Unusual Distribution of Mutations Associated with Serial Bottleneck Passages of Human Immunodeficiency Virus Type 1

Copyright © 2000, American Society for Microbiology. All Rights Reserved.

Unusual Distribution of Mutations Associated with Serial Bottleneck

Passages of Human Immunodeficiency Virus Type 1

ELOISA YUSTE,

1

CECILIO LÓPEZ-GALÍNDEZ,

2_AND

ESTEBAN DOMINGO

1

*

Centro de Biología Molecular “Severo Ochoa,” Universidad Autónoma de Madrid, Cantoblanco,

28049 Madrid,

1

and Centro Nacional de Biología Fundamental, Instituto de

Salud Carlos III, Majadahonda, 28220 Madrid,

2

Spain

Received 8 May 2000/Accepted 18 July 2000

Repeated bottleneck passages result in fitness losses of RNA viruses. In the case of human immunodeficiency

virus type 1 (HIV-1), decreases in fitness after a limited number of plaque-to-plaque transfers in MT-4 cells

were very drastic. Here we report an analysis of entire genomic nucleotide sequences of four HIV-1 clones

derived from the same HIV-1 isolate and their low-fitness progeny following 7 to 15 plaque-to-plaque passages.

Clones accumulated 4 to 28 mutations per genome, with dominance of A

¡

G and G

¡

A transitions (57% of

all mutations) and 49% nonsynonymous replacements. One clone—but not three sibling clones—showed an

overabundance of G

¡

A transitions, evidencing the highly stochastic nature of some types of mutational bias.

The distribution of mutations along the genome was very unusual in that mutation frequencies in

gag

were

threefold higher than in

env

. Particularly striking was the complete absence of replacements in the V3 loop of

gp120, confirmed with partial nucleotide sequences of additional HIV-1 clones subjected to repeated bottleneck

passages. The analyses revealed several amino acid replacements that have not been previously recorded

among natural HIV-1 isolates and illustrate how evolution of an RNA virus genome, with regard to constant

and variable regions, can be profoundly modified by alterations in population dynamics.

Retroviruses and in particular human immunodeficiency

vi-rus type 1 (HIV-1) mutate and recombine at high rates (14, 15,

39, 55, 60, 61, 70, 74). Rapid genetic variation, together with

the short replication times of HIV-1 (8), generates complex

and highly dynamic mutant swarms termed viral quasispecies

(10, 18–22, 42, 66, 69). The mutant spectra of viral quasispecies

constitute reservoirs of phenotypically relevant variants, as

ev-idenced by the nonsyncytial-to-syncytial switch in infected

in-dividuals or the rapid selection of antibody-, cytotoxic-T-cell-,

or inhibitor-resistant mutants in viral populations in vivo (2–4,

32, 33, 36, 37, 41, 46, 47, 56, 59, 65). Although most individual

mutations in mutant swarms of RNA viruses may not be of

immediate or even long-term selective value for the virus (63),

evolution of viral quasispecies can be adaptive and may exert

an influence in viral pathogenesis (26, 34, 76; reviews in 10, 28,

29). The adaptive potential of viral quasispecies is manifested

by quantitatively important fitness variations as viruses evolve

in constant or changing environments (for recent examples and

reviews, see 10, 11, 13, 31, 48, 50–52, 75).

Large-population passages under a constant environment

tend to produce fitness gains in viral populations (10, 11, 13,

25, 51, 52). In contrast, bottleneck events—experimentally

re-alized in an extreme case by serial plaque-to-plaque transfers

of virus on cell monolayers—often lead either to average

fit-ness losses (6, 17, 24, 78) or to limitations of fitfit-ness gains (23,

51, 52). The decrease in fitness mediated by repeated

bottle-necks has been interpreted as the result of an accentuation of

Muller’s ratchet effect (45). According to this model, asexual

populations of organisms with a small population size will tend

to incorporate deleterious mutations unless compensatory

mechanisms such as recombination can restore mutation-free

genomes (45). For RNA virus quasispecies, accumulation of

deleterious mutations is expected from successive rounds of

random sampling of genomes from the mutant spectrum

(re-viewed in 10, 11).

In retroviruses, decreases in fitness as a result of serial

bot-tleneck passages were first documented with HIV-1 following

plaque-to-plaque passages on MT-4 cells (78). In this virus,

fitness losses were unexpectedly drastic when compared with

the fitness losses experienced by other RNA viruses, such

as bacteriophage

␾

6, vesicular stomatitis virus, or

foot-and-mouth disease virus (FMDV) subjected to similar passage

reg-imens (6, 17, 24). Only 4 out of 10 HIV-1 clones could produce

viable progeny after 15 plaque-to-plaque transfers, and 3 of the

4 survivors displayed important decreases in fitness (78). Very

little is known about the numbers and types of mutations which

accompany fitness decreases of RNA viruses when they are

subjected to sequential bottleneck passages. In the case of

the animal picornavirus pathogen FMDV, debilitated clones

showed some unusual genetic lesions (infrequent or absent in

populations evolved without intervening bottlenecks; 24, 25).

