Copyright © 2006, American Society for Microbiology. All Rights Reserved.
MicroRNA-Guided Processing Impairs
Plum Pox Virus
Replication,
but the Virus Readily Evolves To Escape This Silencing Mechanism
Carmen Simo
´n-Mateo and Juan Antonio Garcı´a*
Centro Nacional de Biotecnologı´a-CSIC, Campus Universidad Auto´noma de Madrid, 28049 Madrid, Spain
Received 13 September 2005/Accepted 6 December 2005
Since the discovery of microRNA (miRNA)-guided processing, a new type of RNA silencing, the possibility that such a mechanism could play a role in virus defense has been proposed. In this work, we have analyzed whetherPlum pox virus (PPV) chimeras bearing miRNA target sequences (miR171, miR167, and miR159), which have been reported to be functional inArabidopsis, were affected by miRNA function in three different host plants. Some of these PPV chimeras had clearly impaired infectivity compared with those carrying nonfunctional miRNA target sequences. The behaviors of PPV chimeras were similar but not identical in all the plants tested, and the deleterious effect on virus infectivity depended on the miRNA sequence cloned and on the site of insertion in the viral genome. The effect of the miRNA target sequence was drastically alleviated in transgenic plants expressing the silencing suppressor P1/HCPro. Furthermore, we show that virus chimeras readily escape RNA silencing interference through mutations within the miRNA target sequence, which mainly affected nucleotides matching the 5ⴕ-terminal region of the miRNA.
RNA silencing is a generic term to describe a number of related gene-silencing processes that in recent years have es-tablished a new paradigm for understanding eukaryotic gene regulation and revealed novel host defenses against viruses and transposons (3, 35, 37, 44).
A unifying feature of RNA silencing is the production of small RNAs that are 21 to 26 nucleotides (nt) long and that silence at the transcriptional or posttranscriptional level by virtue of sequence complementarity to their targets (12, 17, 59). So far, there have been two major effectors of RNA si-lencing described in plants and animals, small interfering RNAs (siRNAs) and microRNAs (miRNAs) (36, 55). These tiny RNAs are produced by the cleavage of double-stranded RNA precursors by Dicer, a member of the RNase III family of double-stranded RNA-specific endonucleases. In general, small RNAs associate with a ribonucleoprotein complex, serv-ing as guide sequences to cause either degradation or transla-tional arrest of cognate RNAs (52).
siRNA-mediated RNA silencing encompasses cytoplasmic mRNA degradation pathways, such as posttranscriptional gene silencing (PTGS) in plants, “quelling” in fungi, and RNA in-terference in animals, as well as chromatin-based processes. This nucleic acid-based RNA-silencing mechanism is an evo-lutionarily ancient method conserved among species from dif-ferent kingdoms that probably acts as a primitive immune system protecting the genome against the deleterious effects of invading nucleic acids (viruses and transgenes) and/or repeti-tive elements (transposons and centromeres) (18, 44). It is now generally accepted that PTGS is a major antiviral defense mechanism that is specifically induced by virus infection (3). On the other hand, viruses have evolved proteins that act as suppressors of the silencing response, underscoring the impor-tance of this defense mechanism (54).
miRNAs comprise one of the most abundant classes of gene-regulatory molecules in multicellular organisms (2, 7, 19, 27, 34). They are derived via Dicer cleavage from imperfect hair-pin-containing precursors varying in length from⬃70 to⬎300 nt that are encoded mainly in intergenic regions of plant and animal genomes. miRNAs function as negative regulators of gene expression by directing either site-specific cleavage by RNA-induced silencing complex (RISC) or translational re-pression of cognate mRNAs. In addition, although miRNAs of animals and plants appear to be evolutionarily unrelated, and some of them might be rather specific, many miRNAs are conserved across species, strongly suggesting they have impor-tant conserved roles in gene regulation.
Although the biogeneses of siRNAs and miRNAs are quite different, these two types of small RNAs are biochemically indistinguishable. Some data have demonstrated that miRNAs and siRNAs can interact identically with mRNA molecules bearing target sites of equivalent complementarity, indicating that they may be functionally interchangeable (9). In addition, some siRNAs resemble miRNAs in havingtrans-acting func-tions (41, 53). Nevertheless some other data support the emerging evidence that miRNA- and siRNA-mediated silencing path-ways are only partially overlapping (52).
In contrast with plant and insect virus infections, virus-derived siRNAs appear to be exceptional in infected vertebrate cells (4). On the other hand, some herpesviruses have been shown to produce miRNAs, but their roles are unclear (6, 42, 43). In addition, a cellular miRNA that interferes with trans-lation of the mRNAs of a primate retrovirus has recently been described (23).
Here, we have addressed the possibility that miRNA-guided processing might contribute to plant defense by interfering with viral infection in plants, as siRNA-guided silencing does. We conducted a detailed analysis of the infectivities and ge-nome stabilities in different plant hosts of a series of chimeric viruses derived from Plum pox potyvirus (PPV) (30) bearing different engineered miRNA target sites.
* Corresponding author. Mailing address: Centro Nacional de Biotec-nologı´a-CSIC, Campus Universidad Auto´noma de Madrid, 28049 Ma-drid, Spain. Phone: 34-915854535. Fax: 34-915854506. E-mail: jagarcia @cnb.uam.es.
