490R (E), or F-PML VI 3KR (F) were either mock infected or infected with AD169 at an MOI of 3. At the indicated time points postinfection, cells were harvested and analyzed by Western blotting for F-PML, IE1, and␤-actin.

http://jvi.asm.org/

[image:5.585.44.420.71.604.2]

(6)

together with plasmids for PML WT, K160R, K490R, and 3KR. Strikingly, the expression

of IE1 led to a complete loss of PML K160-SUMO as well as PML K65/160-SUMO, while

the SUMOylation of PML K490 seemed to be resistant against IE1 action (Fig. 2B). In

order to conﬁrm these data in the context of infection, we generated HFF cells stably

overexpressing FLAG-tagged versions of PML VI WT, K160R, K490R, and 3KR. Under

these conditions, we surprisingly observed a residual modiﬁed band (arrowhead) in

HFFs expressing PML 3KR (Fig. 2F, lane 1). This band probably arises from one further

diSUMOylated or two monoSUMOylated SUMO sites, as it migrates approximately 30

kDa higher than unmodiﬁed PML. Interestingly, this SUMOylation was also unaffected

by IE1, since the modiﬁed band did not disappear during AD169 infection (Fig. 2C, D,

E, and F, lanes 6). In addition to this uncharacterized band, only K490 SUMOylation

remained during AD169 infection, thereby demonstrating that this SUMO modiﬁcation

represents the resistant monoSUMOylation during infection (Fig. 2C and D, lanes 6).

Taken together, we provide evidence that IE1 selectively affects SUMOylation at

K65/K160 of PML in order to disrupt NB integrity, whereas SUMOylation of K490, and

probably SUMOylation of one or two additional sites, remains unaffected.

IE1 prevents arsenic trioxide-mediated PML degradation.

Lysine 160 is thought

to be the main conjugation site for polySUMO chains during the process of arsenic

trioxide (As

2

O

3

)-induced degradation of PML (6). These polySUMO chains are targeted

by the cellular STUbL RNF4, which mediates ubiquitination and subsequent

protea-somal degradation (21, 41). Having shown that lysine 160 is selectively affected by

HCMV IE1, the question arose whether IE1 can disturb this As

2

O

3

-mediated degradation

of PML. To clarify this issue, we utilized HFF cells with doxycycline-inducible expression

of wild-type IE1 or truncated IE1 1–382 (IE1

CORE

), which was described to be sufﬁcient

for loss of PML SUMOylation (30, 42). As illustrated in Fig. 3A and B, lanes 1 to 6, As

2

O

3

provokes the hyperSUMOylation of endogenous nuclear PML isoforms, starting at 0.5 h

after treatment and ﬁnally resulting in the degradation of PML at 24 h. As previously

described, this degradation of PML could be reversed by addition of the proteasome

inhibitor MG132 (Fig. 3A and B, lanes 7) (6). In agreement with the data shown in Fig.

1, PML was found to be partially deSUMOylated after doxycycline-induced expression

of wild-type IE1 (Fig. 3A, lane 8) as well as IE1

CORE

(Fig. 3B, lane 8). Interestingly, IE1 and

IE1

CORE

not only caused the loss of physiological PML SUMOylation but also prevented

As

2

O

3

-mediated hyperSUMOylation (Fig. 3A and B, lanes 9, 10, 11, and 12). Strikingly,

this activity of IE1 blocked the degradation of PML (Fig. 3A and B, compare lanes 13 and

6). These ﬁndings further strengthen the assumption that IE1 selectively affects the

SUMOylation, and also the hyperSUMOylation, of PML lysine 160, which is a crucial

residue during As

2

O

3

-mediated degradation of PML.

FIG 3IE1 prevents arsenic trioxide-mediated PML degradation. (A and B) HFF cells with doxycycline-inducible expression of F-IE1 (A) or F-IE1CORE(B) were either not induced or induced with 0.5␮g/ml doxycycline for 16 h, followed by As2O3(1␮M) and simultaneous MG132 (10␮M) treatment when indicated. Cells were harvested at the indicated time points and analyzed by Western blotting for PML, F-IE1, and␤-actin.

on November 7, 2019 by guest

http://jvi.asm.org/

[image:6.585.45.544.72.244.2]

(7)

A SUMO mutant resistant to SUMO proteases is stably conjugated to PML.

The

SUMOylation and deSUMOylation of PML is a very dynamic and reversible process due

to the presence of SUMO E3 ligases on the one hand and SUMO proteases on the other

hand (20). Unfortunately, these dynamics impede the ability to discriminate whether

IE1 mediates proteolytic PML deSUMOylation or inhibition of PML

de novo

SUMOyla-tion. To overcome these dynamics, we generated a nondeconjugatable mutant of

SUMO2 by mutagenizing SUMO residue 90 from glutamine to proline (43). Since SUMO

proteases are necessary not only for deconjugation of SUMO but also for processing

and thereby conjugation, we utilized an already processed version of SUMO2, termed

SUMO2 Q90P. First, we tested whether SUMO2 Q90P is conjugated to PML as efﬁciently

as SUMO2 WT. Therefore, we transiently transfected HEK293T cells with expression

vectors for PML VI and SUMO2 WT or SUMO2 Q90P and harvested the cells at 48 h

posttransfection by immediately lysing the cells under strictly denaturing conditions. As

shown in Fig. 4A, both SUMO2 WT and SUMO2 Q90P were conjugated to PML to

approximately the same extent. Next, we set out to examine whether SUMO2 Q90P is

more stably conjugated to PML than SUMO2 WT due to its resistance to SUMO

proteases. For this purpose, we again transfected HEK293T cells with aforementioned

constructs and lysed the cells using a nondenaturing NP-40 lysis buffer with or without

the cysteine protease inhibitor

N

-ethylmaleimide (NEM). It is known that rapid

de-SUMOylation of proteins occurs under nondenaturing lysis conditions, which is a

consequence of the constitutive activity of endogenous SUMO proteases (44). By

addition of NEM, SUMOylation can be retained to a certain degree. As expected, no

SUMO2 WT conjugates of PML could be detected in the absence of NEM (Fig. 4B, lane

5). However, the addition of NEM to the nondenaturing lysis buffer was sufﬁcient to

stabilize the SUMOylation of PML mediated by SUMO2 WT (Fig. 4C, lane 5). In contrast,

the SUMO2 Q90P mutant was found to be conjugated to PML in both the absence and

presence of NEM, thereby conﬁrming a stable conjugation despite the presence of

SUMO proteases (Fig. 4B and C, lanes 6). Taking these ﬁndings together, due to its

resistance to SUMO protease cleavage, SUMO2 Q90P could be identiﬁed as a tool to

overcome the SUMOylation dynamics and thus to discriminate between proteolytic

PML deSUMOylation and inhibition of PML

de novo

SUMOylation.

FIG 4A SUMO mutant resistant to SUMO proteases is stably conjugated to PML. HEK293T cells were cotransfected with expression plasmids encoding M-PML and F-SUMO2 WT or F-SUMO2 Q90P as indicated. At 48 h posttransfection, the cells were lysed by immediately boiling the cell pellet in SDS loading buffer (A) or by incubating the cells with NP-40 buffer without NEM (B) or with 30 mM NEM (C). The lysates were analyzed by Western blotting for the detection of M-PML, ␤-actin, F-SUMO2 WT, and F-SUMO2 Q90P. Densitometric analysis of the F-SUMO2 signals in panel A, lanes 5 and 6, revealed relative intensities of 100% and 121%, respectively.

on November 7, 2019 by guest

http://jvi.asm.org/

[image:7.585.43.545.70.294.2]

(8)

IE1 prevents PML

de novo

SUMOylation

in vivo

.

