• No results found

Analysis of Murine Hepatitis Virus Strain A59 Temperature-Sensitive Mutant TS-LA6 Suggests that nsp10 Plays a Critical Role in Polyprotein Processing

N/A
N/A
Protected

Academic year: 2019

Share "Analysis of Murine Hepatitis Virus Strain A59 Temperature-Sensitive Mutant TS-LA6 Suggests that nsp10 Plays a Critical Role in Polyprotein Processing"

Copied!
13
0
0

Loading.... (view fulltext now)

Full text

(1)

0022-538X/07/$08.00⫹0 doi:10.1128/JVI.00049-07

Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Analysis of Murine Hepatitis Virus Strain A59 Temperature-Sensitive

Mutant TS-LA6 Suggests that nsp10 Plays a Critical Role in

Polyprotein Processing

Eric F. Donaldson,

1

Rachel L. Graham,

4,5

Amy C. Sims,

2

Mark R. Denison,

3,4,5

and Ralph S. Baric

1,2

*

Department of Microbiology and Immunology, School of Medicine,1and Department of Epidemiology, School of Public Health,2

University of North Carolina, Chapel Hill, North Carolina, and Departments of Pediatrics3and Microbiology and Immunology,4

and The Elizabeth B. Lamb Center for Pediatric Research,5Vanderbilt University Medical Center, Nashville, Tennessee

Received 8 January 2007/Accepted 5 April 2007

Coronaviruses are the largest RNA viruses, and their genomes encode replication machinery capable of efficient replication of both positive- and negative-strand viral RNAs as well as enzymes capable of processing large viral polyproteins into putative replication intermediates and mature proteins. A model described recently by Sawicki et al. (S. G. Sawicki, D. L. Sawicki, D. Younker, Y. Meyer, V. Thiel, H. Stokes, and S. G. Siddell, PLoS Pathog. 1:e39, 2005), based upon complementation studies of known temperature-sensitive (TS) mutants of murine hepatitis virus (MHV) strain A59, proposes that an intermediate comprised of nsp4 to nsp10/11 (150 kDa) is involved in negative-strand synthesis. Furthermore, the mature forms of nsp4 to nsp10 are thought to serve as cofactors with other replicase proteins to assemble a larger replication complex specifically formed to transcribe positive-strand RNAs. In this study, we introduced a single-amino-acid change (nsp10:Q65E) associated with the TS-LA6 phenotype into nsp10 of the infectious clone of MHV. Growth kinetic studies demonstrated that this mutation was sufficient to generate the TS phenotype at permissive and nonpermissive temperatures. Our results demonstrate that the TS mutant variant of nsp10 inhibits the main protease, 3CLpro, blocking its function completely at the nonpermissive temperature. These results implicate nsp10 as being a critical factor in the activation of 3CLpro function. We discuss how these findings challenge the current hypothesis that nsp4 to nsp10/11 functions as a single cistron in negative-strand RNA synthesis and analyze recent complementation data in light of these new findings.

Coronaviruses (CoVs) are large single-stranded positive-sense RNA viruses of the orderNidovirales, family Coronaviri-dae, genus Coronavirus (16, 30, 34). They comprise viruses known to cause severe disease in humans, such as severe acute respiratory syndrome CoV (SARS-CoV), which causes an atypical pneumonia with a⬃10% mortality rate (52). In addi-tion, newly discovered human CoV strain NL63 (HCoV-NL63) (57) and HCoV-HKU-1 (31) are associated with lower respi-ratory tract infections, while HCoV-OC43 and HCoV-229E are typically associated with milder infections similar to the common cold (3). In addition, several CoVs are the etiological agents responsible for diseases affecting important domestic animals including bovines (bovine CoV), swine (porcine epi-demic diarrhea virus and transmissible gastroenteritis virus), and avians (infectious bronchitis virus) (3, 12, 30, 33). Murine hepatitis virus (MHV) strain A59 (MHV-A59) has been ex-tensively studied in cell culture and in mouse models (38), and being a close relative of SARS-CoV makes it a relevant model for studying HCoVs.

Upon entry into the cytoplasm of the infected cell, the viral RNA, which is tightly associated with nucleocapsid protein (N), is uncoated and immediately translated by host ribosomes into large polyproteins (30, 33). Roughly the first two-thirds of

the CoV genome encodes the nonstructural replicase proteins in a single open reading frame (ORF) (Fig. 1A). The final one-third of the genome consists of the structural proteins spike (S), envelope (E), matrix (M), and N (Fig. 1A) as well as accessory proteins specific to different strains, which are trans-lated from a nested set of coterminal subgenomic mRNAs (30, 33).

Two polyproteins are translated from the genome, with the most abundant comprised of nsp1 to nsp10/11, known as polyprotein 1a (pp1a), while the second is a fusion protein known as pp1ab, comprised of nsp1 to nsp16 (30, 33) (Fig. 1A), which is translated only following a ribosomal frameshift that occurs with an approximate frequency of 25 to 30% (7, 8). Processing of the polyproteins occurs both co- and posttrans-lationally with two classes of viral proteinases required to cleave the polyprotein into its component proteins and inter-mediates (Fig. 1A). The first cleavage events in MHV require the papain-like proteinases (PLPs) (PLP1 and PLP2), which rapidly cleave nsp1 to nsp3 from the N terminus. nsp4 to nsp16 are processed by a second 3C-like proteinase known as 3CLpro or Main proteinase (Mpro). A precursor intermediate of 150 kDa, comprised of nsp4 to nsp10/11 (Fig. 1A), has been de-tected in pulse-chase experiments and is thought to play a role in CoV replication (24, 50), although its exact function is yet to be determined. The mature processed proteins are predicted to form the replication complex (9, 10, 15, 22, 50, 61). To date, only nsp2 has been shown to be dispensable for MHV repli-cation (21).

Studies with the 3CLpro inhibitor E64d have demonstrated * Corresponding author. Mailing address: Department of

Epidemi-ology, School of Public Health, University of North Carolina, 2107 MacGavran-Greenberg, CB#7435, Chapel Hill, NC 27599. Phone: (919) 966-3895. Fax: (919) 966-0584. E-mail: [email protected].

Published ahead of print on 11 April 2007.

7086

on November 8, 2019 by guest

http://jvi.asm.org/

(2)

that the addition of this cysteine-specific proteinase inhibitor to cells infected with MHV-A59 rapidly shuts off new viral RNA synthesis, demonstrating that the processing of pp1a/ pp1ab is required throughout the infection to sustain the RNA synthesis necessary for viral replication (27).

Coronavirus replication is currently thought to require at least four distinct phases: (i) recruitment of viral RNA from translation to sites of strand synthesis, (ii) negative-strand synthesis of full-length genomic RNA and subgenome-length transcripts, (iii) conversion from negative- to posi-tive-strand synthesis, and (iv) posiposi-tive-strand synthesis of genome- and subgenome-length transcripts (37, 46, 47, 61). The exact mechanism and proteins or intermediates required for negative- and positive-strand synthesis are currently not known (47). However, it has been shown that continued pro-cessing of the viral polyprotein is essential for continued neg-ative-strand synthesis (47, 59), suggesting that polyprotein in-termediates are required to replicate negative strands and that these are then processed into mature proteins that presumably assemble and function as the positive-strand replication com-plex (47). In contrast, the positive-strand replication comcom-plex does not appear to require additional polypeptide processing, as positive-strand synthesis continues unabated and slowly de-cays after treatment of cells with cycloheximide (CH), while negative-strand synthesis stops abruptly (47, 59).

A recent model proposes that negative-strand synthesis is facilitated by the use of a replication protein intermediate that is hypothetically processed into mature proteins that form the positive-strand replication complex at later times during infec-tion (47). This model is supported by classical complementa-tion studies conducted with temperature-sensitive (TS) mu-tants that suggest that the nsp4 to nsp10/11 intermediate, with

a molecular mass of⬃150 kDa (p150), functions as a single polyprotein or functions incisbefore processing to synthesize negative strands, as TS mutations found in nsp4, nsp5, and nsp10 did not complement each other (47). A single point mutation in nsp10, a glutamine-to-glutamate change at posi-tion 65 of this protein, was predicted to be responsible for the TS phenotype and halts negative-strand synthesis upon a shift from a permissive to a nonpermissive temperature (32°C and 39.5°C, respectively), an observation later characterized as a defect in negative-strand elongation (47, 59). These data sug-gest that the p150 intermediate plays a functional role in neg-ative-strand synthesis, that nsp10 functions in negneg-ative-strand elongation as part of the p150 intermediate, and that nsp10 in its mature form may play a role in positive-strand synthesis (47, 59).

The goal of this study was to further characterize the TS mutant of nsp10 to advance our understanding of the role of nsp10 in CoV replication. Using a genetic approach, we dem-onstrate that a single glutamine-to-glutamic acid replacement at position 65 of nsp10 confers the TS phenotype characterized by a complete block in 3CLpro cleavage of the viral polypro-tein at the nonpermissive temperature.