2429
on November 8, 2019 by guest
http://jvi.asm.org/
MATERIALS AND METHODS
Construction of plasmids.The different miRNA target sequences were cre-ated by hybridizing the following complementary pairs of oligodeoxynucleotides: 171 Mlu (5⬘CGCGGATATTGGCGCGGCTCAATCAGC3⬘; 5⬘CGCGGCTGA TTGAGCCGCGCCAATATC3⬘), m171 Mlu (5⬘CGCGGATATAGGGGCCGC ACAATCAGC3⬘; 5⬘CGCGGCTGATTGTGCGGCCCCTATATC3⬘), 171 Nae (5⬘GATATAGGGGCCGCACAATCAGGTAC3⬘; 5⬘CTGATTGTGCGGCCC CTATATC3⬘), m171 Nae (5⬘GATATAGGGGCCGCACAATCAGGTAC3⬘; 5⬘CTGATTGTGCGGCCCCTATATC3⬘), r171 Mlu (5⬘CGCGGTGATTGA GCCGCGCCAATATCC3⬘; 5⬘CGCGGGATATTGGCGCGGCTCAATCAC3⬘), 167 Mlu (5⬘CGCGGTAGATCATGCTGGCAGCTTCAG3⬘; 5⬘CGCGCTGAA GCTGCCAGCATGATCTAC3⬘), m167 Mlu (5⬘CGCGGTAGACCACGCAGG GAGTTTCAG3⬘; 5⬘CGCGCTGAAACTCCCTGCGTGGTCTAC3⬘), 167 Nae (5⬘GTAGATCATGCTGGCAGCTTCAGTAC3⬘; 5⬘TGAAGCTGCCAGCAT GATCTAC3⬘), m167 Nae (5⬘GTAGACCACGCAGGGAGTTTCAGTAC3⬘; 5⬘TGAAACTCCCTGCGTGGTCTAC3⬘), 159 Nae (5⬘GTAGAGCTCCCTTCA ATCCAAAGTAC3⬘; 5⬘TTTGGATTGAAGGGAGCTCTAC3⬘), and m159 Nae (5⬘GTAGAACTGCCATCTATACAAAGTAC3⬘; 5⬘TTTGTATAGATGGCAGTT CTAC3⬘). Hybridization was carried out by incubating 1.5g of each oligo-deoxynucleotide in a buffer containing 10 mM Tris-HCl (pH 7.5), 0.1 M NaCl, and 1 mM EDTA at 90°C for 5 min and then cooling the mixture slowly to room temperature. The Nae-hybridized oligodeoxynucleotides were cloned between the NaeI and KpnI sites placed between the NIb and CP coding sequences of the pICPPV-NK vector (14). The Mlu-hybridized oligodeoxynucleotides were cloned in the MluI site of pICPPV-GFP-Mlu vector, which replaces nt 32 to 82 of the capsid protein (CP) coding sequence (13); this plasmid also contains the GFP gene cloned between the NIb and CP coding sequences (14).
Analysis of PPV infection in plants.Plants ofNicotiana clevelandii,Nicotiana benthamiana, and Arabidopsis thaliana Landsberg erecta (Ler) Columbia 0 (Col-0) and Col-0 transformed with a transgene encoding the P1/HCPro protein fromTurnip mosaic virus(TuMV) (35a) were grown in a greenhouse maintained at 16 h of light with supplementary illumination at 19 to 22°C or in a climate-controlled room at 60% relative humidity in a 14-h light (22°C) and 10-h dark (20°C) cycle.
The coating of micro-gold particles with DNA from pICPPV-derived plasmids and their bombardment with the Helios Gene Gun were performed essentially according to the procedure described by Lo´pez-Moya and Garcı´a (31). For hand inoculation, young plants were inoculated by rubbing crude extract of previously infected plants (1 g in 2 ml of 5 mM sodium phosphate, pH 7.2) onto three leaves dusted with Carborundum. For serial passages, plant extracts were prepared to infect the next plant at 21 days postinoculation.
Virus infection was assessed by symptom monitoring, by visualizing the GFP fluorescence under a Leica MZ FLIII fluorescence microscope with excitation and barrier filters of 480/40 nm and 510 nm, and by double-antibody sandwich indirect enzyme-linked immunosorbent assay using the REALISA kit (C. C. Durviz S. L.).
Immunocapture (57), followed by reverse transcription-PCR using the Titan kit (Roche) and oligodeoxynucleotides 8883 (5⬘TGGCACTGTAAAAGTTCC3⬘) and 8390 (5⬘TTGGGTTCTTGAACAAGC3⬘), was carried out to amplify cDNA fragments, including the miRNA targets, which were sequenced to verify the stability of the inserts.
RNA blot analysis.Total RNA from leaves was extracted using TRIZOL reagent (Bio-Rad Laboratories) as described previously (28). Low-molecular-weight RNA was isolated with RNA/DNA Midi kits (QIAGEN) according to the manufacturer’s instructions. Blot hybridization analysis was performed as de-scribed previously (28). Briefly, small RNA was resolved on denaturing 15% poly-acrylamide (30:0.8) gels, electroblotted to Hybond N⫹membranes (Amersham) using a transblot semidry transfer cell (Bio-Rad) for 1 h at 400 mA, and UV cross-linked. DNA oligodeoxynucleotides complementary to miRNA sequences were end labeled with [␥-32
P]ATP (3,000 Ci/mmol) using T4 polynucleotide kinase (New England Biolabs). The blots were prehybridized and hybridized using Ultrahyb (Ambion). Hybridization was performed at 20°C below their calculated dissociation temperatures. DNA oligodeoxynucleotides with the same sequences as the miRNAs were used as controls for hybridization and as size standards (data not shown). 5S RNA/tRNA bands visualized by ethidium bro-mide staining were used to monitor the loading of RNA samples.
RESULTS
Production of PPV chimeras bearing miRNA target sequences.
In order to assess the effect of the miRNA-guided degradation
pathway during the course of a plant virus infection, we con-structed PPV chimeras containing target sites of miRNAs that have been reported to regulate gene expression in plants through mRNA degradation. The question was whether PPV, a member of the potyvirus family, coding for a silencing suppressor (P1/ HCPro) that interferes with miRNA-guided RNA silencing, would be targeted to degradation through this mechanism.
Two different insertion sites in the genome of PPV, Mlu and Nae, were used to clone different miRNA targets. Mlu con-structs produce a mutated CP, since the foreign sequence was cloned into the CP gene (13). Viral infection with these types of constructs is easily monitored because the chimeric virus also expresses GFP (14). In the Nae constructs, the miRNA target sequence was cloned between the NIb replicase and CP coding sequences without affecting any viral protein (Fig. 1A) (14).
Three different miRNAs were chosen, miR171, miR167, and miR159, which target mRNAs coding for SCARECROW-like transcription factors (29), auxin response transcription factors (46), and MYB transcription factors (39), respectively (Fig. 1B). Moreover, as controls, we cloned modified versions of each miRNA target sequence carrying several scattered point mutations, which were expected to inhibit initial target recog-nition, thus preventing miRNA-guided processing. We took care to design the mutants with silent substitutions to preserve the amino acid sequence encoded by the foreign insert (Fig. 1B). The recombinant viruses were inoculated in three herbaceous host plants:N. benthamiana, N. clevelandii, and A. thaliana, by microprojectile bombardment, which is the most effective method described for PPV to infect plants (31).