Next, we set out to develop a

cell-based system that, by using the SUMO protease-resistant SUMO2 Q90P mutant,

allows the discrimination between IE1-mediated proteolytic deSUMOylation of PML

and inhibition of PML

de novo

SUMOylation. For this, we generated HEK293 cells with

doxycycline-inducible expression of IE1 by lentiviral transduction. Examination of the

IE1 expression kinetics revealed increasing protein levels until 24 h after doxycycline

stimulation but no further accumulation at 30 h (Fig. 5A). As our own observations and

earlier studies indicate that a high expression level of IE1 is crucial for its effect on PML

SUMOylation, we selected an induction time of 24 h for further experiments (29).

Immunoﬂuorescence analysis at this time point disclosed a high percentage of positive

cells (

⬎

85%) (Fig. 5B). Next, we combined this inducible system and the

nondeconju-gatable SUMO mutant in an assay that should have the following outcomes depending

on the mode of IE1 action. If IE1 inhibits PML

de novo

SUMOylation, expression of IE1

after transfection of a plasmid for SUMO2 Q90P should not affect the SUMOylation

pattern of PML, whereas expression of IE1 before SUMO2 Q90P transfection should

result in a loss of PML SUMOylation. Alternatively, if IE1 acts in a proteolytic way either

by acting as or recruiting a SUMO protease, the time point of IE1 expression should not

have major effects on the PML SUMOylation pattern. Intriguingly, a clear difference in

the SUMOylation state of PML was observed in the two experimental settings: IE1

expression before transfection of plasmids for PML and SUMO2 Q90P induced an

almost complete loss of PML SUMOylation (Fig. 5C and E, lanes 6 and 7), while PML was

still heavily SUMOylated when the expression of IE1 was started after transfection of

plasmids for PML and SUMO2 Q90P (Fig. 5D and F, lanes 6 and 7). In a control

experiment with SUMO2 WT, we observed a depletion of SUMOylated PML irrespective

of whether IE1 was expressed before or after transfection (Fig. 5G and H). These results

demonstrate that the reversible, dynamic nature of the SUMOylation system strongly

inﬂuences the experimental outcome and underline the importance of utilizing a

nondeconjugatable SUMO mutant. Furthermore, the observation that IE1 is able to

prevent the modiﬁcation of PML with this SUMO2 Q90P mutant strongly suggests that

IE1 disrupts NBs via the inhibition of PML

de novo

SUMOylation.

IE1 prevents PML

de novo

SUMOylation

in vitro

.

In order to conﬁrm the data that

we obtained in HEK293 cells using an alternative experimental system, we produced

prokaryotically expressed and puriﬁed proteins for subsequent

in vitro

SUMOylation

assays, in which the mixtures contain all components necessary and sufﬁcient for

protein SUMOylation (45). As these systems are devoid of SUMO proteases as well as

SUMO E3 ligases present in eukaryotic extracts, they provided a further possibility to

overcome the rapid SUMOylation dynamics and, in addition, to determine whether IE1

alone is sufﬁcient for the loss of PML SUMOylation. In order to achieve a stable complex

of puriﬁed PML (GST-PML VI) and IE1 (His-IE1

CORE

), we utilized a system that contains

two plasmids with different antibiotic resistance genes and origins of replication (ori),

thereby allowing simultaneous expression of the two proteins in one prokaryotic cell.

The IE1/PML protein complex was puriﬁed via binding of His-IE1

CORE

to an Ni-Sepharose

matrix to ensure that each PML molecule was occupied by IE1

CORE

. The speciﬁc

interaction between IE1

CORE

and PML VI was conﬁrmed by glutathione

S

-transferase

(GST) pulldown analysis (Fig. 6A). Initially, we tested the ability of GST-PML VI, which

was puriﬁed using glutathione Sepharose, to become

in vitro

SUMOylated. Notably,

while a monoSUMOylated form of PML was observed after 1 h of incubation with the

SUMOylation kit (Fig. 6B, lane 2), polySUMOylation of PML occurred only after a longer

incubation time of 4 h (Fig. 6B, lane 3). Comparative analysis of the SUMOylation of PML

alone with SUMOylation of the PML/IE1

CORE

complex after a 4-h

in vitro

reaction

revealed a drastic reduction of SUMO-modiﬁed PML variants in the presence of IE1

CORE

:

polySUMOylation was completely abolished, while monoSUMOylation remained to a

minor extent (Fig. 6C, compare lanes 2 and 4). In contrast, the addition of IE1

CORE

to

preSUMOylated PML did not result in any reduction of PML SUMOylation, thereby

conﬁrming the

in vivo

results (Fig. 6D, lanes 2 and 3). Altogether, our data provide direct

http://jvi.asm.org/

(9)

FIG 5IE1 prevents PMLde novoSUMOylationin vivo. (A and B) HEK293-IE1 cells were not induced or induced with doxycycline (0.5␮g/ml). (A) At the indicated time points, the cells were harvested and analyzed by Western blotting for IE1 and␤-actin. (B) At 24 h post induction, immunodetection of IE1 was conducted by using an anti-IE1 antibody. (C) Timeline for the experiments for panels E and G. (D) Timeline for the experiments for panels F and H. (E to H) HEK293-IE1 cells were cotransfected with expression plasmids encoding M-PML and F-SUMO2 WT or F-SUMO2 Q90P as indicated. IE1 expression was induced with doxycycline (0.5␮g/ml). Cells were harvested after a total time of 72 h and analyzed by Western blotting for the detection of M-PML, IE1, ␤-actin, F-SUMO2 WT, and F-SUMO2 Q90P. Densitometric analysis of the F-SUMO2-Q90P signals in panel E, lanes 6 and 7, revealed relative intensities of 100% and 31%, while the signal intensities in panel F, lanes 6 and 7, were 100% and 92%, respectively. The signal intensities for F-SUMO2 WT in panel G, lanes 6 and 7, were 100% and 22%, respectively. For panel H, lanes 6 and 7, the signal intensities were 100% and 31%, respectively.

on November 7, 2019 by guest

http://jvi.asm.org/

[image:9.585.41.395.67.638.2]

(10)

evidence that IE1 alone is able to prevent

de novo

SUMOylation of PML but does not

abrogate the SUMOylation of preSUMOylated PML.

IE1 interacts with the dimeric PML coiled coil without interfering with PML

dimerization.

The coiled-coil domain of TRIM family proteins has been described to be

involved in homointeractions which are necessary for the biochemical activity of TRIM

proteins (46, 47). For PML, the coiled-coil-mediated dimerization is thought to be a

prerequisite for its SUMO E3 ligase activity and for PML autoSUMOylation. Since IE1

CORE

was shown to interact with the coiled-coil domain of PML, we asked whether IE1 affects

PML SUMOylation by disrupting the coiled-coil-mediated self-interaction (30). For this

purpose, we performed competitive coimmunoprecipitation experiments using two

differentially tagged versions of PML and increasing amounts of IE1

CORE

. As shown in

Fig. 7A, we could not detect any decrease in PML homodimerization upon coexpression

of IE1

CORE

. The same results were obtained when utilizing the isolated PML coiled-coil

domains in combination with IE1

CORE

or with full-length IE1 (Fig. 7B). These data

indicate that IE1 directly interacts with the dimeric coiled-coil domain of PML to prevent

PML

de novo

SUMOylation, without interfering with PML dimerization.