MATERIALS AND METHODS

[image:2.585.118.465.73.267.2]

Virus and cells.For this study, we used MHV-A59 generated from the infec-tious clone (60) (wt-icMHV) as the wild-type control, and the TS mutant was engineered into the MHV clone, which is comprised of seven fragments main-tained in plasmids amplified and assembled according to previously described protocols (60) (Fig. 1B). Briefly, plasmids were transformed into chemically competent Top10 cells (Invitrogen) by heat shock at 42°C for 2 min and then plated onto Luria-Bertani (LB) plates. Colonies were picked and grown under appropriate selection in LB broth maintained at 28.5°C for 16 to 24 h. Delayed brain tumor (DBT) cells were maintained at 37°C in minimum essential medium FIG. 1. Polyprotein processing of MHV-A59 and assembly of MHV and TS-LA6 infectious clones. (A) pp1a and pp1ab, encoded by ORF1a and ORF1ab, are processed by two virally encoded proteinases into 16 mature proteins. PLP1 and PLP2 cleave the first three nsp’s, while 3CLpro cleaves nsp4 to nsp16. The p150 intermediate is comprised of nsp4 to nsp10/11. T1, transmembrane region 1; T2, transmembrane region 2; T3, transmembrane region 3; 3CL, 3CLpro; RdRp, RNA-dependent RNA polymerase; Hel, helicase; ExoN, exoribonuclease; XendoU, endonuclease; MT, methyltransferase. Black boxes indicate structural proteins that comprise roughly one-third of the genome, and the hatched box represents the nsp that contains the mutations of interest. (B) The MHV infectious clone is divided into seven fragments, which are assembled after unique restriction sites are used to digest the cDNA from plasmids, and appropriate sticky ends allow the fragments to ligate together in the proper order and orientation. The MHV-E fragment was mutated to generate the icTS-LA6 mutant.

on November 8, 2019 by guest

http://jvi.asm.org/

(3)

supplemented with 10% Fetal Clone II (Gibco), 10% tryptose phosphate broth, and gentamicin (0.05␮g/ml)-kanamycin (0.25 ␮g/ml). Baby hamster kidney (BHK) cells exogenously expressing MHV receptor (BHK-MHVr) were main-tained at 37°C in the same media described above with the addition of geneticin (0.8 mg/ml) to select for cells expressing MHV receptor.

Generating the TS mutant TS-LA6.The mutation of interest, a glutamine-to-glutamate change at amino acid position 65 in nsp10 (51), located from positions 13359 to 13361 on the MHV-A59 genome (GenBank accession number NC_001846), was mapped to the MHV-E fragment of the molecular clone (Fig. 1B and 2B). This fragment was used to engineer the appropriate mutation into the MHV backbone. Primers that incorporated a type IIs restriction endonucle-ase (BbsI) site flanking the mutation of interest, and which introduced two nucleotide changes within the codon being targeted, were designed (Table 1). Mutated fragments were generated by PCR, cloned into the TopoXL vector (Invitrogen), grown up in competent Top10 cells, screened by restriction diges-tion, and sequenced to verify that the correct changes were incorporated. The full-length infectious clone was assembled as previously described (60), as was the mutant incorporating the mutant MHV-E fragment (Fig. 1B). The full-length cDNA construct was transcribed and transfected into 8⫻106BHK-MHVr cells,

poured onto 5⫻106

DBT cells (60), and incubated at the permissive tempera-ture of 32°C for 24 to 72 h. Flasks were examined at regular intervals for a cytopathic effect (CPE) and verified by reverse transcriptase PCR (RT-PCR) of subgenomic RNA using primers targeting the leader sequence and the 5⬘end of the N gene (Table 1). Rescued virus was plaque purified, and the nsp10 gene was amplified by RT-PCR, cloned into the TopoXL vector, and sequenced to confirm that the correct mutations were present in the recombinant virus (Fig. 2B). The sequence-verified mutant virus was designated infectious clone of TS-LA6 (icTS-LA6).

Growth kinetics and temperature shift experiments.Viral stocks of recombi-nant wt-icMHV were propagated in DBT cells grown at 37°C, while mutant icTS-LA6 was propagated in DBT cells maintained at the permissive tempera-ture of 32°C. Titers were determined by plaque titration in DBT cells maintained at the appropriate temperature. For the temperature-specific plaque assay, DBT cells were infected in duplicate with serial dilutions of wt-icMHV or icTS-LA6 in 60-mm plates with a 1-h adsorption period. Five milliliters of overlay agar (0.8% LE agar [Sigma], 10% Fetal Clone II, 40% 2⫻minimum essential medium, 1% gentamicin-kanamycin) was added to each culture, and the infections were main-tained at both 32°C and 39.5°C until plaques were observed between 24 h and 36 h. To visualize plaques, plates were stained with neutral red for 2 h at 32°C and counted.

For the growth curve analysis, cultures of DBT cells were infected at a mul-tiplicity of infection (MOI) of 1 PFU/cell in 60-mm plates with a 1-h adsorption period, followed by three washes with phosphate-buffered saline. Three millili-ters of medium was added to each culture, and the infections were maintained at 32°C. Supernatants were harvested at 2, 4, 6, 9, 12, and 16 h postinfection (p.i.), and titers determined by plaque titration in DBT cells maintained at 32°C.

The temperature shift growth curves were conducted as previously described (49), with slight modifications. Briefly, multiple 60-mm dishes of DBT cells were infected with wt-icMHV and mutant icTS-LA6 at an MOI of 5 PFU/cell and incubated at the permissive temperature of 32°C for 6 h. At 6 h, half of the cultures were shifted to the nonpermissive temperature of 39.5°C. Supernatant samples were taken from both 32°C and 39.5°C cultures at 2, 4, 6, 9, and 12 h p.i., and titers were determined by plaque titration in DBT cells maintained at 32°C.

[image:3.585.133.451.67.279.2]

RNA analysis.DBT cells were infected in triplicate with wt-icMHV or icTS-LA6 at an MOI of 1 PFU/cell and maintained at 32°C, 37°C, or 39.5°C. At 8 h p.i., cells were harvested in TRIzol reagent (Invitrogen) for isolation of total

TABLE 1. Primers used for engineering of nsp10 mutants and RT-PCR

Primer Sequence (5⬘–3⬘) Sense Purpose

icTS-LA6S GAAGACGAAGATTCTTATGGTGGTGCTTCC ⫹ Mutant icTS-LA6

icTS-LA6A GAAGACGAATCTTCATTAGTGGTTGCCTCCGGC ⫺ Mutant icTS-LA6

nsp10-WS ACAGGGTGGAGTTCCCGTTA ⫹ PCR and sequencing of nsp10

nsp10-WA CCTAAGGGCACTTGGACAAA ⫺ PCR and sequencing of nsp10

Sg-N1S AAGAGTGATTGGCGTCCGTA ⫹ RT and quantitative PCR

[image:3.585.43.547.648.725.2]

Sg-N1A AGCGCGGTTTACAGAGGAG ⫺ RT and quantitative PCR

FIG. 2. Verification of viral replication and genotype. (A) Transfected cells were harvested in TRIzol reagents, and total RNA was extracted and reverse transcribed. The cDNA was amplified by PCR with primers designed to detect leader-containing cDNAs (N gene and leader). Bands correspond in size to subgenomic mRNAs for N, M, E, and S (lane 2). (B) Mutant viruses were plaque purified, and the nsp10 region was amplified by RT-PCR and cloned into TopoXL for sequencing. The sequence read of the PCR product shows that the mutation was present in the plaque-purified virus.

on November 8, 2019 by guest

http://jvi.asm.org/

(4)

RNA and probed for viral mRNA production. For Northern blot analysis, 1␮g of total RNA from mutant icTS-LA6 and wt-icMHV at each temperature was separated by gel electrophoresis on a 1% agarose gel, transferred onto a nitro-cellulose membrane, and probed with a 300-nucleotide (nt) biotinylated RNA probe designed to detect the first⬃300 nt of mRNA-7 (N gene) using an Ambion (Austin, TX) Northern kit. Bands were detected using the Bright Star Detection (Ambion) system, and membranes were exposed to film.

Reverse transcription, RT-PCR, and real-time PCR.Viral RNA was then reverse transcribed to cDNA using SuperScript III (Invitrogen) with modifica-tions to the protocol as follows. Random hexamers (300 ng) and total RNA (5 ␮g) were incubated for 10 min at 70°C. The remaining reagents were then added according to manufacturer’s protocol, and the reaction mixture was incubated at 55°C for 1 h followed by 20 min at 70°C to deactivate the RT. For RT-PCR, a forward primer in the leader sequence and a reverse primer⬃200 nt into the N gene (Table 1) were used to generate a⬃220-bp product by PCR.

Real-time PCR was conducted using Smart Cycler II (Cepheid) with SYBR green (diluted to 0.25⫻; Cepheid) to detect subgenomic cDNA with primers (7.5 pM) optimized to detect⬃120 nt spanning from the leader sequence to the 5⬘

end of the N gene (Table 1) or genomic cDNA with primers (7.5 pM) optimized to detect⬃120 nt of ORF1a (Table 1). cDNA template concentrations from the RT reaction mixture were diluted 1:100 and normalized to concentrations of the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Omnimix beads (Cepheid) containing all reagents except SYBR green, primer, and template were used to standardize the reaction conditions. All product sizes were verified by melting curve analysis.