Influence of the insertion of miRNA target sequences on virus infectivity.Viral infection was assessed in the
uninocu-FIG. 1. PPV chimeras bearing miRNA target sequences. (A) Sche-matic representation of full-length PPV cDNA clones used to clone the miRNA target sequences. The positions of the miRNA target sequences and the reporter GFP gene are indicated. (B) Nucleotide sequences cloned in the PPV genome. The miRNA target sequence is underlined. The dots indicate the nucleotide substitutions in the mu-tated version of each miRNA target sequence. The amino acids trans-lated from the cloned sequences are shown above them. The numbers of loci coding for each miRNA in theA. thalianagenome are shown in parentheses.
on November 8, 2019 by guest
http://jvi.asm.org/
[image:2.585.321.520.67.266.2]lated upper leaves of plants bombarded with the PPV-Mlu chimeras by monitoring GFP expression under UV light and in plants inoculated with the PPV-Nae viruses by double-anti-body sandwich indirect enzyme-linked immunosorbent assay analyses. The genomic stability of the resulting viral progeny was analyzed by sequencing a cDNA fragment bearing the foreign insert amplified from infected tissue by immunocap-ture-reverse transcription-PCR.
The results obtained with the chimeras carrying the miR171 targets are shown in Table 1. The presence of a target for miR171 in the PPV genome at position Mlu (171 Mlu chimera) did not cause a noticeable effect on viral infectivity in any of the three hosts tested. Only after serial passages were the progeny recovered from 171 Mlu-infected plants shown to ac-cumulate mutations at the miRNA target sequence, unlike mutated miR171 constructs at the same position (m171 Mlu), which maintained the inserted foreign sequence intact. In con-trast, when the miRNA target sequence was cloned in the Nae site, we observed differences between the chimeras carrying the wild-type (171 Nae) and the mutated (m171 Nae) se-quences in the first round of inoculated plants. The infectivity of 171 Nae was lower than that of m171 Nae inN. benthamiana
andA. thaliana. Furthermore, 171 Nae showed genomic
insta-bility in all the host plants tested, with mutations at the inserted sequence in the virus recovered in 50% of the infected plants. The fact that 171 Nae virus progeny that conserved the wild-type insert in the first inoculated plants accumulated mutations at the miRNA target sequence after serial passages further confirmed the genomic instability of this chimera. No second mutations were detected in any case in the progeny of the m171 Nae chimeric virus, which carries the mutated miR171 target sequence.
We then investigated the effects of the miR167 target se-quence on both the Mlu and Nae sites of the PPV genome (Table 2). Both wild-type and mutated miR167 target se-quences cloned in the Mlu site harmed virus infectivity, sug-gesting that the foreign amino acids fused to CP in the 167 Mlu and m167 Mlu chimeras had a deleterious effect on PPV
rep-lication. Nevertheless, sequencing of the virus progeny of the infected plants showed differences in genome stability between the viruses carrying wild-type and mutated miR167 targets, since most of the 167 Mlu progeny, but not that of m167 Mlu, accumulated mutations in the inserted sequence from the first round of infection. Cloning of the miR167 target sequence in the Nae site gave more conclusive results. InA. thaliana, the infectivity of the chimera bearing the wild-type target (167 Nae) was much lower than that of the chimera with the mu-tated sequence (m167 Nae). The deleterious effect of the miR167 target sequence was more obvious in the three plant species tested after the sequence analyses of the viral progeny: all 167 Nae-infected plants from the first round of inoculation contained mutations at the inserted sequence, whereas the mutated miRNA target sequence of the m167 Nae chimeras remained stable even after several serial passages.
The effect of the miR159 target sequence was assessed only in the Nae insertion site, which appeared to be more sensitive. miR159 was chosen for this analysis because it is one of the most abundant miRNAs in Arabidopsis leaves and its effect could be stronger than that of other less abundant miRNAs. Indeed, this happened to be the case in the three plant species tested. The presence of an miR159 target site in the genome of PPV clearly affected its replication efficiency, since the infec-tivity of the 159 Nae chimera was very much reduced—null in
A. thaliana—compared to the m159 Nae virus, which bears a
mutated target site (Table 3). Sequence analysis of the virus progeny corroborated this observation, since the few 159 Nae-infected plants were shown to accumulate mutations at the miRNA target sequence, whereas the foreign sequence of the m159 Nae progeny remained stable (Table 3).
Effect of PPV infection on miRNA accumulation.Soon after the description of PTGS as an antiviral defense mechanism, it was found that many plant viruses encode proteins that can suppress this type of RNA silencing at different points (48, 54). The first silencing suppressor described was the P1/HCPro product from potyviruses (1, 5, 21), and more recently, it has also been shown to interfere with miRNA-mediated regulation (8, 11, 22). Thus, expression of P1/HCPro alters miRNA
ac-TABLE 1. Infectivity of PPV chimeras bearing miR171 target sequences
Plant Virus No. of
exptsa Infectivityb
Second mutationsc
First inoculation
After passages
N. clevelandii 171 Mlu 3 10/10 0/3 2/2
m171 Mlu 2 5/5 0/2 0/2
N. benthamiana 171 Mlu 2 5/5 0/3 NDd
m171 Mlu 2 6/6 0/2 0/1
A. thalianaLer 171 Mlu 2 12/12 0/3 ND
m171 Mlu 2 12/12 0/3 ND
N. clevelandii 171 Nae 2 8/8 3/6 3/3
m171 Nae 2 6/6 0/4 0/2
N. benthamiana 171 Nae 3 5/12 2/4 ND
m171 Nae 3 9/9 0/5 0/1
A. thaliana 171 Nae 2 4/12 2/4 ND
m171 Nae 3 13/13 0/4 ND
aNumber of independent experiments carried out. bNumber of infected plants/number of inoculated plants.
cNumber of plants with virus variants exhibiting mutations in the miRNA target
sequence/number of infected plants.
[image:3.585.42.283.87.242.2]dND, not determined.