DISCUSSION

It is well known that HCMV IE1 induces the loss of PML SUMOylation, thereby

antagonizing NB-mediated intrinsic immunity (26–30, 32, 34–36, 48). However, the

underlying mechanism remained elusive for the last decades. IE1-mediated loss of PML

SUMOylation could be achieved either by proteolytic deSUMOylation or by inhibition of

de novo

SUMOylation. In the present study, we report for the ﬁrst time that IE1 is able

to prevent the

de novo

SUMOylation of PML. By using a nondeconjugatable SUMO

mutant, described by Békés and colleagues, we were able to overcome the rapid and

reversible dynamics of PML SUMOylation (43). These dynamics are caused by the

FIG 6IE1 prevents PMLde novoSUMOylationin vitro. (A) GST pulldown analysis of prokaryotically expressed GST, GST-PML, and His-IE1CORE. Bound proteins were eluted by boiling the glutathione-Sepharose beads in SDS loading buffer. Eluted proteins and input were analyzed by Western blotting for the detection of GST fusions and His-IE1CORE. (B to D) Bacterially expressed and puriﬁed proteins were incubated together with anin vitroSUMOylation kit containing E1 (SAE1/SAE2), Ubc9, ATP, and SUMO3 for the indicated times (B) or for 4 h (C and D) as described in Materials and Methods. (B and C) The reaction mixes were analyzed by Western blotting using anti-PML antibody (B) or both anti-PML and anti-His antibodies (C). (D) After terminating the reaction by adding 10 mM each EDTA and DTT, the mix was again incubated for 1 h in the presence or absence of bacterially expressed and puriﬁed His-IE1CORE.

The reaction mixes were analyzed by Western blotting using anti-PML and anti-His antibodies.

on November 7, 2019 by guest

http://jvi.asm.org/

[image:10.585.72.338.70.310.2]

(11)

presence of both SUMO conjugating enzymes and deconjugating SUMO proteases

inside PML NBs, which are considered to represent nuclear “SUMO hot spots” (19). An

experimental approach which combined this SUMO mutant with inducible expression

of IE1 revealed that IE1 affects the PML SUMOylation status only when it is present

before SUMOylation takes place (Fig. 5C and E). In contrast, when IE1 is expressed after

PML SUMOylation, no loss of PML SUMOylation is detectable (Fig. 5D and F).

Further-more, this effect seems to be independent of additional cellular proteins, as we

observed the same outcome

in vitro

by using prokaryotically expressed and puriﬁed

proteins (Fig. 6). Notably, we obtained further evidence that formation of a tight

complex between IE1 and PML is critical for IE1 action, since the inhibitory effect on

PML SUMOylation as detected by

in vitro

SUMOylation was evident only when we

utilized a puriﬁed IE1/PML complex and not when using separately puriﬁed proteins

(data not shown). This may explain the contradicting results reported by Kang and

colleagues, who pursued the latter strategy and did not observe effects of IE1 on PML

SUMOylation by

in vitro

SUMOylation and therefore proposed that IE1 neither interferes

with PML SUMOylation nor directly causes PML deSUMOylation by acting as a SUMO

protease itself (48). The latter was actually conﬁrmed by our experiments: the addition

of puriﬁed IE1 to preSUMOylated PML did not affect the SUMOylation status of PML

(Fig. 6D). This ﬁnding is additionally supported by structural analysis of IE1

CORE

, which

provides no evidence for the presence of a potential active site with hydrolase activity

(30).

The observation that IE1 exclusively affects PML polySUMOylation has already been

made in earlier studies (Fig. 1) (29, 40). However, by utilizing a variety of PML

SUMOylation site mutants, we now provide evidence that the residual

monoSUMO-ylated form can be assigned to a PML, which is SUMO modiﬁed on lysine 490 (Fig. 2C

to F). Three major SUMOylation sites have been reported for PML: K65, K160, and K490

(10). When we mutated these three lysine residues to arginine, followed by expression

of the triple mutant (3KR) in HEK293T cells, SUMOylation of PML was completely

abolished (Fig. 2A, lane 8). Surprisingly, the same mutant, stably expressed in HFF cells,

revealed one residual slower-migrating band which might correspond either to a PML

that is monoSUMOylated on two additional SUMO sites or to a diSUMOylated PML

FIG 7IE1 does not act by interfering with PML dimerization. (A) HEK293T cells were cotransfected with expression plasmids encoding F-PML VI and M-PML VI with increasing amounts of M-IE1COREconstruct. (B) HEK293T cells were cotransfected with expression plasmids encoding the F-PML coiled-coil domain (CC) and GFP-PML CC with increasing amounts of M-IE1COREor M-IE1 FL constructs. Upper panels, Western blot detection of M-PML VI (A) or GFP-PML CC (B) after immunoprecipitation with an anti-FLAG antibody (IP). Lower three panels, detection of M-PML VI (A) or GFP-PML CC (B) and F-PML VI (A) or F-PML CC (B) and M-IE1 variants (as indicated) in cell lysates before precipitation (input).

http://jvi.asm.org/

[image:11.585.44.463.71.287.2]

(12)

(Fig. 2F). The same modiﬁed band was detected in PML WT, K160R, and K490R cells after

mock as well as HCMV infection, thereby suggesting the existence of at least one

additional SUMO site that is not affected by IE1 (Fig. 2C to E). A similar phenomenon

was observed by Cuchet-Lourenço and colleagues when expressing the PML I 3KR

mutant in HFFs. However, the mutation of one further minor SUMOylation site (K616)

eliminated all modiﬁed bands (49). PML VI lacks the K616 SUMO site; however, four

additional minor SUMOylation sites (K226, K380, K497, and K400) were reported for this

isoform, which might be SUMOylated under speciﬁc conditions in a cell type-speciﬁc

manner (50, 51). In summary, when taking into account previous results demonstrating

that K65 is modiﬁed only when K160 is SUMOylated, IE1 appears to selectively inhibit

K160 SUMOylation in order to induce PML NB disruption (21). This assumption is further

strengthened by the ﬁnding that IE1 and also its central domain IE1

CORE

is able to

prevent As

2

O

3

-mediated hyperSUMOylation of PML (Fig. 3), which takes place on K160

(6). Additionally, this ﬁnding highlights the capability of IE1 to prevent not only

physiological polySUMOylation but also hyperSUMOylation under cellular stress

con-ditions.

Having demonstrated that IE1 exclusively affects the on-rate of PML SUMO

modi-ﬁcation without requiring additional proteins, we can now narrow down the possible

mechanistic scenarios. IE1 is able to prevent PML SUMOylation

in vitro

, which limits the

number of IE1 target proteins to the E1-activating enzyme, a heterodimer of SAE1 and

SAE2, the E2-conjugating enzyme Ubc9, the SUMO protein, and PML itself. Surprisingly,

despite the fact that IE1 itself is a SUMO substrate, interactions between IE1 and Ubc9

or SUMO could not be demonstrated, making it rather unlikely that IE1 targets these

factors (32, 33). To our knowledge, an interaction with the E1-activating enzyme has

also not been observed for IE1, as is true for the avian adenoviral protein Gam1, which

is able to induce a global loss of SUMOylation (52). In contrast to Gam1, IE1 acts not by

reducing global SUMO conjugation but by speciﬁc interference with the SUMOylation

of PML and Sp100 (53). Consequently, the hypothesis arose that there must be a more

targeted action of IE1, presumably by acting on PML itself. This is strengthened by the

fact that a direct binding of IE1 to PML is a prerequisite for IE1 action (29, 34). Due to

the following reasons, we would further suggest that the integrity of the central

globular domain of IE1, termed IE1

CORE

, is needed for the loss of PML SUMOylation.