Immunoprecipitation analysis.DBT cells were infected at an MOI of 2 PFU/ cell for 2 h, at which time the medium was removed and replaced with medium lacking Met-Cys but containing 20␮g/ml of actinomycin D (Sigma), and incu-bated at 32°C for icTS-LA6 and TS-LA6 and 37°C for wt-icMHV for an addi-tional 2 h. At 4 h p.i., [35S]methionine-cysteine (0.08mCi/ml) was added to the

[image:4.585.90.502.71.446.2]

infections, and cells were harvested at 9 h. Radiolabeled cells were washed in 1 ml of phosphate-buffered saline and then resuspended in 1 ml of cold ST buffer (200 mM sucrose, 10 mM Tris[pH 7.4]). Next, the cells were homogenized by 40 passes through a ball-bearing homogenizer and transferred into fresh tubes. Homogenates were then spun at 6,000⫻gfor 3 min at room temperature, and the supernatant was transferred into ultracentrifuge tubes and spun at 300,000⫻ FIG. 3. Growth characteristics of TS mutant icTS-LA6. (A) A plaque assay was performed to determine if icTS-LA6 produced plaques at the permissive and nonpermissive temperatures. wt-icMHV (hatched bars) grew at the permissive and nonpermissive temperatures, while icTS-LA6 (solid bars) produced plaques only at the permissive temperature. (B) Virus growth was evaluated at the permissive temperature for wt-icMHV () and icTS-LA6 (F). wt-icMHV was delayed in growth at 32°C from 9 to 14 h but recovered by 16 h. (C and D) A temperature shift experiment was performed using double cultures of cells infected at an MOI of 1 PFU/cell with the infection initiated at 32°C. At 6 h (indicated by arrow), half of the cultures were shifted to the nonpermissive temperature, supernatants were harvested at 2, 4, 6, 9, and 12 h p.i. from both cultures, and titers were determined by plaque assay. wt-icMHV grew equally well at both temperatures (C), while icTS-LA6 shows a TS phenotype, with growth declining rapidly after a shift to the nonpermissive temperature (D).f, infections initiated and maintained at 32°C;Œ, infections initiated at 32°C and shifted to 39.5°C at 6 h p.i.

on November 8, 2019 by guest

http://jvi.asm.org/

(5)

gfor 15 min at 4°C. The supernatant was then transferred into a fresh tube (S100), and the pellet was resuspended in 1 ml of ST buffer (P100).

Lysates were boiled for 5 min in sodium dodecyl sulfate (SDS) at a final concentration of 1% and then combined with protein A-Sepharose beads and a 1:200 dilution of anti-nsp10 antibody (VU128) in no-SDS lysis buffer (1% NP-40, 150 mM sodium chloride, 0.5% sodium deoxycholate, and 50 mM Tris [pH 8.0]) supplemented with 1% SDS. After incubation at 4°C for 4 h, the beads were pelleted and washed with low-salt lysis buffer (no-SDS lysis buffer plus 150 mM NaCl), followed by high-salt lysis buffer (no-SDS lysis buffer with 1 M NaCl) and a final low-salt wash. After rinsing, 30 ml of 2⫻SDS loading buffer (8% SDS, 0.2 M Tris [pH 8.8], 4 mM EDTA, 0.1% bromophenol blue, 40% glycerol, 0.5 M dithiothreitol) was added to the pelleted beads and boiled for 5 min prior to electrophoresis of the supernatant on 4 to 12% SDS-polyacrylamide gel electro-phoresis (PAGE) gels.

Temperature shift immunoprecipitation analysis.DBT cells were infected in duplicate with mock, wt-icMHV, icTS-LA6, and TS-LA6 at an MOI of 10 PFU/cell at the permissive temperature of 32°C for 1 h, at which time the medium was removed and replaced with medium lacking Met-Cys but containing 20␮g/ml of actinomycin D and incubated at the permissive temperature for an additional 3 h. At 4 h p.i.,35S-labeled Cys-Met (0.08 mCi/ml) medium was added

to the infected cells, and half the cultures were shifted to the nonpermissive temperature of 39.5°C. Cell lysates were harvested at 8 h p.i., and the cytoplasmic fraction was processed and prepared for SDS-PAGE as described above using antibodies directed against nsp10, nsp8, nsp5, nsp12, nsp2, and MHV (VU128, VU123, SP9, VU145, VU154, and VU13, respectively).

Analysis of structure.The crystal structure coordinates of SARS-CoV nsp10 (Protein Data Bank [PDB] accession number 2FYG) (23) were used to generate a homology model of MHV nsp10 and icTS-LA6 using the program Modeler version 8.2 (17, 32), implementing the automodel class. A pairwise alignment was generated using the SARS-CoV nsp10 PDB file and the MHV homologue sequence (GenBank accession number NP_740615), and five models were gen-erated from each alignment, with the best model selected based on the lowest objective function score. Corresponding PDB files generated by this program were visualized using the molecular modeling tools MacPyMol (DeLano Scien-tific) and Chimera (39). In addition, the program Rosetta was used to generate a robust structural model of icTS-LA6, using a flexible backbone as well as relaxed rotameric states to estimate the lowest-energy putative structure (35).

RESULTS

Assembling infectious clone TS-LA6.The Q65E mutation of nsp10 predicted by sequence analysis to convey a TS pheno-type capable of growth only at the permissive temperature of 32°C (51) was engineered into the infectious clone of MHV (Fig. 1A and B). This experiment was designed to confirm that a single amino acid replacement could recapitulate the TS-LA6 phenotype as reported previously by Siddell et al. (51). The mutation was engineered into the MHV-E fragment using the No See’m approach described previously (60) and outlined above (Fig. 1B). The seven fragments of the molecular clone were ligated together with the appropriate mutant fragment, and full-length cDNAs were transcribed in vitro, transfected into BHK-MHVr cells, poured onto DBT cells, and monitored for CPE. For wt-icMHV, transfections were maintained at 37°C, while mutant icTS-LA6 was maintained at the permissive temperature of 32°C. Plates were examined at regular intervals for CPE, indicated by syncytium formation and clearing of the monolayer.

Rescue of recombinant virus bearing the TS-LA6 genotype.

wt-icMHV showed obvious CPE by 6 h posttransfection, with the cultures displaying extensive CPE and fusion by 16 h post-transfection. In contrast, icTS-LA6 was delayed in the onset of CPE, although cytopathology was clearly detectable at 24 h posttransfection. The delay in the CPE phenotype was likely associated with the maintenance of the cultures at 32°C, the permissive temperature for TS-LA6 replication. Replication

was verified by RT-PCR using primers to detect products that contain the leader sequence and a 5⬘ portion of the N gene (Fig. 2A and Table 1). icTS-LA6 was plaque purified, and stocks were grown to high titers for additional analyses. Cells infected with plaque-purified virus were harvested, and the nsp10 region was amplified by RT-PCR and sequenced to verify that the Q65E mutation was present. All five plaques selected and sequenced showed the correct mutation at posi-tion 65 of nsp10 (Fig. 2B).

wt-icMHV produced clear plaques of about 5 mm by 24 to 36 h posttransfection, while icTS-LA6 produced smaller, less distinct plaques that were harder to see in the monolayer and identical to plaques produced by infection with TS-LA6. Our next step was to verify the TS phenotype of icTS-LA6.

Characterization of the TS phenotype of icTS-LA6. First, serial dilutions of supernatant from plaque-purified virus was used to infect double cultures of DBT cells maintained at the permissive temperature of 32°C and the nonpermissive tem-perature of 39.5°C, with plaques counted at 36 h p.i. wt-icMHV produced plaques at both temperatures and reached a titer of 1⫻108PFU/ml under both conditions, while icTS-LA6

pro-duced a titer of 8⫻107PFU/ml at the permissive temperature

but produced no plaques at the nonpermissive temperature (Fig. 3A). This phenotype was the same as that of TS-LA6, which has a known reversion frequency of 1⫻10⫺8(46). Next,

DBT cells were infected at an MOI of 1 PFU/cell for 1 h, and virus growth was assayed over 16 h for both icTS-LA6 and icMHV at the permissive temperature. icTS-LA6 and wt-icMHV grew to nearly the same titers at all time points, except at 12 h, where the wild type was delayed in replication by 1 log compared to icTS-LA6 (Fig. 3B), and these results were con-sistent with those for TS-LA6.

A temperature shift assay was performed to further evaluate the TS phenotype of icTS-LA6. Dual infections with wt-icMHV and icTS-LA6 were initiated at the permissive tempera-ture of 32°C at an MOI 5 PFU/cell, and at 6 h p.i., half the cultures were shifted to the nonpermissive temperature of 39.5°C (49). wt-icMHV grew to similar titers at each time point and at both temperatures (Fig. 3C). However, after a shift to the nonpermissive temperature, growth of icTS-LA6 was in-hibited, and titers dropped 3 and 4 logs below those of cultures maintained at 32°C at the later time points (Fig. 3D). In all cases tested, icTS-LA6 behaved identically to TS-LA6 as reported previously (49). Clearly, the amino acid change identified previ-ously by Siddell et al. is sufficient for the TS phenotype noted for TS-LA6 (51).

RNA synthesis of icTS-LA6 mimics RNA synthesis of wt-icMHV at the permissive temperature. DBT cells were in-fected at an MOI of 1 PFU/cell with wt-icMHV or icTS-LA6 and maintained at 32°C, 37°C, or 39.5°C for 8 h. The superna-tant was removed, and the cells were harvested using TRIzol reagents. Total RNA (1␮g) was denatured with glyoxal and separated on 1% agarose gels. The RNA was transferred onto a nitrocellulose membrane and probed for virus mRNAs using an RNA probe designed to hybridize to the first 300 nt of the N gene found at the 5⬘ end of genomic RNA and all sub-genomic mRNAs. icTS-LA6 and wt-icMHV produced nearly identical levels of subgenomic mRNA at the permissive tem-perature (Fig. 4). We were unable to detect mRNA in cells

on November 8, 2019 by guest

http://jvi.asm.org/

(6)

infected with icTS-LA6 maintained at 37°C or 39.5°C (data not shown).