TABLE 2. Infectivity of PPV chimeras bearing miR167 target sequences
Plant Virus No. of
exptsa Infectivityb
Second mutationsc
First inoculation
After passages
N. clevelandii 167 Mlu 2 8/8 6/6 NAd
m167 Mlu 2 5/8 0/2 NDe
N. benthamiana 167 Mlu 2 5/8 3/5 ND
m167 Mlu 2 4/8 0/1 0/1
A. thalianaLer 167 Mlu 2 0/11 NA NA
m167 Mlu 2 1/11 0/1 ND
N. clevelandii 167 Nae 1 4/4 4/4 NA
m167 Nae 1 4/4 0/2 ND
N. benthamiana 167 Nae 2 6/8 6/6 NA
m167 Nae 2 7/8 0/2 0/1
A. thaliana 167 Nae 2 2/12 2/2 NA
m167 Nae 3 9/12 0/4 ND
aNumber of independent experiments carried out. bNumber of infected plants/number of inoculated plants.
cNumber of plants with virus variants exhibiting mutations in the miRNA target
sequence/number of infected plants.
dNA, not applicable. eND, not determined.
on November 8, 2019 by guest
http://jvi.asm.org/
[image:3.585.301.542.88.224.2]cumulation, prevents the cleavage of miRNA targets, and in-duces developmental defects (8, 11, 22). We investigated the steady-state levels of the three miRNAs used in this study inN.
clevelandii,N. benthamiana, andA. thaliana, either uninfected
or infected with PPV. PPV infection enhanced the levels of miR159, miR167, and miR171 in the three plant species as-sayed, suggesting that P1/HCPro of PPV also affects miRNA activity (Fig. 2). Interestingly, the accumulation levels of the miRNAs appeared to positively correlate with the strengths of the deleterious effects of their target sequences in the infection of the corresponding PPV chimeras, and those of miR159 and miR171 corresponded to the highest and lowest, respectively.
Infectivity of PPV chimeras in P1/HCPro transgenic plants.
In order to further investigate the role of the miRNA-guided
[image:4.585.41.284.88.188.2]processing in reduced infectivity of PPV chimeras bearing miRNA target sequences, we used microprojectile bombard-ment to inoculate transgenic plants expressing P1/HCPro of TuMV (35a). As mentioned above, P1/HCPro expression has been shown to cause increases in miRNA accumulation, to-gether with inhibition of its activity (8, 11, 22). We verified that the accumulation of miR159, miR167, and miR171 was in-creased in the P1/HCPro transgenic plants compared to non-transgenic plants (Fig. 2). It is remarkable that PPV infection and transgenic TuMV P1/HCPro expression appear to en-hance the accumulation of each miRNA to a different extent, and the enhancement of miR159 accumulation was greater after PPV infection and that of miR171 was greater after TuMV P1/HCPro transgenic expression (Fig. 2). The results of the inoculation of P1/HCPro transgenic plants with the PPV chimeras bearing miRNA target sequences are summarized in Table 4. In general, the infectivities of all the chimeras were higher than that of theA. thalianaLer(Tables 1 to 3) or Col-0 (data not shown) nontransgenic plants. Furthermore, sequence analyses of the viral progeny of the transgenic plants infected with the 171 Nae, 167 Mlu, and 167 Nae chimeras showed no additional mutations in the miRNA target sequence, revealing an enhanced genomic stability of these chimeras associated with the transgenic expression of P1/HCPro (Table 4). In con-trast with these results, transgenic P1/HCPro appeared not to be able to completely counteract the effect of miR159 on the 159 Nae virus, since only some of the plants inoculated with this chimera were infected, and also, mutations in its inserted miRNA target sequence were detected in the viral progeny of the 159 Nae-infected plants (Table 4). Nevertheless, the dele-terious effect of miR159 also appeared to be alleviated in the P1/HCPro transgenic plants, since we had not observed infec-tion in any of the wild-typeArabidopsisplants inoculated with the 159 Nae chimera (Table 3).
Analysis of the mutations accumulated in the miRNA target sequences cloned in the PPV-derived chimeras. Analyses of the mutations accumulated in the virus chimeras escaping from miRNA-guided processing can help us to understand the pair-ing requirements governpair-ing miRNA function. Mutations were detected only within the miRNA target sequences. Two kinds of mutations were observed, insertions and deletions (9 out of 48) (Fig. 3A), and from single to triple point mutations (39 out of 48) (Fig. 3B). In some cases, the mutated and wild-type nucleotides coexisted in the virus progeny, but the mutated sequence prevailed after further plant passages. It is
[image:4.585.300.543.98.174.2]notewor-FIG. 2. RNA blot analysis of miR171, miR167, and miR159. Low-molecular-weight RNA (25 g) from leaf tissue of wild-type N. benthamiana(N.b.),N. clevelandii(N.c.), andA. thalianaLer(Ler) or Col-0 plants and of TuMV P1/HCPro transgenicA. thaliana Col-0 (HCPro) plants, infected with PPV (⫹) or uninoculated (⫺), was blotted and probed with an end-labeled oligonucleotide that was complementary to miR159 (top). The same filter was stripped and reprobed sequentially with radiolabeled oligonucleotides that were complementary to miR167 (upper middle) and to miR171 (lower mid-dle). The miR159, miR167, and miR171 blots show autoradiographs obtained after 5, 7, and 14 days, respectively, of exposure with inten-sifying screens. The ethidium bromide-stained gel in the zone corre-sponding to tRNAs and 5S RNAs, prior to blot transfer, is shown (bottom).
TABLE 3. Infectivity of PPV chimeras bearing miR159 target sequences
Plant Virus No. of
exptsa Infectivityb
Second mutationsc
First inoculation
After passages
N. clevelandii 159 Nae 2 1/8 1/1 NAd
m159 Nae 2 6/6 0/3 NDe
N. benthamiana 159 Nae 2 1/8 1/1 NA
m159 Nae 2 6/6 0/3 0/1
A. thaliana 159 Nae 2 0/12 NA NA
m159 Nae 2 10/10 0/3 ND
aNumber of independent experiments carried out. bNumber of infected plants/number of inoculated plants.
cNumber of plants with virus variants exhibiting mutations in the miRNA target
sequence/number of infected plants.
[image:4.585.88.239.440.595.2]dNA, not applicable. eND, not determined.