First, IE1

CORE

is described as an elongated molecule consisting of a single contiguous

domain with conserved residues distributed evenly over the entire surface (30). Second,

IE1

CORE

is hypersensitive to mutational interventions (36–38). Third, further attempts to

narrow down the binding region by mutations and deletions failed. We strongly favor

a model whereby the IE1 globular core domain targets the PML coiled-coil domain via

coiled-coil interactions, thereby preventing the

de novo

SUMOylation of PML.

An interesting mechanism was described for inﬂuenza virus protein NS1, which

prevents TRIM25 oligomerization, thereby abrogating its ubiquitin E3 ligase activity

(54). However, the idea that IE1 interferes with SUMO E3 ligase activity by preventing

PML dimerization was rejected, as IE1 does not decrease homointeractions of PML (Fig.

7). Thus, one possible scenario is that IE1 blocks SUMO E3 ligase activity of PML by a

mechanism independent of PML dimerization. By mutating key zinc-chelating residues,

Chu and Yang demonstrated that RING and B-box domains are likely required for the

SUMO E3 ligase activity of PML (16). Interestingly, when expressing these RING and

B-box mutants, PML was found only monoSUMOylated, which led us to speculate that

the SUMO E3 ligase activity of PML is necessary for its own polySUMOylation (16). The

assumption that IE1 selectively affects the SUMOylation of PML K160, which is nearby

the IE1 binding site on PML, raised another idea. IE1 may also act by simply covering

the K160 SUMO site or by blocking the accessibility of PML for the components of the

cellular SUMOylation machinery, thereby preventing SUMOylation by a steric hindrance

mechanism. This idea is supported by the fact that IE1 does oligomerize, thereby

potentially providing an enlarged surface (30). In addition to this, the assumption that

the interaction with PML is a prerequisite for IE1 action bears similarity to the case for

http://jvi.asm.org/

(13)

the adenoviral E4-ORF3 protein, which is suggested to inactivate PML via tight binding

using a multivalent matrix built by extensive multimerization (55).

Taken together, the results presented in this study clearly demonstrate that IE1

selectively abrogates the

de novo

SUMOylation of PML at speciﬁc lysine residues, which

may be due either to interference with the E3 ligase function of PML or to steric

hindrance which blocks access to speciﬁc SUMOylation sites. Further attempts to

understand the molecular architecture of the IE1-PML protein complex by

cocrystalli-zation will help to distinguish between these two possibilities.

MATERIALS AND METHODS

[image:13.585.41.376.82.281.2]

Oligonucleotides and plasmid constructs.The oligonucleotide primers used for this study were purchased from Biomers GmbH (Ulm, Germany) and are listed in Table 1. Lentivirus vectors expressing FLAG-tagged versions of PML isoforms I to VI were kindly provided by Roger Everett (Glasgow, UK) (56). All cDNAs encoding the PML isoforms have been made resistant to the anti-PML short hairpin RNA (shRNA) siPML2; the altered sequence is 5=-AGATGCTGCAGTTAGCAAG-3=(31). For the generation of Myc-PML VI as well as FLAG-PML VI and FLAG-PML 228 –399 (CC), PML isoform VI was amplified from pAS-PML (a gift from Gerd Maul) and inserted into pHM1580 Myc) or pHM971 (pcDNA3.1-FLAG) as described elsewhere (30, 31, 57, 58). The construct for transient expression of green fluorescent protein (GFP)-PML 228 –399 (CC) was generated by amplification using the above-mentioned pcDNA3.1-Myc PML VI and primers 5=PMLaa228_SalI and 3=PMLaa399_BamHI, followed by insertion via SalI and BamHI into pEGFP C1 (Clontech, Mountain View, CA, USA). The constructs for transient expression of IE1 (pHM494), Myc-IE1, and Myc-IE1COREwere generated as described elsewhere (30, 57). Derivatives of Myc-PML isoform VI with point mutations in the SUMO modification sites (SUMOmut; K160R, K490R, and 3KR) were constructed by site-directed mutagenesis using a QuikChange site-directed mutagenesis kit as instructed by the manufacturer (Stratagene, La Jolla, CA, USA). The constructs for the stable overexpres-sion of PML VI WT, PML VI K160R, PML VI K490R, and PML VI 3KR were generated by amplification using the above-mentioned PML VI constructs and primers 5=PML_SalI and 3=EcoRI_PML6, followed by insertion via SalI and EcoRI into a modified pLKO-based lentiviral vector. The modified pLKO-based lentiviral vector was generated by exchanging the CMV major immediate early promoter (MIEP) via NdeI/PacI for an EF1␣ promoter amplified with primers 5=EF1alpha-NdeI and 3=EF1alpha-PacI. For inducible expression of IE1, the entry vector pDONR221-IE1 was introduced into the pINDUCER20 destination vector using the Invitrogen Gateway recombination technology (Thermo Fisher Scientific, Waltham, MA, USA) (53, 59). The FLAG-SUMO2 Q90P mutant was generated by using the GeneArt site-directed mutagenesis kit as instructed by the manufacturer (Thermo Fisher Scientific, Waltham, MA, USA) with pcDNA3-FLAG-SUMO2 as the template (57). The processed FLAG-SUMO2 Q90P was generated by amplification using the mutagenized construct and primers 5=SUMO2_BamHI and 3=Xba_SUMO2_GG, followed by insertion via BamHI and XbaI into pHM971 (pcDNA3.1-FLAG) (57). For bacterial expression of GST-tagged full-length PML, the synthetic, codon-optimized cDNA of PML VI was synthesized by the GeneArt gene synthesis service (Thermo Fisher Scientific, Waltham, MA, USA) and was cloned into the prokaryotic expression vector pGEX-6P-1 (GE Healthcare, Munich, Germany) via BamHI/XhoI. His-IE1 14 –382 was obtained by subcloning a synthetic codon-optimized version of the IE1 cDNA sequence purchased from the GeneArt gene synthesis service into pCOLADuet-1 (Novagen, Merck Millipore, Billerica. MA, USA) via BamHI and NotI. The integrity of all newly generated plasmids was confirmed by automated DNA sequence analysis.

TABLE 1Oligonucleotides used for plasmid construction

Purpose and oligonucleotide Sequence

Mutagenesis

5=PML-SUMO65-mut CCAGGCGGAAGCCAGGTGCCCGAAGCTGC

3=PML-SUMO65-mut GCAGCTTCGGGCACCTGGCTTCCGCCTGG

5=PML-SUMO160-mut CCAGTGGTTCCTCAGGCACGAGGCCCGGC

3=PML-SUMO160-mut GCCGGGCCTCGTGCCTGAGGAACCACTGG

5=PML-SUMO490-mut CCAGGAAGGTCATCAGGATGGAGTCTGAGGAGG

3=PML-SUMO490-mut CCTCCTCAGACTCCATCCTGATGACCTTCCTGG

5=SUMO2_Q90Pmut GATGTGTTCCAACAGCCAACGGGAGGTGTCTAC

3=SUMO2_Q90Pmut GTAGACACCTCCCGTTGGCTGTTGGAACACATC

Ampliﬁcation

5=PMLaa228_SalI CATAGTCGACGACATCAGCGCAGAGATCCA

3=PMLaa399_BamHI CATAGGATCCTCATGGATACAGCTGCATCTTTC

5=PML-SalI CATAGTCGACATGGAGCCTGCACCCGCCCG

3=EcoRI_PML6 CATAGAATTCTCACCACAACGCGTTCCTCTC

5=EF1alpha-NdeI CATACATATGCCCGTCAGTGGGCAGAG

3=EF1alpha-PacI CATATTAATTAATATTAGTACCAAGCTAATTC

5=SUMO2_BamHI CATAGGATCCGCCGACGAAAAGCCCAAGGA

3=Xba_SUMO2_GG CATATCTAGATCAACCTCCCGTTGGCTGTTG

on November 7, 2019 by guest

http://jvi.asm.org/

(14)