To confirm and extend the Northern blot analysis, real-time PCR analysis was used to quantify viral transcripts using prim-ers designed to amplify cDNAs from the N gene or genomic RNA. Quantitative RT-PCR analyses also demonstrated that mutant icTS-LA6 and wt-icMHV showed equivalent quantities of genomic and subgenomic mRNA at 8 h p.i. at the permissive temperature (Fig. 5B and C). Both were reduced compared to wt-icMHV infections initiated and maintained at 37°C (Fig. 5B to D). A comparison of ratios of subgenomic N-gene mRNA to genomic RNA demonstrated that mutant icTS-LA6 had equal reductions in both subgenomic and genomic mRNAs, resulting in ratios similar to those of the wild type (⬃100 to 1) (Fig. 5D) (46, 47). These results suggested that this mutation had little effect on plus- or minus-strand RNA synthesis at the permis-sive temperature. Little if any subgenomic or genomic RNA was detected by real-time PCR in DBT cells infected with icTS-LA6 maintained at the nonpermissive temperature.

Processing of nsp10 is not altered in mutant icTS-LA6 at the permissive temperature.We next examined nsp10 processing to determine if nsp10 was cleaved from the polyprotein at rates equal to those of wt-icMHV. To evaluate protein processing and expression of nsp10, DBT cells were infected with wt-icMHV, TS-LA6, or icTS-LA6, and the cultures were labeled with [35S]Cys-Met for 3 h between 7 and 9 h p.i. nsp4 to

nsp10/11 are expressed as a large precursor of 150 kDa (p150), which is subsequently processed by cisand/ortrans cleavage into the individual replicase proteins nsp4 to nsp10. A band corresponding to the p150 intermediate was detected, as were bands corresponding to processed nsp10 (Fig. 6A). TS-LA6

and icTS-LA6, grown at the permissive temperature of 32°C, processed similar levels of the p150 intermediate and nsp10, and both were reduced compared to wild-type MHV-A59 grown at 37°C (Fig. 6A). Both TS mutants processed equiva-lent structural proteins compared to those of wt-icMHV (Fig. 6B).

Mutations responsible for the TS phenotype completely block 3CLpro activity at the nonpermissive temperature.To determine levels of nsp10 processing at the permissive and nonpermissive temperatures, temperature shift immunopre-cipitation assays were designed and conducted to analyze the processing of nsp10 at 32°C and after a shift to 39.5°C. DBT cells were infected in duplicate with mock, wt-icMHV, icTS-LA6, and TS-LA6 at an MOI of 10 PFU/cell at the permissive temperature of 32°C for 1 h, after which the medium was removed and replaced with medium lacking Met-Cys but con-taining 20␮g/ml of actinomycin D and incubated at the per-missive temperature for an additional 3 h. At 4 h p.i.,35

S-labeled Cys-Met (0.08 mCi/ml) medium was added to the infected cells, and half the cultures were shifted to the non-permissive temperature of 39.5°C. Cell lysates were harvested at 8 h p.i., and the cytoplasmic fraction was probed with anti-bodies directed against nsp10 (VU128), separated on SDS-PAGE gels, and analyzed by autoradiography to detect radio-labeled viral proteins. At 32°C, nsp10 was processed as expected for infections with wt-icMHV, TS-LA6, and icTS-LA6, and the p150 intermediate was detected in all cases (Fig. 7A, lanes 2 to 4). However, at 39.5°C, there was an accumu-lation of p150 in TS-LA6 and icTS-LA6, and nsp10 processing was abrogated in both TS mutants (Fig. 7A, lanes 6 and 7). wt-icMHV continued to process nsp10 and p150 at all three temperatures, 32°C, 37°C, and 39.5°C (Fig. 7A, lanes 2, 5, and 8).

To determine if this effect was limited to nsp10, we next examined the processing of nsp8 under the same experimental conditions. Cell lysates were harvested, and the cytoplasmic fraction was probed with antibodies directed against nsp8 (VU123), separated on SDS-PAGE gels, and analyzed by au-toradiography to detect radiolabeled viral proteins. As with nsp10, in the TS mutants TS-LA6 and icTS-LA6, nsp8 was processed at the permissive temperature (Fig. 7B, lanes 3 and 4) but not at the nonpermissive temperature (Fig. 7B, lanes 6 and 7), while wt-icMHV processed nsp8 at all temperatures (Fig. 7B, lanes 2, 5, and 8). The absence of nsp8 processing again resulted in an accumulation of the p150 intermediate in the TS infections shifted to the nonpermissive temperature.

[image:6.585.91.234.67.296.2]

To determine the extent of this effect, we next examined the nsp5 (3CLpro) protein under identical conditions using anti-nsp5 antibody (SP9) (Fig. 7C). Again, we discovered that the infection with icTS-LA6 and TS-LA6 completely blocked pro-cessing of nsp5 at the nonpermissive temperature after the shift (Fig. 7C, lanes 6 and 7) but not before the shift (Fig. 7C, lanes 3 and 4). These experiments demonstrated that the TS mutation in nsp10 was sufficient to block the processing of the C-terminal nsp5 to nsp10 of pp1a. To determine if the nsp10 mutation abrogated pp1ab processing, we performed the same experiment using anti-nsp12 antibody (VU145) to analyze the processing of RNA-dependent RNA polymerase at the per-missive and nonperper-missive temperatures (Fig. 7D). Surpris-ingly, while wt-icMHV processed nsp12 at both temperatures FIG. 4. Northern blot analysis of icTS-LA6. Cultures of cells were

infected at an MOI of 1 PFU/cell, and intracellular RNA was isolated at 8 h p.i. The RNA was separated on 1% agarose gels, blotted onto a nitrocellulose membrane, and probed with an MHV N-gene-specific probe. icTS-LA6 and wt-icMHV grown at the permissive temperature of 32°C generate equivalent quantities of subgenomic RNA at 8 h p.i. Numbered bands correspond to mRNAs 1 to 7.

on November 8, 2019 by guest

http://jvi.asm.org/

(7)

(Fig. 7D, lanes 3 and 4), both TS-LA6 and icTS-LA6 did not process nsp12 at the nonpermissive temperature (Fig. 7D, lanes 6 and 7). This suggested that the TS mutation was re-sponsible for a complete block of the 3CLpro activity.

To rule out a complete block in polyprotein processing, we next precipitated nsp2 with an anti-nsp2 antibody (VU154) from the same lysates to determine if nsp2 processing by PLP1 was affected at the nonpermissive temperature (Fig. 7E). In this case, cells infected with wt-icMHV, icLA6, and TS-LA6 processed nsp2 at both the permissive and nonpermissive temperatures (Fig. 7E, lanes 3, 4, 6, and 7). These results

demonstrate that the mutation in nsp10 responsible for the TS phenotype completely blocks 3CLpro activity at the nonper-missive temperature but has no effect on processing mediated by PLPs.

[image:7.585.64.526.70.461.2]

TS mutation maps to a disordered region of nsp10, which likely plays a role in 3CLpro processing.Homology models of nsp10 were generated for wt-icMHV and icTS-LA6. The back-bone of the SARS-CoV nsp10 structure (23) was then com-pared to the homology model of MHV nsp10 using the Match-Maker tool under the structure comparison section of Chimera, resulting in a calculated root mean square distance of 0.207 Å. FIG. 5. Real-time PCR analysis of icTS-LA6. Cells were infected in triplicate with wt-icMHV, icTS-LA6, and mock at an MOI of 1 PFU/cell and maintained at the permissive temperature of 32°C and the standard temperature of 37°C. Cells were harvested in TRIzol reagent at 8 h p.i., total RNA was isolated, and 5␮g of RNA was used for reverse transcription using random hexamer primers to generate cDNA. Viral cDNAs were normalized to the housekeeping gene GAPDH. (A) Dilutions were prepared to normalize the total cDNA of all infections to approximate levels using the housekeeping gene GAPDH. All four normalized samples amplified at similar cycle threshold values indicating equivalent starting template concentrations. (B) Subgenomic mRNAs were detected using primers to the leader and the first 122 nt of the N gene. Cells infected with wt-icMHV and maintained at 37°C generated the most subgenomic mRNAs, while cells infected with wt-icMHV and icTS-LA6 and maintained at the permissive temperature were reduced by⬃2.5 logs. icTS-LA6 infections initiated and maintained at 37°C generated extremely reduced concentrations of subgenomic mRNAs. (C) Genomic mRNAs were detected using primers to 122 nt of ORF1a. Cells infected with wt-icMHV and maintained at 37°C generated the most genomic mRNAs, while cells infected with wt-icMHV and icTS-LA6 and maintained at the permissive temperature were reduced by 2 to 2.5 logs. icTS-LA6 infections initiated and maintained at 37°C generated extremely reduced concentrations of genomic RNAs. (D) Comparisons of the reductions of subgenomic and genomic mRNAs for icTS-LA6 and wt-icMHV suggest that RNA synthesis is equivalent in both viruses at the permissive temperature. Black, subgenomic; white, genomic.

on November 8, 2019 by guest

http://jvi.asm.org/

(8)

The homology models of nsp10 of icTS-LA6 and wt-icMHV were then analyzed and compared.