Such lesions included mutations that resulted in amino acid

replacements at internal sites of the viral capsid and a unique

elongation of five adenylate residues which resulted in an

in-ternal polyadenylate tract of variable length preceding the

sec-ond functional AUG initiation codon of the FMDV genome

(24, 25). No information on genetic lesions associated with

fitness losses in retroviral genomes is available. Here we report

complete HIV-1 genomic sequences of HIV-1 clones subjected

to plaque transfers that led to severe fitness losses. The results

reveal a broad spectrum of mutations associated with fitness

decrease and an unexpected distribution of mutations along

the HIV-1 genome.

MATERIALS AND METHODS

HIV-1 clones.The origin and passage history of the biological clones of HIV-1

used in the present study have been previously described (78). Briefly, virus clones were isolated by plating a natural isolate of HIV-1, termed S61, on MT-4 cells. Virus populations D1, G1, I1, and K1 are from randomly chosen, individual plaques. After the first plating, viruses from individual plaques (in the range of

* Corresponding author. Mailing address: Centro de Biología

Mo-lecular “Severo Ochoa,” Universidad Autónoma de Madrid,

Canto-blanco, 28049 Madrid, Spain. Phone: 34-91-397 8485. Fax: 34-91-397

4799. E-mail: [email protected].

9546

on November 9, 2019 by guest

http://jvi.asm.org/

102_{to 10}5_{PFU) were diluted in 300␮l of culture medium and plated on fresh}

MT-4 cells, and this process was repeated a number of times (Fig. 1). Plaques appeared 7 to 10 days after infection. Fitness of the clonal populations of HIV-1 was determined by growth-competition experiments in MT-4 cells, and popula-tions were analyzed by the heteroduplex tracking assay as previously described (78).

DNA extraction, PCR amplification, and nucleotide sequencing.DNA was

extracted using an Instagene purification matrix (Bio-Rad) according to the man-ufacturer’s instructions. To determine the consensus nucleotide sequence of the entire HIV-1 genome in individual virus clones, a collection of overlapping sets of oligonucleotide primers was used. They either have been previously described (46, 47) or were designed for the present experiments (Table 1). HIV-1 DNA was amplified using nested PCR. The first amplifications (external primers) were carried out using the GeneAmp PCR kit (Perkin-Elmer) and resulted in the copying of 1,235-, 4,253-, and 6,686-bp fragments, comprising residues 1 through 1235, 546 through 4799, and 2975 through 9661, respectively; residue numbers correspond to those of the genome of HIV-1 isolate HXB2 (35). Internal am-plifications yielded fragments of 500 to 1,500 residues, which were used for nu-cleotide sequence determination. For amplification of short regions ofgag

(positions 1337 to 1598) andenv(positions 7071 to 7333), a single PCR ampli-fication was carried out. Both external and internal ampliampli-fications involved 35 cycles with temperatures chosen according to the composition of the oligonu-cleotide primers (78). Before sequencing, the PCR mixture was digested with exonuclease I and shrimp alkaline phosphatase (Amersham Life Sciences). Nu-cleotide sequences were determined on the two cDNA strands, with an ABI 373 automatic sequencer. Multiple sequence alignments were obtained using the CLUSTAL W program (71).

The newly determined nucleotide sequences have been deposited in the EMBL sequence database with accession numbers AF256204, AF256205, AF256206, AF256207, AF256208, AF256209, AF256210, and AF256211.

RESULTS

Mutation accumulation as a result of bottleneck transfers.

HIV-1 clones underwent severe fitness losses as a result of

serial plaque-to-plaque transfers in MT-4 cells (78). To

deter-mine the types and numbers of mutations accumulated during

bottleneck transfers, the entire genomic nucleotide sequence

of four HIV-1 clones (D1, G1, I1, and K1) and their derivatives

after 15, 7, 15, and 15 plaque-to-plaque passages, respectively

(termed D15, G7, I15, and K15, respectively [Fig. 1]), were

obtained. The comparison of genomic nucleotide sequences of

[image:2.612.55.293.71.278.2]

each passaged clone relative to the corresponding initial clone

showed that transitions were 2.8-fold more frequent than

transversions and that A

¡

G and G

¡

A accounted for 20%

and 36%, respectively, of all mutation types; nonsynonymous

mutations represented 49% of the total; an insertion of one

nucleotide was present in clone I15 (Table 2). Mutation

fre-quencies varied up to sevenfold among lineages (range, 4.4

⫻

FIG. 1. Scheme of passages of HIV-1 clones subjected to plaque-to-plaque transfers in MT-4 cells. Clonal populations (HIV-1 isolated from individual plaques) are depicted as filled squares. The experimental procedures and the origins of natural HIV-1 isolate S61 and clones B1 to K1 are given in reference 78 and in Materials and Methods. HIV-1 clones are indicated by letters followed by a number which gives the total number of plaque-to-plaque transfers under-gone by the clone. Infectious virus could not be rescued from viral populations B15, E13, G7, H13, and J15 as described in reference 78.