Cells and viruses. HEK293 and HEK293T cells were cultivated in Dulbecco’s minimal essential medium (DMEM) (Gibco, Thermo Fisher Scientific, Waltham, MA, USA) containing 10% fetal calf serum (FCS). HEK293 cells with inducible overexpression of IE1 (HEK293-IE1) were cultured in DMEM supple-mented with 10% tetracycline-free fetal bovine serum (Clontech, Palo Alto, CA, USA) and 500␮g/ml Geneticin. Primary human foreskin fibroblasts (HFFs) were prepared from human foreskin tissue and were maintained in Eagle’s minimal essential medium (MEM) (Gibco, Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 7.5% fetal calf serum. HFFs stably overexpressing F-PML VI constructs (WT, K160R, K490R, and 3KR) were maintained in MEM supplemented with 7.5% fetal calf serum and 500 ␮g/ml Geneticin. HFFs with a small interfering RNA-mediated knockdown of PML (siPML2 cells) and stable overexpression of F-PML I were maintained in MEM supplemented with 10% fetal calf serum and 5␮g/ml puromycin as well as 500␮g/ml Geneticin. HFFs with inducible expression of IE1 or IE1 1–382 were cultured in MEM supplemented with 10% tetracycline-free fetal bovine serum (Clontech, Palo Alto, CA, USA), 5␮g/ml puromycin, and 500␮g/ml Geneticin. Infection experiments were performed with the HCMV laboratory strain AD169 at specified multiplicities of infection (MOIs). Viral stocks were titrated via IE1p72 fluorescence (60). For this purpose, HFFs were infected with various dilutions of virus stocks. After 24 h of incubation, cells were fixed and stained with monoclonal antibody (MAb) p63-27, directed against IE1p72 (61). Subsequently, the number of IE1-positive cells was determined and used to calculate viral titers, expressed as IE protein-forming units (IEU).

Lentivirus transduction and selection of stably transduced cells.HFF PML-kd cells stably ex-pressing FLAG-PML I were generated via lentiviral transduction using the ViraPower lentiviral system according to the manufacturer’s protocol (Invitrogen, Karlsruhe, Germany) and were selected in Dulbec-co’s minimal essential medium supplemented with 10% fetal calf serum plus 500␮g/ml Geneticin (31). For the generation of HFF cells stably expressing FLAG-tagged PML VI WT, K160R, K490R, and 3KR or HEK293 cells stably expressing inducible IE1, replication-deﬁcient lentiviruses were generated using pLKO-based or pINDUCER20-based expression vectors. For this purpose, HEK293T cells seeded in 10-cm dishes (5⫻106_{cells) were cotransfected with a pLKO vector encoding FLAG-tagged PML versions or} pINDUCER20 vector encoding IE1 together with packaging plasmids pLP1, pLP2, and pLP/VSV-G using the Lipofectamine 2000 reagent (Invitrogen, Karlsruhe, Germany). Viral supernatants were harvested 48 h after transfection, cleared by centrifugation, ﬁltered, and stored at⫺80°C. HFFs and HEK293 cells were incubated for 24 h with lentiviral supernatants in the presence of 7.5␮g/ml Polybrene (Sigma-Aldrich, St. Louis, MO, USA). Stably transduced HFF and HEK293 cell populations were selected by adding 500 ␮g/ml Geneticin to the cell culture medium. HFFs with inducible expression of IE1 or IE1 1–382 were generated as described elsewhere (42).

Antibodies. Endogenous PML was detected by rabbit polyclonal antibodies A301-167A (Bethyl Laboratories, Montgomery, TX, USA) and A301-168A (Bethyl Laboratories, Montgomery, TX, USA) in combination. Mouse monoclonal antibody p63-27, which recognizes IE1, has been described elsewhere (61). Myc-tagged IE1 and Myc-tagged IE1COREwere detected by MAb-Myc (1-9E10.2; ATCC). MAb-FLAG 1804 (Sigma-Aldrich, St. Louis, MO, USA) was utilized for the detection of FLAG-IE1 and FLAG-IE1CORE. For the detection of Myc-, FLAG-, and GFP-tagged versions of PML the mouse monoclonal antibodies MAb-Myc (1-9E10.2; ATCC), MAb-FLAG 1804 (Sigma-Aldrich, St. Louis, MO, USA), and MAb GFP (Roche, Penzberg, Germany) were utilized. A mouse IgG Fc fragment from Dianova (Hamburg, Germany) served as control antibody. Rabbit monoclonal antibody EPR4602 (Abcam, Cambridge, UK) was utilized for the detection of endogenous SUMO2/3. Mouse monoclonal antibody AC-15, which recognizes beta-actin, was purchased from Sigma-Aldrich (St. Louis, MO, USA). Prokaryotically expressed GST-PML was detected by using rabbit polyclonal antibody H-238 (Santa Cruz Biotechnology, Santa Cruz, CA, USA) or mouse anti-GST monoclonal antibody BZL01642 (Biozol, Eching, Germany). Mouse monoclonal antibody HIS.H8 (Thermo Fisher Scientiﬁc, Waltham, MA, USA) against 6⫻His tag was utilized for the detection of prokaryotically expressed His-IE1CORE. Horseradish peroxidase-conjugated anti-mouse and anti-rabbit secondary antibodies for Western blot analysis were obtained from Dianova (Hamburg, Germany), while Alexa Fluor 555-conjugated secondary antibody for indirect immunoﬂuorescence experiments was purchased from Molecular Probes (Karlsruhe, Germany).

Transfection and doxycycline induction. HEK293T and HEK293-IE1 cells were transfected by applying the standard calcium phosphate coprecipitation method. For this, 7 ⫻ 105 _{HEK293T or} HEK293-IE1 cells were seeded into six-well dishes 1 day before transfection; 1.5 to 2␮g of plasmid DNA was used for each transfection reaction. At about 16 h later, the cells were washed two times with phosphate-buffered saline without calcium and magnesium (PBSo) and provided with fresh medium. At 48 h after transfection, cells were harvested for further analyses. The HEK293-IE1 cell line was transfected using the Lipofectamine 2000 reagent (Invitrogen, Karlsruhe, Germany), according to the instructions of the manufacturer, when transfection and doxycycline induction were combined. Cells (7⫻105_{) were} seeded into six-well dishes and were grown until the next day. IE1 expression was induced either 24 h prior to transfection or 24 h posttransfection by the addition of 0.5 ␮g/ml doxycycline. At 48 h posttransfection, cells were harvested or IE1 expression was induced for 24 h, depending on the experimental setting.

Immunoblotting.Lysates from infected HFF, transfected HEK293T, or transfected/induced HEK293-IE1 cells were prepared in sodium dodecyl sulfate (SDS)-Laemmli buffer and boiled for 10 min at 95°C (57). To analyze the stability of SUMO2 WT in comparison to SUMO2 Q90P conjugation, transfected HEK293T cells were lysed for 20 min at 4°C by addition of 800␮l NP-40 buffer (50 mM Tris-HCl [pH 8.0], 150 mM NaCl, 5 mM EDTA, 0.5% NP-40, 1 mM phenylmethylsulfonyl ﬂuoride [PMSF], 2␮g each of aprotinin, leupeptin, and pepstatin per ml buffer) in the presence or absence of a 30 mM concentration of the cysteine modiﬁerN-ethylmaleimide (NEM) (Sigma-Aldrich, St. Louis, MO, USA). After centrifugation,

on November 7, 2019 by guest

http://jvi.asm.org/

(15)

the supernatant was diluted in SDS-Laemmli buffer and boiled at 95°C for 10 min. Proteins were separated by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) on 8% to 12.5% polyacrylamide gels and transferred onto nitrocellulose membranes (GE Healthcare, Munich, Germany), followed by chemi-luminescence detection according to the manufacturer’s protocol (ECL Western blotting detection kit; Amersham Pharmacia Europe, Freiburg, Germany).