In general, the nsp10:Q65E mutation occurs in a loop region distal to both zinc-binding fingers (23), in a disordered region that extends to the surface (Fig. 8) (14a). The switch from Gln to Glu alters the surface charge by adding a negative charge to the surface. In addition, both Modeler and Rosetta indicate that this single amino acid change significantly alters the loop structures in the region, resulting in an extended surface area proximal to the mutation.

DISCUSSION

TS mutants have been described for a large number of pos-itive-strand RNA viruses and have provided significant insights into the molecular mechanisms governing RNA synthesis, ge-nome replication, and subgenomic transcription (11, 18, 19, 25, 26, 28, 29, 41–44, 46, 48, 49, 55). In this study, we introduced the Q65E mutation in nsp10 of MHV, which was predicted to generate a TS phenotype (51), into the molecular clone of MHV (Fig. 1) and recapitulated TS-LA6 as icTS-LA6 (Fig. 1 and 2). This confirms that this single amino acid replacement is sufficient to generate this phenotype, and our characteriza-tion experiments show that it clearly mimics the TS phenotype reported for TS-LA6 (Fig. 3) (46, 48, 49, 51, 59). The mutation was introduced by altering the codon in two positions to limit reversion to the wild type and further stabilize the mutant locus. No plaques were detected in infections initiated and maintained at the nonpermissive temperature (Fig. 3A), while icTS-LA6 grew with growth kinetics similar to those of the wild type at the permissive temperature (Fig. 3B). A temperature shift experiment confirmed that icTS-LA6 replication was sim-ilar to that of wt-icMHV at the permissive temperature, but replication declined drastically when shifted to the nonpermis-sive temperature at 6 h p.i. (Fig. 3C and D). This result was in

complete agreement with data previously reported for TS-LA6 that showed an identical phenotype (48, 49).

In addition, at the permissive temperature, icTS-LA6 be-haves similarly to the wild type in the processing of nsp10, as detected by immunoprecipitation with anti-nsp10 antibody (Fig. 6A), and in producing structural proteins, as indicated by immunoprecipitation with anti-MHV antibody (Fig. 6B). Fur-ther immunofluorescence assays conducted at 6.5 h p.i. showed that in both wt-icMHV and TS-LA6, nsp10 colocalized with N to sites of viral replication, indicating that the TS mutation in nsp10 does not result in a defect in localization (data not shown).

Analysis of RNA synthesis by real-time PCR (Fig. 5) and Northern blotting (Fig. 4) showed that icTS-LA6 does not have a specific defect in RNA synthesis, as it produces a wild-type ratio of subgenomic-to-genomic mRNAs at the permissive temperature (Fig. 5B, C, and D). Taken together, these data suggest that the TS defect exhibited by icTS-LA6 has little or no effect on RNA synthesis, subcellular localization, or nsp10 processing compared to wt-icMHV at the permissive temper-ature.

[image:8.585.137.452.70.272.2]

Complementation studies using TS mutants with mutations in several nsp’s of MHV have purported that nsp10 along with nsp4, nsp5, nsp12, nsp14, and nsp16 are essential for the as-sembly of a functional replication/transcription complex (46). Among these TS mutants, three that fall within the peptide sequence of pp1a have been identified, and these include TS-ALB6 in nsp4, TS-ALB16 in nsp5, and TS-LA6 in nsp10. Classic complementation experiments demonstrated that these mutants do not complement each other in crosses where each of the TS viruses was used to coinfect cells initiated and main-tained at the nonpermissive temperature for a single round of replication (⬃8 h) (46). By definition, mutations that do not complement each other in thecis-trans test are defined as a FIG. 6. Processing of nsp10 and the structural proteins. Immunoprecipitations were conducted to evaluate the processing of nsp10 and the structural proteins S, M, and N. Cells were infected at an MOI of 2 PFU/cell with infections initiated and maintained at the permissive temperature. (A) Anti-nsp10 antibody was used to immunoprecipitate proteins from the cytoplasmic fraction of cells. nsp10 was detected and processed at the permissive temperature, as was the p150 intermediate. (B) Anti-MHV antibody was used to detect structural proteins in wt-icMHV grown at 37°C and compared to icTS-LA6 and TS-LA6 grown at 32°C.

on November 8, 2019 by guest

http://jvi.asm.org/

(9)
[image:9.585.105.477.75.623.2]

FIG. 7. Temperature shift immunoprecipitations of icTS-LA6. Double cultures of DBT cells were infected with mock (M) (lane 1), wt-icMHV (lanes 2 and 5), icTS-LA6 (lanes 3 and 6), and TS-LA6 (lanes 4 and 7) at an MOI of 10 PFU/cell at the permissive temperature of 32°C for an hour, medium was then removed and replaced with medium lacking Met-Cys but with actinomycin D, and infections were incubated at the permissive temperature for an additional 3 h. At 4 h p.i., labeled medium was added to the infected cells, and half the cultures were maintained at the permissive temperature (P), while the other half were shifted to the nonpermissive temperature of 39.5°C (NP). Immunoprecipitations were performed on the cytoplasmic lysates using antibodies indicated above each figure. wt-icMHV infections initiated and maintained at 37°C were performed as a control (C). (A) Immunopre-cipitation analysis was performed using anti-nsp10 antibody (-nsp10). At the permissive temperature of 32°C, nsp10 is processed in wt-icMHV, icTS-LA6, and TS-LA6 (lanes 2 to 4). For infections initiated at 32°C and then shifted to the nonpermissive temperature of 39.5°C, processing of nsp10 was ablated in icTS-LA6 and TS-LA6, while p150 appeared to accumulate (lanes 6 and 7). wt-icMHV continued to efficiently process this protein at 37°C and 39.5°C (lanes 5 and 8). (B) Anti-nsp8 antibody was used to pull down viral proteins that were processed at the permissive and nonpermissive temperatures. At 32°C, nsp8 was processed in wt-icMHV, icTS-LA6, and TS-LA6 (lanes 2 to 4). For infections initiated at 32°C and then shifted to 39.5°C,

on November 8, 2019 by guest

http://jvi.asm.org/

(10)

single complementation group and are presumed to occur within a cistron (14). This principle was the basis for predicting that nsp4, nsp5, and nsp10 are part of a single cistron com-prised of nsp4 to nsp10/11 and known as complementation group I (46). A cistron comprised of nsp4 to nsp10/11 has a calculated molecular mass of ⬃150 kDa, and the hypothesis that nsp4 to nsp10/11 act as a single cistron is supported by the fact that a p150 intermediate is detected in immunoprecipitation experiments using antibody against nsp7 to nsp10 (6, 24, 50).

TS-LA6 behaves almost identically to wild-type MHV infec-tions treated with CH to inhibit protein synthesis (5, 45). In wild-type MHV-A59 replication, negative-strand synthesis stops within 30 min of the addition of CH, which implies that the virus requires an ongoing supply of proteins to form new strand replication complexes to continue negative-strand synthesis (5, 45). Positive-negative-strand synthesis continues un-til all negative strands are depleted, suggesting that the posi-tive-strand replication complex is stable and does not require the continued renewal of cofactors to function (46). Sawicki and colleagues reported previously that TS-LA6 negative-strand synthesis stops almost immediately after a shift to the

nonpermissive temperature, while positive-strand synthesis continues unabated until all negative strands are likely de-pleted. This hypothesis is drawn from two experiments, one evaluating overall RNA synthesis of several TS mutants and a second using pulse-chase experiments before and after the shift of plus and minus strands compared to infections treated with CH (46). The pulse-label experiment for TS-LA6 showed no difference in plus-strand synthesis and a rapid reduction in negative-strand synthesis (46). Those authors suggested at least two possibilities to account for TS mutants from comple-mentation group I being defective in forming competent rep-lication/transcription complexes capable of generating more negative strands: (i) the TS mutation altered the ability of p150 to function in negative-strand but not positive-strand synthesis, and (ii) the TS mutation blocked the ability of negative strands to be used as templates for positive-strand synthesis (46). Fur-ther analysis of RNA synthesis of the TS-LA6 mutant sug-gested that negative strands were not made after the shift, implying a defect in negative-strand elongation (46, 59).

Our immunoprecipitation results suggest an alternative mechanism for the TS-LA6 mode of action. Using TS-LA6 and icTS-LA6, we demonstrated that the processing of nsp5, nsp8, nsp10, and nsp12 is ablated after a shift to the nonpermissive temperature (Fig. 7A to D), which strongly implies that 3CLpro function in general is abrogated by this mutation. Furthermore, our results demonstrate that 3CLpro-mediated processing of pp1a and pp1ab is blocked by this mutation (Fig. 7A to D), while processing by PLPs is not compromised (Fig. 7E).

Blocking the processing of 3CLpro should mimic infections that were treated with E64d or CH, especially if nsp4 to nsp16 encode the labile factors that contribute to the negative-strand replicase. In fact, there is little difference in viral RNA synthesis of cells treated with CH and those infected with TS-LA6 at the nonpermissive temperature (46). While CH would reduce the quantities of proteins translated in general, ablating processing at the nonpermissive temperature, as we have demonstrated occurs with TS-LA6, would more closely mimic treatment of cells with E64d, as translation would continue, but unprocessed polypro-teins would likely accumulate (27). In our immunoprecipitation experiments for the study of nsp5, nsp8, nsp10, we show that p150 accumulates after a shift to the nonpermissive temperature (Fig. 7), consistent with this observation.