TABLE 4. Infectivity of PPV chimeras bearing miRNA target sequences inA. thalianatransgenic plants expressing
P1/HCPro from TuMV
Plant Virus Infectivitya Second
mutationsb
A. thalianaP1/HCPro 171 Mlu 6/6 0/2
171 Nae 6/6 0/6
167 Mlu 5/6 0/5
167 Nae 6/6 0/6
159 Nae 2/5 2/2
a
Number of infected plants/number of inoculated plants.
b
Number of plants with virus variants exhibiting mutations in the miRNA target sequence/number of infected plants.
on November 8, 2019 by guest
http://jvi.asm.org/
thy that most of the point substitutions (41 out of 50) were clustered at the 3⬘end of the miRNA target sequence (nt 15 to 21), which pairs with the 5⬘end of the miRNA (Fig. 3B). This is especially remarkable in the cases of the miR167 and miR159 target sequences, where all identified mutations mapped to the nt 15 to 21 region (Fig. 3B).
To further investigate the relative relevances of the different residues of the miRNA target sequence, plants were infected with the PPV chimera r171 Mlu, which has the reverse se-quence of the miR171 target inserted in the Mlu site (Fig. 1). We chose this cloning site because the negative effect of miRNA function on PPV-Mlu chimeras is less drastic and allows mutations to accumulate after serial passages. In the r171 Mlu chimera, the putative target for miRNA processing is exposed not in the genomic RNA but in its complementary strand, which is produced during genome replication. PPV r171 Mlu efficiently infected N. clevelandii plants, but when virus progeny from several plants infected after two or three serial passages were analyzed, point mutations were shown to accumulate in the foreign sequence. Seven out of nine muta-tions mapped between nt 1 and 4 of the insert, which corre-spond to the 3⬘end of the miRNA target sequence present in the viral minus-strand RNA (Fig. 3B). These results strongly suggest that minus-strand replicative intermediates are acces-sible to the miRNA-guided processing machinery and confirm
that good pairing between the 5⬘-terminal region of the miRNA and its target sequence is especially relevant for activity.
DISCUSSION
When a virus enters a eukaryotic cell, it has to deal with the activation of many different host defense mechanisms. These mechanisms include the siRNA-mediated silencing first de-scribed in plants, and plant viruses are inducers, targets, and suppressors of this mechanism (54). The miRNA-mediated processing that functions as a negative regulator of mRNAs has features in common with siRNA-mediated silencing: first, miRNAs and siRNAs are chemically indistinguishable, and second, the incorporation of these small molecules into RISC-like complexes guides them to the cognate RNA for degrada-tion (52). It can therefore be easily reasoned that a viral ge-nome could also be targeted by miRNA-guided RNA silencing, either by the effects of specific miRNAs produced against a particular virus or by a fortuitous complementarity to the mul-titude of miRNAs present in the cells infected by the virus (13). The results described in this work demonstrate that miRNA-guided processing targets a plant virus bearing in its genome miRNA target sequences impairing virus infectivity as a con-sequence (Tables 1 to 3). These results agree with the recent report that a chimeric poliovirus RNA can be targeted by let-7 miRNA (16). The normal behavior of some of the PPV-de-rived chimeras bearing miRNA target sequences in a trans-genicArabidopsisline expressing the silencing suppressor P1/ HCPro protein (Table 4), which has been shown to inhibit miRNA activity (22), further supports the idea that the impaired infectivity of the chimeras is due to a functional miRNA-guided activity.
The strength of the effects of the miRNA targets cloned in PPV appears to depend not only on their own nature, but also on the position in which they are inserted in the viral genome, probably indicating either that some sites are more accessible than others to the miRNA silencing machinery or that process-ing is somehow influenced by the flankprocess-ing sequences rather than by the miRNA sequence alone. In this regard, although it has been suggested that information outside the miRNA complementary sequence could not be very important for efficient transcript cleavage (50), there are also data showing strong dependence of the effectiveness of siRNAs on the local structures of their targets (32, 38, 49). In particular, RNA folding occluding the target sequence from binding to the siRNA or miRNA has been shown to reduce processing efficiency (47, 56).
[image:5.585.57.270.75.357.2]It has been suggested that only the viral mRNA, not the genomic RNA, of influenza virus (15) and only the positive, not the negative, strand of poliovirus (16) are susceptible to the RNA-silencing machinery. On the contrary, it appears that both positive and negative strands of hepatitis C virus may be targeted by siRNAs (58). We observed that virus variants with mutations in the foreign sequence are selected in plants in-fected with a PPV chimera containing the sense miRNA se-quence in the plus-strand genomic RNA, indicating that the RNAs complementary to the viral genome synthesized during viral replication are targeted by miRNA-directed silencing. Whether these contrasting results reflect differences in the susceptibilities of replicative intermediates of different plant
FIG. 3. PPV escape variants detected in plants infected with PPV chimeras bearing miRNA target sequences. (A) Mutations affecting the length of the miRNA target sequence. The sites and lengths of the insertions are indicated. Deletions are shown as dashes. (B) Point nucleotide substitutions. The nucleotides corresponding to each miRNA target sequence are shown. Only nucleotides different from the wild-type sequence are spelled out. The region complementary to the 5⬘end of the miRNA is indicated with a box.
on November 8, 2019 by guest
http://jvi.asm.org/
and animal viruses to different RNA-silencing pathways re-quires further study.
The extent of the interference with viral infection strongly depends on the miRNA target sequence included in the PPV genome (Tables 1 to 3). The drastic effect observed for the miR159 target sequence could be due to the larger accumula-tion of miR159 that we observed in the leaves of the three plant species analyzed (Fig. 2), but it is also possible that miR159 guides the RISC complex to its target more efficiently than miR167 and miR171. On the other hand, PPV infection produces P1/HCPro, which can interfere with miRNA activity. However, the effect of the inserted miRNA target sequences on virus infectivity, which was apparent even in the TuMV P1/HCPro transgenic plants for the 159 Nae chimera, indicates that P1/HCPro activity cannot completely suppress this miRNA activity (see below); thus, different susceptibilities of the miRNAs to P1/HCPro suppression could also contribute to the differences in the ability to affect virus infection observed among the target sequences.