Immunoprecipitation. HFF cells stably overexpressing FLAG-PML were infected with HCMV AD169 or mock infected. At speciﬁed time points postinfection, the cells were harvested and lysed for 5 min at 4°C using denaturing radioimmunoprecipitation assay (RIPA) buffer (50 mM Tris-HCl [pH 7.4], 150 mM NaCl, 1% NP-40, 0.1% SDS, 0.5% sodium deoxycholate, 1 mM PMSF, 2␮g each of aprotinin, leupeptin, and pepstatin per ml buffer) in the presence of 20 to 30 mM NEM. After centrifugation, the supernatant was incubated with the appropriate antibody coupled to protein A-Sepharose beads for 1.5 h at 4°C. The Sepharose beads were collected and washed three times in NP-40 buffer. Antigen-antibody complexes were recovered by boiling in SDS sample buffer and analyzed via Western blotting. Coimmunoprecipitation analysis using HEK293T cells was performed as described elsewhere (30).

Indirect immunofluorescence.For indirect immunofluorescence analysis, 3.5⫻105_{HEK293-IE1 cells} were seeded on coverslips. One day after seeding, the expression of IE1 was induced by addition of 0.5 ␮g/ml doxycycline. At 24 h postinduction, the cells were fixed with a 4% paraformaldehyde solution for 10 min at room temperature (RT) and then washed twice. Permeabilization of the cells was achieved by incubation with 0.2% Triton X-100 in PBSo on ice for 20 min. Cells were washed again with PBSo over a time period of 5 min and incubated with the monoclonal antibody p63-27 detecting IE1 diluted in PBSo–1% FCS for 30 min at 37°C. Excessive antibodies were removed by washing four times with PBSo, followed by incubation with the fluorescence-coupled secondary antibody rabbit anti-mouse 555 diluted in PBSo–1% FCS for 30 min at 37°C. The cells were mounted using the DAPI (4=,6= -diamidino-2-phenylindole)-containing Vectashield mounting medium (Alexis, Grünberg, Germany) and analyzed using a Leica TCS SP5 confocal microscope with the 543-nm laser line. The images were exported, processed with Adobe Photoshop CS5, and assembled using CorelDraw⫻5. To quantify the amount of IE1-expressing cells after induction, IE1-expressing cells were counted in three fields of view, and the mean value as well as the standard deviation was calculated.

Protein generation and purification.GST, GST-PML FL, His-IE1CORE, and the complexes consisting of GST-PML FL and His-IE1COREwere produced inEscherichia colistrain BL21(DE3). For this, LB media with appropriate antibiotics were inoculated with transformed BL21(DE3). GST fusion proteins and the complex were induced by treatment with 0.1 mM isopropyl-␤-D-thiogalactoside (IPTG) for 16 h at 25°C. His-IE1COREwas induced by using 1 mM IPTG for 5 h at 30°C. Cell pellets were resuspended in the appropriate lysis buffer for either GST fusion proteins (1⫻PBSo, 2 mM PMSF, 1␮g/ml aprotinin, 1␮g/ml leupeptin, 1␮g/ml pepstatin, 2␮g/ml DNase, and 10 mM dithiothreitol [DTT]) or His fusion proteins (2⫻ PBSo, 250 mM NaCl, 2 mM PMSF, 1␮g/ml aprotinin, 1␮g/ml leupeptin, 1␮g/ml pepstatin, 2␮g/ml DNase, and 5 mM DTT), followed by sonication and centrifugation to separate the lysate from the cell debris. The fusion proteins were purified from the lysate by affinity chromatography using glutathione-Sepharose or Ni-glutathione-Sepharose according to the specifications of the manufacturer (GE Healthcare, Freiburg, Germany). Eluted proteins were analyzed by SDS-PAGE and Coomassie blue staining.

In vitroSUMOylation assays.In vitroSUMOylation reactions were performed at 37°C for 1 to 4 h in a 20-␮l volume containing prokaryotically expressed proteins along with a 50 nM concentration of the heterodimeric human E1-activating enzyme (SAE1/SAE2), a 62.5␮M concentration of the E2-conjugating enzyme UbcH9, 1 mM Mg-ATP, 25␮M SUMO3, and reaction buffer (500 mM HEPES [pH 8], 1,000 mM NaCl, 10 mM DTT) according to the manufacturer’s protocol (BostonBiochem, Cambridge, MA, USA). After termination of the reaction using SDS sample buffer containing beta-mercaptoethanol, the reaction products were fractionated by 8% SDS-PAGE for immunoblot detection of IE1COREand PML.

ACKNOWLEDGMENTS

We thank Roger Everett (Glasgow, UK) for providing expression vectors for PML

isoforms and Regina Müller (Erlangen, Germany) for excellent technical assistance.

REFERENCES

1. Ishov AM, Sotnikov AG, Negorev D, Vladimirova OV, Neff N, Kamitani T, Yeh ET, Strauss JF, III, Maul GG. 1999. PML is critical for ND10 formation and recruits the PML-interacting protein daxx to this nuclear structure when modiﬁed by SUMO-1. J Cell Biol 147:221–234. https://doi.org/ 10.1083/jcb.147.2.221.

2. Lallemand-Breitenbach V, de The H. 2010. PML nuclear bodies. Cold Spring Harb Perspect Biol 2:a000661. https://doi.org/10.1101/ cshperspect.a000661.

3. Tavalai N, Stamminger T. 2008. New insights into the role of the sub-nuclear structure ND10 for viral infection. Biochim Biophys Acta 1783: 2207–2221. https://doi.org/10.1016/j.bbamcr.2008.08.004.

4. Everett RD, Chelbi-Alix MK. 2007. PML and PML nuclear bodies: implica-tions in antiviral defence. Biochimie 89:819 – 830. https://doi.org/ 10.1016/j.biochi.2007.01.004.

5. Jensen K, Shiels C, Freemont PS. 2001. PML protein isoforms and the RBCC/TRIM motif. Oncogene 20:7223–7233. https://doi.org/10.1038/ sj.onc.1204765.

6. Lallemand-Breitenbach V, Zhu J, Puvion F, Koken M, Honore N, Doubeik-ovsky A, Duprez E, Pandolﬁ PP, Puvion E, Freemont P, de The H. 2001. Role of promyelocytic leukemia (PML) sumolation in nuclear body for-mation, 11S proteasome recruitment, and As2O3-induced PML or PML/ retinoic acid receptor alpha degradation. J Exp Med 193:1361–1371. https://doi.org/10.1084/jem.193.12.1361.

7. Zhong S, Muller S, Ronchetti S, Freemont PS, Dejean A, Pandolﬁ PP. 2000. Role of SUMO-1-modiﬁed PML in nuclear body formation. Blood 95: 2748 –2753.

8. Borden KL. 2008. Pondering the puzzle of PML (promyelocytic leukemia) nuclear bodies: can we ﬁt the pieces together using an RNA regulon?

on November 7, 2019 by guest

http://jvi.asm.org/

(16)

Biochim Biophys Acta 1783:2145–2154. https://doi.org/10.1016/ j.bbamcr.2008.06.005.

9. Liang YC, Lee CC, Yao YL, Lai CC, Schmitz ML, Yang WM. 2016. SUMO5, a novel poly-SUMO isoform, regulates PML nuclear bodies. Sci Rep 6:26509. https://doi.org/10.1038/srep26509.