In light of these findings, we hypothesize that the TS mutation of nsp10 ablates all 3CLpro processing, similar to treatment with E64d (27), which results in a block of all viral RNA synthesis at the restrictive temperature. The noted dominant effects on neg-ative-strand synthesis reflect the sensitivity of the negneg-ative-strand replicase when new protein synthesis/processing is blocked, while

[image:10.585.45.283.70.267.2]

nsp8 was ablated in icTS-LA6 and TS-LA6, and p150 appeared to accumulate (lanes 6 and 7). wt-icMHV continued to process this protein at 37°C and 39.5°C (lanes 5 and 8). (C) Immunoprecipitation analysis conducted with anti-nsp5 antibody. At 32°C, the results show that nsp5 was processed in wt-icMHV, icTS-LA6, and TS-LA6 (lanes 2 to 4). After a shift to 39.5°C, processing of nsp5 was not seen in icTS-LA6 and TS-LA6 (lanes 6 and 7). wt-icMHV processing of nsp5 was observed at 37°C and 39.5°C (lanes 5 and 8). (D) Immunoprecipitation with anti-nsp12 antibody showed that nsp12 was processed in wt-icMHV, icTS-LA6, and TS-LA6 at the permissive temperature (lanes 2 to 4). After a shift to the nonpermissive temperature, processing of nsp12 was ablated in icTS-LA6 and TS-LA6 (lanes 6 and 7), while wt-icMHV continued to efficiently process this protein at 37°C and 39.5°C (lanes 5 and 8). (E) Anti-nsp2 antibody was used to pull down viral proteins that were processed at the permissive and nonpermissive temperatures by PLP1 and PLP2. (C) At 32°C, the results show that nsp2 is processed in wt-icMHV as well as mutants icTS-LA6 and TS-LA6. (D) For infections initiated at 32°C and then shifted to 39.5°C, the results show that the processing of nsp2 continued as observed at 32°C, with wt-icMHV showing a greater increase in processed nsp2.

FIG. 8. Location of the TS mutation on the nsp10 structure. A homology model of the MHV-A59 nsp10 protein was generated using the coordinates of the X-ray crystal structure of SARS-CoV (PDB accession number 2FYG) using the program Modeler. The mutants icTS-LA6 (nsp10:Q65E) and nsp10-E2 (nsp10:D47A,H48A) were mapped onto the structure. Both mutations occur within a predicted disordered region, proximal to zinc-binding finger 1, and are exposed to the surface.

on November 8, 2019 by guest

http://jvi.asm.org/

(11)

plus-strand replicase molecules are less sensitive. However, all RNA synthesis will eventually stop because continued protein processing is ultimately required for both.

Complementation studies showed that TS-LA6 does not complement other TS viruses with mutations in p150, including TS-ALB6 (nsp4) and TS-Alb16 (nsp5) as well as others (46). However, TS-LA6 does complement other TS mutants with changes that occur in pp1b, although the incorporation rates and complementation indices (CIs) for these crosses are sig-nificantly lower (46). For example, LA6 crossed with TS-ALB22 (mutation in nsp12) has CIs of 11 and 18 and an incorporation rate of 9% compared to the cross between TS-ALB6 and TS-ALB22, which has CIs of 694 and 108 and an incorporation rate of 41% (46). This same result was shown in other crosses between TS-LA6 and TS mutants that fall into complementation groups other than group I, specifically with mutants TS-ALB17 (nsp14) and TS-Ut145 (unknown), with CIs of 3 and 7, and 6, respectively (46). Our results are con-sistent with the inability of TS-LA6 to complement viruses with mutations in p150, as the TS mutation prevents any processing of these intermediates both incisand intrans(Fig. 9A). Con-sequently, viruses with TS mutations within nsp4 to nsp10 would lack the cognitivetransfunctional factor from TS-LA6. In contrast, it is less clear why complementation between TS-LA6 and TS mutants mapping in ORF1b was observed. The TS-LA6 mutation appears to block the processing of ORF1b, most likely incisand intrans, as temperature shift experiments demonstrated ablated processing in the presence of processed 3CLpro (Fig. 7D). These data suggest that mutant TS-LA6 (icTS-LA6) could not directly complement any other TS mu-tant with mutations that occur within the 3CLpro cleavage range (nsp4 to nsp16). The fact that low-level complementa-tion has been reported to occur in crosses between TS-LA6

and TS mutants in pp1b suggests that 3CLpro from the pp1b TS mutants can perform limited processing of ORF1b nsp’s of TS-LA6 polyproteins intransallowing the two viruses to com-plement (Fig. 9B). However, we cannot rule out the possibility that the recombination or reversion of TS viruses may be occurring during coinfection, which would confound the CI, resulting in slightly higher-than-expected indices; also, 3CLpro may function less efficiently intransto process proteins from the C-terminal region of pp1ab. We hypothesize that crosses between TS-LA6 and TS-ALB22, TS-ALB17, and TS-Ut145 are complementing via trans cleavage by the 3CLpro of the pp1b TS mutant, which cleaves the appropriate nsp of TS-LA6 to rescue RNA synthesis.

Our results also challenge the current paradigm that nsp4 to nsp11 (p150) function as a cistron, as TS-LA6 abrogates 3CLpro activity and therefore synthesizes large uncleaved polyproteins and should not be capable of complementing other TS mutants spanning nsp4 to nsp16 at the restrictive temperature. Two additional mutants within the putative cis-tron spanning nsp4 to nsp11, TS-ALB6 in nsp4 and TS-ALB16 in nsp5, do not complement TS-LA6 or each other but do robustly complement TS viruses from other complementation groups. The processing patterns of TS-ALB6 and TS-ALB16 need to be investigated in more detail to determine whether they impact global processing similarly to TS-LA6, impact se-lect processing of specific intermediates (nsp5 and nsp6), or impact individual nsp function. Our data suggest that mutants within the individual proteins nsp4 to nsp10 that do not affect processing may exist, and these mutants should be capable of complementing other TS mutants in other nsp’s (49, 53).

The fact that TS-ALB6 and TS-ALB16 do not complement within p150 but do so in other complementation groups raises the possibility that CoVs utilize differential proteolytic processing, FIG. 9. Complementation with TS-LA6 revisited. Sawicki et al. established that crosses between TS mutants within nsp4, nsp5, and nsp10 failed to complement each other as shown by thecis-transtest and biochemical complementation analysis. This was the basis for including them in complementation group I and suggests that nsp4 to nsp10 act as a single cistron. (A) The TS mutation in nsp10 effectively renders the entire pp1ab polyprotein unprocessed, and therefore, it cannot complement any other TS mutant from complementation group 1. (B) Our results suggest that TS-LA6 cannot complement any virus bearing a TS mutation in pp1ab. However, limited proteolysis may occur intransto process proteins in pp1b. Complementation between TS-LA6 and TS-ALB22 suggests that 3CLpro of TS-ALB22 cleaves nsp12 of TS-LA6 in trans to rescue virus replication. The dotted line representstranscleavage of nsp12. Hatched boxes show proteins potentially cleaved intrans.}, 3CLpro cleavage site.

on November 8, 2019 by guest

http://jvi.asm.org/

(12)

cleaving the majority of products translated from pp1a by cis

interactions while processing less frequent pp1b products intrans. Interestingly, the icTS-LA6 mutation is adjacent on the in-ferred structure of MHV nsp10 to the mutations of nsp10-E2 (Fig. 8), a mutant that demonstrated a delayed processing phenotype, resulting in replication intermediates not observed in wt-icMHV (14a). The nsp10-E2 mutation removes an as-partate and a histidine, which are replaced with alanine, while the TS mutation adds the negative charge of glutamate. Both mutants produce viral RNA in ratios equivalent to those of the wild type, map from amino acid positions 50 to 70 of nsp10, and occur in a disordered loop region proximal to zinc-binding finger 1 (23). This region is altered substantially by both mu-tations, as predicted by homology models of nsp10-E2 and icTS-LA6. In the case of nsp10-E2, substituting alanines for Asp47 and His48 directly alters hydrogen bonds, Lys43-His48, Asp47-Ala49, and Asp47-Cys46, forcing the loop to collapse inward, rearranging the surface. Replacing a glutamine with a glutamic acid at position 65, as in icTS-LA6, adds a negative charge to the surface of the protein (23) and forces the loop to extend outward, probably due to repulsion between Glu65, Asp66, and Glu60, which are in the same proximity. This allows a new hydrogen bond to form between Glu65 and His48, which likely extends the loop outward. These results suggest that the region from amino acids 50 to 70 comprises a putative inter-action site in wt-icMHV nsp10, and we predict that these mutations significantly alter the binding interface between nsp10 and another cofactor, which is required to facilitate 3CLpro activity.