In general, the infectivities of the different PPV chimeras bearing miRNA target sequences are similarly affected in the three host plants tested, indicating not only the evolutionary conservation of the genes encoding the miRNAs, but also that they are functional (Tables 1 to 3). However, the effects appear to be more severe inA. thaliana. We cannot discern whether this is due to a more efficient activity of the miRNAs of this plant on the target sites cloned in the PPV-derived chimeras (which correspond to the publishedArabidopsissequence) or to a putative lower fitness of wild-type PPV inA. thalianathan
inN. clevelandiiorN. benthamiana. Moreover, although PPV
infection enhanced the miRNA levels in the three plant species assayed, the possibility exists that the most drastic effect of miRNAs on the chimeric viruses inArabidopsiscould be the result of a lower PPV HCPro activity in this host than in the other two species.
Sequence analysis of the viral progeny of plants infected with PPV chimeras bearing miRNA target sequences has shown that they can readily escape the negative pressure of miRNA activity through mutations in the inserted foreign sequence. As stated above, the viral silencing suppressor P1/HCPro could help viruses at early infection times, allowing genome replica-tion and the appearance of mutareplica-tions that improve virus fit-ness. In this regard, in P1/HCPro transgenicArabidopsisplants, no mutations were observed after infection with chimeras bearing miR171 or miR167 target sequences, supporting the idea that in these plants, inhibition of miRNA activity is stron-ger and selection of mutations is no lonstron-ger necessary. For the 159 Nae chimera, mutations appeared even in the transgenic line, again suggesting that the degradation pathway guided via miR159 is more efficient.
The precise rules governing siRNA and miRNA target rec-ognition are still poorly defined, and there are controversial data. Scrutiny of the mutations associated with escape of the PPV chimeras from the miRNA activity can give useful infor-mation about the pairing requirements for miRNA function in planta, an issue little explored so far (33). Our results provide especially reliable information about this, since the mutations are introduced in the target sequence and not in the miRNA, so the analysis is not biased by the ability of the miRNA to enter the RISC complex (51). Moreover, the target sequence
analyzed is not a viral sequence, so it has no restriction on mutation in advance. In theory, all the positions along the 21 nt of the nonviral miRNA target sequences can be mutated, but only mutations which confer an advantage for virus replication, in this case by escaping miRNA activity, would be selected. One main conclusion of our results is that mismatches at the 5⬘ end of the miRNA are not well tolerated, since 82% of the point mutations map between nt 1 and 7 of the miRNA se-quence (numbered from the 5⬘ end). So far, it has been ac-cepted that miRNAs in plants have a propensity to pair with target mRNAs with near-perfect complementarity, enabling targets for most plant miRNAs to be easily predicted. How-ever, our results and others (33, 40, 50) strongly suggest that pairing with mismatches at positions different from the 5⬘end could be well tolerated. Schwab et al. (50) mapped the mis-match-sensitive region to positions 2 to 12, but we detected mutations at positions 8 to 12 or beyond only in the miR171 target sequence (Fig. 3B), which is the target sequence that had the least effect on infectivity of the virus chimeras (Tables 1 to 3), supporting the suggestion that complementarity at the closest proximity to the 5⬘ end of the miRNA is especially relevant for its activity. On the other hand, the selection of point mutations downstream of nt 12 in the progeny of chime-ras bearing the miR171 target sequence, and of small deletions affecting sequence complementary to the 3⬘half of the miRNA in those of chimeras bearing miR171 and miR167 target se-quences (Fig. 3A), indicates that complementarity outside the 5⬘ half of the miRNA sequence also contributes to miRNA activity, although to a lesser extent. It is also remarkable that the selection of mutants containing insertions in the cloned target sequences clearly indicates that looping is not allowed in the pairing between miRNA and cognate RNA.
Our results agree with those that support a model in which the 5⬘ region of miRNAs is critical for initial target RNA binding in animals (24, 25) and plants (33, 40, 50). Interest-ingly, our data differ from those obtained recently in which animal viruses (poliovirus, hepatitis C virus, and human immu-nodeficiency virus) escape RNA interference guided by an miRNA or by synthetic siRNAs (16, 56, 58) or in a systematic analysis of the silencing effects of an siRNA on mismatched target sites (10). These studies conclude that mutations at either side of the central region are critical for target recogni-tion. This disparity in the most important regions for target recognition suggests the existence of important differences be-tween plants and animals in the miRNA- and siRNA-guided silencing machineries. These differences might account for the apparently higher specificity of plant miRNAs than those of animals (26, 50) that is reflected in the large off-target effects of many siRNAs administered to animal cells (20, 45).
What can we tell now about the possible role of the miRNA-guided silencing pathway in natural virus infections? The ex-istence of cellular miRNAs that target viral mRNAs (23) and of miRNAs produced by animal viruses (6, 42, 43) clearly demonstrates the relevance of these small RNAs for viral in-fections, at least in animals. However, it appears that the role of miRNAs is more devoted to reaching an equilibrium be-tween virus and host (persistent infection) by interfering both with host defenses and with excessive virus proliferation than to fighting to eliminate the virus. Our study shows that plant viruses can be targets for the miRNA-directed processing but
on November 8, 2019 by guest
http://jvi.asm.org/
can readily escape it by two different mechanisms, either by coding for efficient silencing suppressors that inhibit miRNA activity or by mutation of the target sequences, abolishing the pairing requirements needed for proper miRNA function. Al-though we cannot rule out the possibility that some miRNAs able to overcome the activity of viral silencing suppressors could efficiently interfere with virus replication by targeting an essential nonmutable viral RNA sequence, this appears to be rather unlikely.
ACKNOWLEDGMENTS
We are grateful to Vicky Vance for kindly providing seeds of P1/HCPro expressing the transgenicArabidopsisline. We thank Elvira Dominguez for technical assistance.
This work was supported by Grant BIO2004-02687 from the Spanish MEC and QLG2-2002-01673 and QLK2-2002-01050 from the European Union.
REFERENCES
1.Anandalakshmi, R., G. J. Pruss, X. Ge, R. Marathe, A. C. Mallory, T. H. Smith, and V. B. Vance.1998. A viral suppressor of gene silencing in plants. Proc. Natl. Acad. Sci. USA95:13079–13084.
2.Bartel, D. P.2004. MicroRNAs: genomics, biogenesis, mechanism, and func-tion. Cell116:281–297.