10. Kamitani T, Kito K, Nguyen HP, Wada H, Fukuda-Kamitani T, Yeh ET. 1998. Identiﬁcation of three major sentrinization sites in PML. J Biol Chem 273:26675–26682. https://doi.org/10.1074/jbc.273.41.26675.

11. Kamitani T, Nguyen HP, Kito K, Fukuda-Kamitani T, Yeh ET. 1998. Cova-lent modiﬁcation of PML by the sentrin family of ubiquitin-like proteins. J Biol Chem 273:3117–3120. https://doi.org/10.1074/jbc.273.6.3117. 12. Duprez E, Saurin AJ, Desterro JM, Lallemand-Breitenbach V, Howe K,

Boddy MN, Solomon E, de The H, Hay RT, Freemont PS. 1999. SUMO-1 modiﬁcation of the acute promyelocytic leukaemia protein PML: impli-cations for nuclear localisation. J Cell Sci 112:381–393.

13. Tatham MH, Jaffray E, Vaughan OA, Desterro JM, Botting CH, Naismith JH, Hay RT. 2001. Polymeric chains of SUMO-2 and SUMO-3 are conju-gated to protein substrates by SAE1/SAE2 and Ubc9. J Biol Chem 276:35368 –35374. https://doi.org/10.1074/jbc.M104214200.

14. Hay RT. 2005. SUMO: a history of modiﬁcation. Mol Cell 18:1–12. https:// doi.org/10.1016/j.molcel.2005.03.012.

15. Quimby BB, Yong-Gonzalez V, Anan T, Strunnikov AV, Dasso M. 2006. The promyelocytic leukemia protein stimulates SUMO conjugation in yeast. Oncogene 25:2999 –3005. https://doi.org/10.1038/sj.onc.1209335. 16. Chu Y, Yang X. 2011. SUMO E3 ligase activity of TRIM proteins. Oncogene

30:1108 –1116. https://doi.org/10.1038/onc.2010.462.

17. Guo L, Giasson BI, Glavis-Bloom A, Brewer MD, Shorter J, Gitler AD, Yang X. 2014. A cellular system that degrades misfolded proteins and protects against neurodegeneration. Mol Cell 55:15–30. https://doi.org/10.1016/ j.molcel.2014.04.030.

18. Shen TH, Lin HK, Scaglioni PP, Yung TM, Pandolﬁ PP. 2006. The mech-anisms of PML-nuclear body formation. Mol Cell 24:331–339. https:// doi.org/10.1016/j.molcel.2006.09.013.

19. Van Damme E, Laukens K, Dang TH, Van OX. 2010. A manually curated network of the PML nuclear body interactome reveals an important role for PML-NBs in SUMOylation dynamics. Int J Biol Sci 6:51– 67. 20. Wilkinson KA, Henley JM. 2010. Mechanisms, regulation and

conse-quences of protein SUMOylation. Biochem J 428:133–145. https:// doi.org/10.1042/BJ20100158.

21. Lallemand-Breitenbach V, Jeanne M, Benhenda S, Nasr R, Lei M, Peres L, Zhou J, Zhu J, Raught B, de The H. 2008. Arsenic degrades PML or PML-RARalpha through a SUMO-triggered RNF4/ubiquitin-mediated pathway. Nat Cell Biol 10:547–555. https://doi.org/10.1038/ncb1717. 22. Wimmer P, Schreiner S, Dobner T. 2012. Human pathogens and the host

cell SUMOylation system. J Virol 86:642– 654. https://doi.org/10.1128/ JVI.06227-11.

23. Boutell C, Cuchet-Lourenco D, Vanni E, Orr A, Glass M, McFarlane S, Everett RD. 2011. A viral ubiquitin ligase has substrate preferential SUMO targeted ubiquitin ligase activity that counteracts intrinsic antiviral de-f e n c e . P L o S P a t h o g 7 : e 1 0 0 2 2 4 5 . h t t p s : / / d o i . o r g / 1 0 . 1 3 7 1 / journal.ppat.1002245.

24. Everett RD, Freemont P, Saitoh H, Dasso M, Orr A, Kathoria M, Parkinson J. 1998. The disruption of ND10 during herpes simplex virus infection correlates with the Vmw110- and proteasome-dependent loss of several PML isoforms. J Virol 72:6581– 6591.

25. Kelly C, van DR, Wilkinson GW. 1995. Disruption of PML-associated nuclear bodies during human cytomegalovirus infection. J Gen Virol 76:2887–2893. https://doi.org/10.1099/0022-1317-76-11-2887. 26. Korioth F, Maul GG, Plachter B, Stamminger T, Frey J. 1996. The nuclear

domain 10 (ND10) is disrupted by the human cytomegalovirus gene product IE1. Exp Cell Res 229:155–158. https://doi.org/10.1006/ excr.1996.0353.

27. Ahn JH, Hayward GS. 1997. The major immediate-early proteins IE1 and IE2 of human cytomegalovirus colocalize with and disrupt PML-associated nuclear bodies at very early times in infected permissive cells. J Virol 71:4599 – 4613.

28. Muller S, Dejean A. 1999. Viral immediate-early proteins abrogate the modiﬁcation by SUMO-1 of PML and Sp100 proteins, correlating with nuclear body disruption. J Virol 73:5137–5143.

29. Lee HR, Kim DJ, Lee JM, Choi CY, Ahn BY, Hayward GS, Ahn JH. 2004. Ability of the human cytomegalovirus IE1 protein to modulate sumoy-lation of PML correlates with its functional activities in transcriptional regulation and infectivity in cultured ﬁbroblast cells. J Virol 78: 6527– 6542. https://doi.org/10.1128/JVI.78.12.6527-6542.2004.

30. Scherer M, Klingl S, Sevvana M, Otto V, Schilling EM, Stump JD, Muller R, Reuter N, Sticht H, Muller YA, Stamminger T. 2014. Crystal structure of cytomegalovirus IE1 protein reveals targeting of TRIM family member PML via coiled-coil interactions. PLoS Pathog 10:e1004512. https:// doi.org/10.1371/journal.ppat.1004512.

31. Tavalai N, Papior P, Rechter S, Leis M, Stamminger T. 2006. Evidence for a role of the cellular ND10 protein PML in mediating intrinsic immunity against human cytomegalovirus infections. J Virol 80:8006 – 8018. https://doi.org/10.1128/JVI.00743-06.

32. Xu Y, Ahn JH, Cheng M, ap Rhys CM, Chiou CJ, Zong J, Matunis MJ, Hayward GS. 2001. Proteasome-independent disruption of PML onco-genic domains (PODs), but not covalent modiﬁcation by SUMO-1, is required for human cytomegalovirus immediate-early protein IE1 to inhibit PML-mediated transcriptional repression. J Virol 75:10683–10695. https://doi.org/10.1128/JVI.75.22.10683-10695.2001.

33. Spengler ML, Kurapatwinski K, Black AR, Azizkhan-Clifford J. 2002. SUMO-1 modiﬁcation of human cytomegalovirus IE1/IE72. J Virol 76: 2990 –2996. https://doi.org/10.1128/JVI.76.6.2990-2996.2002.

34. Ahn JH, Brignole EJ, III, Hayward GS. 1998. Disruption of PML subnuclear domains by the acidic IE1 protein of human cytomegalovirus is medi-ated through interaction with PML and may modulate a RING ﬁnger-dependent cryptic transactivator function of PML. Mol Cell Biol 18: 4899 – 4913. https://doi.org/10.1128/MCB.18.8.4899.