Although previous reports have shown that polyprotein pro-cessing is affected by TS mutants of MHV-A59 (4), this is the first report to demonstrate that the Q65E mutation in nsp10 of TS-LA6 results in a defect in nsp5 (3CLpro) function at the nonper-missive temperature. This implicates nsp10 as being a critical factor in 3CLpro activity. In general, the regulation of 3CLpro activity in MHV is poorly understood. However, one potential mechanism is that nsp10 allosterically regulates 3CLpro by inter-acting with another nsp(s) in the p150 polyprotein to facilitate the proteinase activity by inducing a conformational change necessary for 3CLpro to function incis. Two studies have shown that nsp10 interacts with other proteins including itself, nsp1, and nsp7 (6, 36). Future experiments have been designed to determine if amino acids 50 to 70 maintain a site that is important for inter-actions with other viral cofactors.

A second possibility is that nsp10 encodes a flexible disordered region, conserved among all CoVs, which allows the polyprotein to fold into the proper orientation to facilitate the cleavage of p150 by 3CLpro. Studies conducted with yellow fever and hepa-titis A viruses have shown that the mutagenesis of amino acids distant from the polyprotein cleavage site and the active site of the viral protease can reduce proteolytic activity, probably by altering substrate conformation (13, 20). It is possible that the change to glutamate at position 65 of nsp10 of TS-LA6 is thermostable at the permissive temperature but unstable at the nonpermissive temperature, altering the conformation of the p150 intermediate or rendering it insoluble and therefore resistant to 3CLpro cleav-age. A third possibility is that the TS mutation of nsp10 alters the conformation of p150 at the nonpermissive temperature and that this prevents membrane anchoring or dimerization, both of which

may be essential for the activation of 3CLpro function (1, 2, 40, 50, 54, 56, 58).

This is the first study to demonstrate that nsp10 is critical for polyprotein processing and suggests that nsp10 plays pleiotropic roles in the CoV life cycle, as additional studies have demon-strated that nsp10 likely plays a role in viral RNA synthesis.

ACKNOWLEDGMENTS

This work was supported by research project grant AI023946 to R.S.B. from the National Institutes of Health (NIH). Data analysis of immunofluorescence assay results was performed in part through the use of the Vanderbilt University Medical Center Cell Imaging Shared Resource (supported by NIH grants CA68485, DK20593, DK58404, HD15052, DK59637, and EY08126).

We gratefully acknowledge the laboratories of Michael Buchmeier and Peter Kuhn and in particular Michael Buchmeier, Benjamin Neu-man, Jeremiah Joseph, and Kumar Saikatendu for technical discus-sions of the nsp10 structure and advice on the use of Modeler. We gratefully acknowledge the laboratory of Brian Kuhlman and espe-cially Ron Jacak for help with the installation of Rosetta and technical advice for determining the appropriate parameters to use. We thank Boyd Yount, Damon Deming, and Will McRoy for technical assistance throughout the project.

REFERENCES

1.Anand, K., G. J. Palm, J. R. Mesters, S. G. Siddell, J. Ziebuhr, and R. Hilgenfeld.2002. Structure of coronavirus main proteinase reveals combi-nation of a chymotrypsin fold with an extra alpha helical domain. EMBO J.

21:3213–3224.

2.Anand, K., J. Ziebuhr, P. Wadhwani, J. R. Mesters, and R. Hilgenfeld.2003. 2003. Coronavirus main proteinase (3CLpro) structure: basis for design of anti-SARS drugs. Science300:1763–1767.

3.Baker, S. C.2004. Coronaviruses: from common colds to severe acute res-piratory syndrome. Pediatr. Infect. Dis. J.23:1049–1050.

4.Baker, S. C., H. Gao, and R. S. Baric.1993. Altered proteolytic processing of the polymerase polyprotein in RNA (⫺) temperature sensitive mutants of murine coronavirus. Adv. Exp. Med. Biol.342:215–219.

5.Baric, R. S., and B. Yount.2000. Subgenomic negative-strand RNA function during mouse hepatitis virus infection. J. Virol.74:4039–4046.

6.Bost, A. G., R. H. Carnahan, X. T. Lu, and M. R. Denison.2000. Four proteins processed from the replicase gene polyprotein of mouse hepatitis virus colocalize in the cell periphery and adjacent to sites of virion assembly. J. Virol.74:3379–3387.

7.Bredenbeek, P. J., C. J. Pachuk, A. F. Noten, J. Charite, W. Luytjes, S. R. Weiss, and W. J. Spaan.1990. The primary structure and expression of the second open reading frame of the polymerase gene of the coronavirus MHV-A59; a highly conserved polymerase is expressed by an efficient ribosomal frameshifting mechanism. Nucleic Acids Res.18:1825–1832.

8.Brierley, I., and F. J. Dos Ramos.2006. Programmed ribosomal frameshift-ing in HIV-1 and the SARS-CoV. Virus Res.119:29–42.

9.Brockway, S. M., and M. R. Denison. 2005. Mutagenesis of the murine hepatitis virus nsp1-coding region identifies residues important for protein processing, viral RNA synthesis, and viral replication. Virology340:209–223. 10.Brockway, S. M., X. T. Lu, T. R. Peters, T. S. Dermody, and M. R. Denison.

2004. Intracellular localization and protein interactions of the gene 1 protein p28 during mouse hepatitis virus replication. J. Virol.78:11551–11562. 11.Broughan, J. H., V. B. Randolph, and J. M. Tatem.1997. Biochemical

characterizations of two temperature-sensitive and attenuated strains of res-piratory syncytial virus subgroup B. J. Virol.71:4962–4970.

12.Cavanagh, D.2005. Coronaviruses in poultry and other birds. Avian Pathol.

34:439–448.

13.Chambers, T. J., D. A. Droll, Y. Tang, Y. Liang, V. K. Ganesh, K. H. Murthy, and M. Nickells.2005. Yellow fever virus NS2B-NS3 protease: characteriza-tion of charged-to-alanine mutant and revertant viruses and analysis of polyprotein cleavage activities. J. Gen. Virol.86:1403–1413.

14.Diamond, S. E., and K. Kirkegaard.1994. Clustered charged-to-alanine mu-tagenesis of poliovirus RNA-dependent RNA polymerase yields multiple tem-perature-sensitive mutants defective in RNA synthesis. J. Virol.68:863–876. 14a.Donaldson, E. F., A. C. Sims, R. L. Graham, M. R. Denison, and R. S. Baric.

2007. Murine hepatitis virus replicase protein nsp10 is a critical regulator of viral RNA synthesis. J. Virol.81:6356–6368.

15.Enjuanes, L., F. Almazan, I. Sola, and S. Zuniga.2006. Biochemical aspects of coronavirus replication and virus-host interaction. Annu. Rev. Microbiol.

60:211–230.

16.Enjuanes, L., D. Cavanaugh, K. Holmes, M. Lai, H. Laude, P. Masters, P. Rottier, S. Siddell, W. Spaan, F. Taguchi, and P. Talbot.2000.

on November 8, 2019 by guest

http://jvi.asm.org/

(13)

dae, p. 835–859.InM. H. V. Van Regenmortel, C. M. Fauquet, D. H. L. Bishop, E. B. Carstens, M. K. Estes, S. M. Lemon, J. Maniloff, M. A. Mayo, D. J. McGeoch, C. R. Pringle, and R. B. Wickner (ed.), Virus taxonomy: classification and nomenclature of viruses. Seventh Report of the Interna-tional Committee on Taxonomy of Viruses. Academic Press, San Diego, CA. 17.Fiser, A., R. K. Do, and A. Sali.2000. Modeling of loops in protein structures.

Protein Sci.9:1753–1773.

18.Fournier, J. G., O. Robain, I. Cerutti, I. Tardivel, F. Chany-Fournier, and C. Chany.1988. Detection of vesicular stomatitis virus (VSV) RNA in the central nervous system of infected mice by in situ hybridization. Acta Neuro-pathol. (Berlin)75:554–556.

19.Gadkari, D. A., and C. R. Pringle.1980. Temperature-sensitive mutants of Chandipura virus. II. Phenotypic characteristics of the six complementation groups. J. Virol.33:107–114.

20.Gosert, R., G. Dollenmaier, and M. Weitz.1997. Identification of active-site residues in protease 3C of hepatitis A virus by site-directed mutagenesis. J. Virol.71:3062–3068.

21.Graham, R. L., A. C. Sims, S. M. Brockway, R. S. Baric, and M. R. Denison.

2005. The nsp2 replicase proteins of murine hepatitis virus and severe acute respiratory syndrome coronavirus are dispensable for viral replication. J. Vi-rol.79:13399–13411.

22.Harcourt, B. H., D. Jukneliene, A. Kanjanahaluethai, J. Bechill, K. M. Severson, C. M. Smith, P. A. Rota, and S. C. Baker.2004. Identification of severe acute respiratory syndrome coronavirus replicase products and char-acterization of papain-like protease activity. J. Virol.78:13600–13612. 23.Joseph, J. S., K. S. Saikatendu, V. Subramanian, B. W. Neuman, A. Brooun,

M. Griffith, K. Moy, M. K. Yadav, J. Velasquez, M. J. Buchmeier, R. C. Stevens, and P. Kuhn.2006. Crystal structure of nonstructural protein 10 from the severe acute respiratory syndrome coronavirus reveals a novel fold with two zinc-binding motifs. J. Virol.80:7894–7901.

24.Kanjanahaluethai, A., and S. C. Baker.2000. Identification of mouse hep-atitis virus papain-like proteinase 2 activity. J. Virol.74:7911–7921. 25.Kao, C. C., R. Quadt, R. P. Hershberger, and P. Ahlquist.1992. Brome

mosaic virus RNA replication proteins 1a and 2a form a complex in vitro. J. Virol.66:6322–6329.