3.Baulcombe, D.2004. RNA silencing in plants. Nature431:356–363. 4.Bennasser, Y., S. Y. Le, M. Benkirane, and K. T. Jeang.2005. Evidence that
HIV-1 encodes an siRNA and a suppressor of RNA silencing. Immunity
22:607–619.
5.Brigneti, G., O. Voinnet, W. X. Li, L. H. Ji, S. W. Ding, and D. C. Baulcombe.
1998. Viral pathogenicity determinants are suppressors of transgene silenc-ing inNicotiana benthamiana. EMBO J.17:6739–6746.
6.Cai, X., S. Lu, Z. Zhang, C. M. Gonzalez, B. Damania, and B. R. Cullen.
2005. Kaposi’s sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells. Proc. Natl. Acad. Sci. USA102:5570– 5575.
7.Carrington, J. C., and V. Ambros.2003. Role of microRNAs in plant and animal development. Science301:336–338.
8.Chapman, E. J., A. I. Prokhnevsky, K. Gopinath, V. V. Dolja, and J. C. Carrington.2004. Viral RNA silencing suppressors inhibit the microRNA pathway at an intermediate step. Genes Dev.18:1179–1186.
9.Doench, J. G., C. P. Petersen, and P. A. Sharp.2003. siRNAs can function as miRNAs. Genes Dev.17:438–442.
10.Du, Q., H. Thonberg, J. Wang, C. Wahlestedt, and Z. Liang.2005. A sys-tematic analysis of the silencing effects of an active siRNA at all single-nucleotide mismatched target sites. Nucleic Acids Res.33:1671–1677. 11.Dunoyer, P., C. H. Lecellier, E. A. Parizotto, C. Himber, and O. Voinnet.
2004. Probing the microRNA and small interfering RNA pathways with virus-encoded suppressors of RNA silencing. Plant Cell16:1235–1250. 12.Elbashir, S. M., J. Harborth, W. Lendeckel, A. Yalcin, K. Weber, and T.
Tuschl.2001. Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature411:494–498.
13.Ferna´ndez-Ferna´ndez, M. R., J. L. Martı´nez-Torrecuadrada, J. I. Casal, and J. A. Garcı´a.1998. Development of an antigen presentation system based on plum pox potyvirus. FEBS Lett.427:229–235.
14.Ferna´ndez-Ferna´ndez, M. R., M. Mourin˜o, J. Rivera, F. Rodrı´guez, J. Plana-Dura´n, and J. A. Garcı´a.2001. Protection of rabbits against rabbit hemor-rhagic disease virus by immunization with the VP60 protein expressed in plants with a potyvirus-based vector. Virology280:283–291.
15.Ge, Q., L. Filip, A. L. Bai, T. Nguyen, H. N. Eisen, and J. Chen.2004. Inhibition of influenza virus production in virus-infected mice by RNA in-terference. Proc. Natl. Acad. Sci. USA101:8676–8681.
16.Gitlin, L., J. K. Stone, and R. Andino.2005. Poliovirus escape from RNA interference: short interfering RNA-target recognition and implications for therapeutic approaches. J. Virol.79:1027–1035.
17.Hamilton, A. J., and D. C. Baulcombe.1999. A species of small antisense RNA in posttranscriptional gene silencing in plants. Science286:950–952. 18.Hannon, G. J.2002. RNA interference. Nature418:244–251.
19.He, L., and G. J. Hannon.2004. MicroRNAs: small RNAs with a big role in gene regulation. Nat. Rev. Genet.5:522–531.
20.Jackson, A. L., and P. S. Linsley.2004. Noise amidst the silence: off-target effects of siRNAs? Trends Genet20:521–524.
21.Kasschau, K. D., and J. C. Carrington.1998. A counterdefensive strategy of plant viruses: suppression of posttranscriptional gene silencing. Cell95:461– 470.
22.Kasschau, K. D., Z. X. Xie, E. Allen, C. Llave, E. J. Chapman, K. A. Krizan, and J. C. Carrington.2003. P1/HC-Pro, a viral suppressor of RNA silencing,
interferes withArabidopsisdevelopment and miRNA function. Dev. Cell
4:205–217.
23.Lecellier, C.-H., P. Dunoyer, K. Arar, J. Lehmann-Che, S. Eyquem, C. Himber, A. Saı¨b, and O. Voinnet.2005. A cellular microRNA mediates antiviral defense in human cells. Science308:557–560.
24.Lewis, B. P., C. B. Burge, and D. P. Bartel.2005. Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets. Cell120:15–20.
25.Lewis, B. P., I. H. Shih, M. W. Jones-Rhoades, D. P. Bartel, and C. B. Burge.
2003. Prediction of mammalian microRNA targets. Cell115:787–798. 26.Lim, L. P., N. C. Lau, P. Garrett-Engele, A. Grimson, J. M. Schelter, J.
Castle, D. P. Bartel, P. S. Linsley, and J. M. Johnson.2005. Microarray analysis shows that some microRNAs downregulate large numbers of target mRNAs. Nature433:769–773.
27.Llave, C.2004. MicroRNAs: more than a role in plant development? Mol. Plant Pathol.5:361–366.
28.Llave, C., K. D. Kasschau, M. A. Rector, and J. C. Carrington.2002. En-dogenous and silencing-associated small RNAs in plants. Plant Cell.14:
1605–1619.
29.Llave, C., Z. X. Xie, K. D. Kasschau, and J. C. Carrington.2002. Cleavage ofScarecrow-likemRNA targets directed by a class ofArabidopsismiRNA. Science297:2053–2056.
30.Lo´pez-Moya, J. J., M. R. Ferna´ndez-Ferna´ndez, M. Cambra, and J. A. Garcı´a. 2000. Biotechnological aspects of plum pox virus. J. Biotechnol.
76:121–136.
31.Lo´pez-Moya, J. J., and J. A. Garcı´a.2000. Construction of a stable and highly infectious intron-containing cDNA clone of plum pox potyvirus and its use to infect plants by particle bombardment. Virus Res.68:99–107.
32.Luo, K. Q., and D. C. Chang.2004. The gene-silencing efficiency of siRNA is strongly dependent on the local structure of mRNA at the targeted region. Biochem. Biophys. Res. Commun.318:303–310.