35. Lee HR, Huh YH, Kim YE, Lee K, Kim S, Ahn JH. 2007. N-terminal determinants of human cytomegalovirus IE1 protein in nuclear targeting and disrupting PML-associated subnuclear structures. Biochem Biophys Res Commun 356:499 –504. https://doi.org/10.1016/j.bbrc.2007.03.007. 36. Wilkinson GW, Kelly C, Sinclair JH, Rickards C. 1998. Disruption of

PML-associated nuclear bodies mediated by the human cytomegalovirus major immediate early gene product. J Gen Virol 79:1233–1245. https:// doi.org/10.1099/0022-1317-79-5-1233.

37. Hayhurst GP, Bryant LA, Caswell RC, Walker SM, Sinclair JH. 1995. CCAAT box-dependent activation of the TATA-less human DNA polymerase alpha promoter by the human cytomegalovirus 72-kilodalton major immediate-early protein. J Virol 69:182–188.

38. Lafemina RL, Pizzorno MC, Mosca JD, Hayward GS. 1989. Expression of the acidic nuclear immediate-early protein (IE1) of human cytomegalo-virus in stable cell lines and its preferential association with metaphase chromosomes. Virology 172:584 – 600. https://doi.org/10.1016/0042 -6822(89)90201-8.

39. Martinez FP, Tang Q. 2013. Identiﬁcation of cellular proteins that interact with human cytomegalovirus immediate-early protein 1 by protein array assay. Viruses 6:89 –105.

40. Tavalai N, Adler M, Scherer M, Riedl Y, Stamminger T. 2011. Evidence for a dual antiviral role of the major nuclear domain 10 component Sp100 during the immediate-early and late phases of the human cytomegalo-virus replication cycle. J Virol 85:9447–9458. https://doi.org/10.1128/ JVI.00870-11.

41. Tatham MH, Geoffroy MC, Shen L, Plechanovova A, Hattersley N, Jaffray EG, Palvimo JJ, Hay RT. 2008. RNF4 is a poly-SUMO-speciﬁc E3 ubiquitin ligase required for arsenic-induced PML degradation. Nat Cell Biol 10: 538 –546. https://doi.org/10.1038/ncb1716.

42. Scherer M, Otto V, Stump JD, Klingl S, Muller R, Reuter N, Muller YA, Sticht H, Stamminger T. 2016. Characterization of recombinant human cytomegaloviruses encoding IE1 mutants L174P and 1-382 reveals that viral targeting of PML bodies perturbs both intrinsic and innate immune responses. J Virol 90:1190 –1205. https://doi.org/10.1128/JVI.01973-15. 43. Bekes M, Prudden J, Srikumar T, Raught B, Boddy MN, Salvesen GS. 2011.

The dynamics and mechanism of SUMO chain deconjugation by SUMO-speciﬁc proteases. J Biol Chem 286:10238 –10247. https://doi.org/ 10.1074/jbc.M110.205153.

44. Golebiowski F, Tatham MH, Nakamura A, Hay RT. 2010. High-stringency tandem afﬁnity puriﬁcation of proteins conjugated to ubiquitin-like moieties. Nat Protoc 5:873– 882. https://doi.org/10.1038/nprot.2010.40. 45. Werner A, Moutty MC, Moller U, Melchior F. 2009. Performing in vitro sumoylation reactions using recombinant enzymes. Methods Mol Biol 497:187–199. https://doi.org/10.1007/978-1-59745-566-4_12.

46. Meroni G, Diez-Roux G. 2005. TRIM/RBCC, a novel class of ‘single protein RING ﬁnger’ E3 ubiquitin ligases. Bioessays 27:1147–1157. https:// doi.org/10.1002/bies.20304.

47. Li Y, Wu H, Wu W, Zhuo W, Liu W, Zhang Y, Cheng M, Chen YG, Gao N, Yu H, Wang L, Li W, Yang M. 2014. Structural insights into the TRIM family of ubiquitin E3 ligases. Cell Res 24:762–765. https://doi.org/ 10.1038/cr.2014.46.

on November 7, 2019 by guest

http://jvi.asm.org/

(17)

48. Kang H, Kim ET, Lee HR, Park JJ, Go YY, Choi CY, Ahn JH. 2006. Inhibition of SUMO-independent PML oligomerization by the human cytomegalo-virus IE1 protein. J Gen Virol 87:2181–2190. https://doi.org/10.1099/ vir.0.81787-0.

49. Cuchet-Lourenco D, Boutell C, Lukashchuk V, Grant K, Sykes A, Murray J, Orr A, Everett RD. 2011. SUMO pathway dependent recruitment of cellular repressors to herpes simplex virus type 1 genomes. PLoS Pathog 7:e1002123. https://doi.org/10.1371/journal.ppat.1002123.

50. Galisson F, Mahrouche L, Courcelles M, Bonneil E, Meloche S, Chelbi-Alix MK, Thibault P. 2011. A novel proteomics approach to identify SUMO-ylated proteins and their modiﬁcation sites in human cells. Mol Cell Proteomics 10:M110.004796.

51. Vertegaal AC, Andersen JS, Ogg SC, Hay RT, Mann M, Lamond AI. 2006. Distinct and overlapping sets of SUMO-1 and SUMO-2 target proteins revealed by quantitative proteomics. Mol Cell Proteomics 5:2298 –2310. https://doi.org/10.1074/mcp.M600212-MCP200.

52. Boggio R, Colombo R, Hay RT, Draetta GF, Chiocca S. 2004. A mechanism for inhibiting the SUMO pathway. Mol Cell 16:549 –561. https://doi.org/ 10.1016/j.molcel.2004.11.007.

53. Scherer M, Reuter N, Wagenknecht N, Otto V, Sticht H, Stamminger T. 2013. Small ubiquitin-related modiﬁer (SUMO) pathway-mediated en-hancement of human cytomegalovirus replication correlates with a recruitment of SUMO-1/3 proteins to viral replication compartments. J Gen Virol 94:1373–1384. https://doi.org/10.1099/vir.0.051078-0. 54. Gack MU, Albrecht RA, Urano T, Inn KS, Huang IC, Carnero E, Farzan M,

Inoue S, Jung JU, Garcia-Sastre A. 2009. Inﬂuenza A virus NS1 targets the ubiquitin ligase TRIM25 to evade recognition by the host viral RNA sensor RIG-I. Cell Host Microbe 5:439 – 449. https://doi.org/10.1016/ j.chom.2009.04.006.

55. Ou HD, Kwiatkowski W, Deerinck TJ, Noske A, Blain KY, Land HS, Soria C, Powers CJ, May AP, Shu X, Tsien RY, Fitzpatrick JA, Long JA, Ellisman MH,

Choe S, O’Shea CC. 2012. A structural basis for the assembly and functions of a viral polymer that inactivates multiple tumor suppressors. Cell 151:304 –319. https://doi.org/10.1016/j.cell.2012.08.035.

56. Cuchet D, Sykes A, Nicolas A, Orr A, Murray J, Sirma H, Heeren J, Bartelt A, Everett RD. 2011. PML isoforms I and II participate in PML-dependent restriction of HSV-1 replication. J Cell Sci 124:280 –291. https://doi.org/ 10.1242/jcs.075390.

57. Hofmann H, Floss S, Stamminger T. 2000. Covalent modiﬁcation of the transactivator protein IE2-p86 of human cytomegalovirus by conjuga-tion to the ubiquitin-homologous proteins SUMO-1 and hSMT3b. J Virol 74:2510 –2524. https://doi.org/10.1128/JVI.74.6.2510-2524.2000. 58. Hofmann H, Sindre H, Stamminger T. 2002. Functional interaction

be-tween the pp71 protein of human cytomegalovirus and the PML-interacting protein human Daxx. J Virol 76:5769 –5783.