26.Kennedy-Morrow, J., and J. A. Lesnaw.1984. Structural and functional characterization of the RNA-positive complementation groups, C and D, of the New Jersey serotype of vesicular stomatitis virus: assignment of the M gene to the C complementation group. Virology132:38–52.

27.Kim, J. C., R. A. Spence, P. F. Currier, X. Lu, and M. R. Denison.1995. Coronavirus protein processing and RNA synthesis is inhibited by the cys-teine proteinase inhibitor E64d. Virology208:1–8.

28.Kroner, P., D. Richards, P. Traynor, and P. Ahlquist.1989. Defined muta-tions in a small region of the brome mosaic virus 2 gene cause diverse temperature-sensitive RNA replication phenotypes. J. Virol.63:5302–5309. 29.Kroner, P. A., B. M. Young, and P. Ahlquist.1990. Analysis of the role of brome mosaic virus 1a protein domains in RNA replication, using linker insertion mutagenesis. J. Virol.64:6110–6120.

30.Lai, M. M., and D. Cavanagh.1997. The molecular biology of coronaviruses. Adv. Virus Res.48:1–100.

31.Lau, S. K., P. C. Woo, C. C. Yip, H. Tse, H. W. Tsoi, V. C. Cheng, P. Lee, B. S. Tang, C. H. Cheung, R. A. Lee, L. Y. So, Y. L. Lau, K. H. Chan, and K. Y. Yuen.2006. Coronavirus HKU1 and other coronavirus infections in Hong Kong. J. Clin. Microbiol.44:2063–2071.

32.Marti-Renom, M. A., A. C. Stuart, A. Fiser, R. Sanchez, F. Melo, and A. Sali.

2000. Comparative protein structure modeling of genes and genomes. Annu. Rev. Biophys. Biomol. Struct.29:291–325.

33.Masters, P. S.2006. The molecular biology of coronaviruses. Adv. Virus Res.

66:193–292.

34.McIntosh, K.1974. Coronaviruses: a comparative review. Curr. Top. Micro-biol. Immunol.1974:85–129.

35.Misura, K. M., D. Chivian, C. A. Rohl, D. E. Kim, and D. Baker.2006. Physically realistic homology models built with ROSETTA can be more accurate than their templates. Proc. Natl. Acad. Sci. USA103:5361–5366. 36.Ng, L. F., and D. X. Liu.2002. Membrane association and dimerization of a

cysteine-rich, 16-kilodalton polypeptide released from the C-terminal region of the coronavirus infectious bronchitis virus 1a polyprotein. J. Virol.76:

6257–6267.

37.Pasternak, A. O., W. J. Spaan, and E. J. Snijder.2006. Nidovirus transcrip-tion: how to make sense? J. Gen. Virol.87:1403–1421.

38.Perlman, S.1998. Pathogenesis of coronavirus-induced infections. Review of pathological and immunological aspects. Adv. Exp. Med. Biol.440:503–513. 39.Pettersen, E. F., T. D. Goddard, C. C. Huang, G. S. Couch, D. M. Greenblatt,

E. C. Meng, and T. E. Ferrin.2004. UCSF Chimera—a visualization system for exploratory research and analysis. J. Comput. Chem.25:1605–1612. 40.Pinon, J. D., R. R. Mayreddy, J. D. Turner, F. S. Khan, P. J. Bonilla, and

S. R. Weiss.1997. Efficient autoproteolytic processing of the MHV-A59 3C-like proteinase from the flanking hydrophobic domains requires mem-branes. Virology230:309–322.

41.Racaniello, V. R., and C. Meriam.1986. Poliovirus temperature-sensitive mutant containing a single nucleotide deletion in the 5⬘-noncoding region of the viral RNA. Virology155:498–507.

42.Sawicki, D., D. B. Barkhimer, S. G. Sawicki, C. M. Rice, and S. Schlesinger.

1990. Temperature sensitive shut-off of alphavirus minus strand RNA syn-thesis maps to a nonstructural protein, nsP4. Virology174:43–52. 43.Sawicki, D. L., and S. G. Sawicki.1994. Alphavirus positive and negative

strand RNA synthesis and the role of polyproteins in formation of viral replication complexes. Arch. Virol. Suppl.9:393–405.

44.Sawicki, D. L., and S. G. Sawicki.1993. A second nonstructural protein functions in the regulation of alphavirus negative-strand RNA synthesis. J. Virol.67:3605–3610.

45.Sawicki, S. G., and D. L. Sawicki.1986. Coronavirus minus-strand RNA synthesis and effect of cycloheximide on coronavirus RNA synthesis. J. Virol.

57:328–334.

46.Sawicki, S. G., and D. L. Sawicki.2005. Coronavirus transcription: a per-spective. Curr. Top. Microbiol. Immunol.287:31–55.

47.Sawicki, S. G., D. L. Sawicki, D. Younker, Y. Meyer, V. Thiel, H. Stokes, and S. G. Siddell.2005. Functional and genetic analysis of coronavirus replicase-transcriptase proteins. PLoS Pathog.1:e39.

48.Schaad, M. C., and R. S. Baric.1994. Genetics of mouse hepatitis virus transcription: evidence that subgenomic negative strands are functional tem-plates. J. Virol.68:8169–8179.

49.Schaad, M. C., S. A. Stohlman, J. Egbert, K. Lum, K. Fu, T. Wei, Jr., and R. S. Baric.1990. Genetics of mouse hepatitis virus transcription: identifi-cation of cistrons which may function in positive and negative strand RNA synthesis. Virology177:634–645.

50.Schiller, J. J., A. Kanjanahaluethai, and S. C. Baker.1998. Processing of the coronavirus MHV-JHM polymerase polyprotein: identification of precursors and proteolytic products spanning 400 kilodaltons of ORF1a. Virology242:

288–302.

51.Siddell, S., D. Sawicki, Y. Meyer, V. Thiel, and S. Sawicki.2001. Identifica-tion of the mutaIdentifica-tions responsible for the phenotype of three MHV RNA-negative ts mutants. Adv. Exp. Med. Biol.494:453–458.

52.Stadler, K., V. Masignani, M. Eickmann, S. Becker, S. Abrignani, H. D. Klenk, and R. Rappuoli.2003. SARS—beginning to understand a new virus. Nat. Rev. Microbiol.1:209–218.

53.Stalcup, R. P., R. S. Baric, and J. L. Leibowitz.1998. Genetic complemen-tation among three panels of mouse hepatitis virus gene 1 mutants. Virology

241:112–121.

54.Tan, J., K. H. G. Verschueren, K. Anand, J. Shen, M. Yang, Y. Xu, Z. Rao, J. Bigalke, B. Heisen, and J. R. Mesters.2005. pH-dependent conforma-tional flexibility of the SARS-CoV main proteinase (Mpro) dimer: molecular dynamics simulations and multiple X-ray structure analyses. J. Mol. Biol.

354:25–40.

55.Tarr, G. C., and A. S. Lubiniecki.1976. Chemically-induced temperature sensitive mutants of dengue virus type 2. I. Isolation and partial character-ization. Arch. Virol.50:223–235.

56.Tibble, K. W., I. Brierley, D. Cavanaugh, and T. D. Brown.1996. Charac-terization in vitro of an autocatalytic processing activity associated with the predicted 3C-like proteinase domain of the coronavirus avian infectious bronchitis virus. J. Virol.70:1923–1930.

57.van der Hoek, L., K. Pyrc, and B. Berkhout.2006. Human coronavirus NL63, a new respiratory virus. FEMS Microbiol. Rev.30:760–773.

58.Yang, H., M. Yang, Y. Ding, Y. Liu, Z. Lou, Z. Zhou, L. Sun, L. Mo, S. Ye, H. Pang, G. F. Gao, K. Anand, M. Bartlam, R. Hilgenfeld, and Z. Rao.2003. The crystal structures of severe acute respiratory syndrome virus main pro-tease and its complex with an inhibitor. Proc. Natl. Acad. Sci. USA100:

13190–13195.

59.Younker, D. R., and S. G. Sawicki.1998. Negative strand RNA synthesis by temperature-sensitive mutants of mouse hepatitis virus. Adv. Exp. Med. Biol.

440:221–226.

60.Yount, B., M. R. Denison, S. R. Weiss, and R. S. Baric.2002. Systematic assembly of a full-length infectious cDNA of mouse hepatitis virus strain A59. J. Virol.76:11065–11078.

61.Ziebuhr, J.2006. The coronavirus replicase: insights into a sophisticated enzyme machinery. Adv. Exp. Med. Biol.581:3–11.

on November 8, 2019 by guest

http://jvi.asm.org/

Figure

FIG. 1. Polyprotein processing of MHV-A59 and assembly of MHV and TS-LA6 infectious clones
TABLE 1. Primers used for engineering of nsp10 mutants and RT-PCR
FIG. 3. Growth characteristics of TS mutant icTS-LA6. (A) A plaque assay was performed to determine if icTS-LA6 produced plaques at thepermissive and nonpermissive temperatures
FIG. 4. Northern blot analysis of icTS-LA6. Cultures of cells wereinfected at an MOI of 1 PFU/cell, and intracellular RNA was isolated
+5

References

Related documents