33.Mallory, A. C., B. J. Reinhart, M. W. Jones-Rhoades, G. Tang, P. D. Zamore, M. K. Barton, and D. P. Bartel.2004. MicroRNA control ofPHABULOSA
in leaf development: importance of pairing to the microRNA 5⬘ region. EMBO J.23:3356–3364.
34.Mallory, A. C., and H. Vaucheret.2004. MicroRNAs: something important between the genes. Curr. Opin. Plant Biol.7:120–125.
35.Meister, G., and T. Tuschl.2004. Mechanisms of gene silencing by double-stranded RNA. Nature431:343–349.
35a.Mlotshwa, S., S. E. Schauer, T. H. Smith, A. C. Mallory, J. M. Herr, B. Roth, D. S. Merchant, A. Ray, L. H. Bowman, and V. B. Vance.2005. Ectopic DICER-LIKE1 expression in P1/HC-Pro Arabidopsis rescues phenotypic anomalies but not defects in microRNA and silencing pathways. Plant Cell
17:2873–2885.
36.Nakahara, K., and R. W. Carthew.2004. Expanding roles for miRNAs and siRNAs in cell regulation. Curr. Opin. Cell Biol.16:127–133.
37.Novina, C. D., and P. A. Sharp.2004. The RNAi revolution. Nature430:
161–164.
38.Overhoff, M., M. Alken, R. K. K. Far, M. Lemaitre, B. Lebleu, G. Sczakiel, and I. Robbins.2005. Local RNA target structure influences siRNA efficacy: a systematic global analysis. J. Mol. Biol.348:871–881.
39.Palatnik, J. F., E. Allen, X. L. Wu, C. Schommer, R. Schwab, J. C. Carrington, and D. Weigel.2003. Control of leaf morphogenesis by mi-croRNAs. Nature425:257–263.
40.Parizotto, E. A., P. Dunoyer, N. Rahm, C. Himber, and O. Voinnet.2004. In vivo investigation of the transcription, processing, endonucleolytic activity, and functional relevance of the spatial distribution of a plant miRNA. Genes Dev.18:2237–2242.
41.Peragine, A., M. Yoshikawa, G. Wu, H. L. Albrecht, and R. S. Poethig.2004.
SGS3andSGS2/SDE1/RDR6are required for juvenile development and the production of trans-acting siRNAs inArabidopsis. Genes Dev.18:2368–2379. 42.Pfeffer, S., A. Sewer, M. Lagos-Quintana, R. Sheridan, C. Sander, F. A. Grasser, L. F. van Dyk, C. K. Ho, S. Shuman, M. Chien, J. J. Russo, J. Ju, G. Randall, B. D. Lindenbach, C. M. Rice, V. Simon, D. D. Ho, M. Zavolan, and T. Tuschl.2005. Identification of microRNAs of the herpesvirus family. Nat. Methods2:269–276.
43.Pfeffer, S., M. Zavolan, F. A. Gra¨sser, M. C. Chien, J. J. Russo, J. Y. Ju, B. John, A. J. Enright, D. Marks, C. Sander, and T. Tuschl.2004. Identification of virus-encoded microRNAs. Science304:734–736.
44.Plasterk, R. H. A. 2002. RNA silencing: The genome’s immune system. Science296:1263–1265.
45.Qiu, S., C. M. Adema, and T. Lane.2005. A computational study of off-target effects of RNA interference. Nucleic Acids Res.33:1834–1847.
46.Rhoades, M., B. Reinhart, L. Lim, C. Burge, B. Bartel, and D. Bartel.2002. Prediction of plant microRNA targets. Cell110:513–520.
47.Robins, H., Y. Li, and R. W. Padgett.2005. Incorporating structure to predict microRNA targets. Proc. Natl. Acad. Sci. USA102:4006–4009.
48.Roth, B. M., G. J. Pruss, and V. B. Vance.2004. Plant viral suppressors of RNA silencing. Virus Res.102:97–108.
49.Schubert, S., A. Grunweller, V. A. Erdmann, and J. Kurreck.2005. Local RNA target structure influences siRNA efficacy: systematic analysis of in-tentionally designed binding regions. J. Mol. Biol.348:883–893.
on November 8, 2019 by guest
http://jvi.asm.org/
50.Schwab, R., J. F. Palatnik, M. Riester, C. Schommer, M. Schmid, and D. Weigel.2005. Specific effects of microRNAs on the plant transcriptome. Dev. Cell8:517–527.
51.Schwarz, D. S., G. Hutvagner, T. Du, Z. Xu, N. Aronin, and P. D. Zamore.
2003. Asymmetry in the assembly of the RNAi enzyme complex. Cell115:
199–208.
52.Tang, G. L.2005. siRNA and miRNA: an insight into RISCs. Trends Bio-chem. Sci.30:106–114.
53.Vazquez, F., H. Vaucheret, R. Rajagopalan, C. Lepers, V. Gasciolli, A. C. Mallory, J. L. Hilbert, D. P. Bartel, and P. Cre´te´.2004. Endogenoustrans -acting siRNAs regulate the accumulation ofArabidopsismRNAs. Mol. Cell
16:69–79.
54.Voinnet, O.2005. Induction and suppression of RNA silencing: insights from viral infections. Nat. Rev. Genet.6:206–220.
55.Voinnet, O.2002. RNA silencing: small RNAs as ubiquitous regulators of gene expression. Curr. Opin. Plant Biol.5:444–451.
56.Westerhout, E. M., M. Ooms, M. Vink, A. T. Das, and B. Berkhout.2005. HIV-1 can escape from RNA interference by evolving an alternative struc-ture in its RNA genome. Nucleic Acids Res.33:796–804.
57.Wetzel, T., T. Candresse, G. Macquaire, M. Ravelonandro, and J. Dunez.
1992. A highly sensitive immunocapture polymerase chain reaction method for plum pox potyvirus detection. J. Virol. Methods39:27–37.
58.Wilson, J. A., and C. D. Richardson.2005. Hepatitis C virus replicons escape RNA interference induced by a short interfering RNA directed against the NS5b coding region. J. Virol.79:7050–7058.
59.Zamore, P. D., T. Tuschl, P. A. Sharp, and D. P. Bartel.2000. RNAi: double-stranded RNA directs the ATP-dependent cleavage of mRNA at 21 to 23 nucleotide intervals. Cell101:25–33.