TABLE 1. Synthetic oligonucleotide primers employed for

nucleotide sequence determination of the HIV-1 genome

a

Nucleotide sequence

GCTTCAAGTAGTGTGTGCCCGTCTG (563, S) AGAGTCACACAACAGACGGG (582, A) TGACTAAAAGGGTCTGAGGG (614, A) CTCTGGTAACTAGAGATCCC (615, S)

TCTCTAGCAGTGGCGCCCGAACAGGGAC (626, S) AGACAGGATCAGAAGAA (995, S)

GGTGATATGGCCTGATGTACCATTTGCCCCTG (1204, A) CCAGGCCAGATGAGAGAACCAAGGG (1462, S) TGTCCAGAATGCTGGTAGGG (1642, A) CTCTCAGAAGCAGGAGCCG (2205, S) GTATTTAGTAGGACCTACACCT (2475, S) TCTTCTGTCAATGGCCATTGTTTAAC (2635, A) GGATTAGATATCAGTACAATGTGCTT (2971, S) CATGGATCCGATATCTAATCCCTGG (2991, A) GCTGGTGACCTTTCCATCC (3022, A)

TAGATATCAGTACAATGTGCTTCCAC (2975, S) TATTGCTGGTGATCCTTTCC (3026, A) AAACATCAGAAAGAACCTCC (3207, S) GTTCATAACCCATCCAAAGG (3249, A)

GCGGAATCTGTATGTCATTGACAGTCCAGCT (3300, A) CATGGAGTGTATTATGACCC (3492, S)

CTTTCCCCATATTACTATGC (3704, A) AGTTTGTCAATACCCCTCCC (3793, S) AATCATTCAAGCACAACCAG (4061, S) TTAGATGGAATAGATAAGGC (4233, S)

CTTGAAGCTTATCTATTCCATCTAAAAATAGT (4257, A) GGCGAATTCACTAGCCATTGCTCTCCA (4284, A) AGTGATTTTAACC (4299, S)

GCTTCTATATATCCACTGGC (4486, A) AAGTATGCTGTTTCTTGCCC (4528, A)

AAGGGGGGATTGGGGGGTACAGTGCAGGG (4792, S) TAGCCCTTCCAGTCCCCCCTTTTCTTTTA (4799, A) CTTTCCCCTGCACTGTACCC (4825, A)

TACTAATCTAGCCTCCCCTAGTGGGATGTG (5235, A) GCCTCTGTGGCCCTTGGTCTTCTGGGG (5595, A) CAGAAAAGCTTGTCGACATAGCAGAATAGG (5576, S) TTAGGCATCTCCTATGGCAGGAAGAAGCGG (5957, S) CCCATAATAGACTGTGACCC (6347, A)

TGTGGGTTGGGGTCTGTGGG (6469, A) ATGGGATCAAAGCCTAAAGCCATGTG (6557, S) AGGATACCTTTGGACAGGCC (6852, A) TCAGCACAGTACAATGTACACATGG (6949, S) ATAAGCTTGCAGTCTAGCAGAAGAAGA (7004, S) CAATCCTCAGGAGGGGAC (7311, S)

TGCATCTCAATTTCTGGGCTCCCCTCCTGAG (7345, A) AGGAGTCCTCCCCTGGGTCTTAAGTA (7648, A) AGTGCTTCCTGCTGCTCCCAAGAACCCAAG (7811, A) TCTTGCCTGGAGCTGTTTGATGCCCCAGAC (7961, A) TTGGAATTGGATAAGTGGGC (8205, S)

GTGAATAGAGTTAGGCAGGG (8337, S)

GAAATGACAATGGTGAGTATCCCTGCC (8376, A) CGATTCCTTCGGGCCTGTCGGGTCCCC (8424, A) TGTGGAACTTCTGGGACGCAGGGGGTGGG (8567, S) CAAGGAGGAGGAGGAGGTGGGTTTTCC (8977, S) TGGAAGGGCTAATTTGGTCCCAGA (9086, S) CTGGGACCAAATTAGCCCTTCCAGTCC (9108, A)

a_{Sequences are written from 5⬘to 3⬘; data in parentheses are the position of} the 5⬘nucleotide of each primer—according to the genomic nucleotide number-ing of isolate HXB2 (35)—and primer orientation (S, sense [same orientation as genomic RNA]; A, antisense [complementary to genomic RNA]). Oligonucleo-tide primers were purchased from Isogen (Maarssen).

on November 9, 2019 by guest

http://jvi.asm.org/

[image:2.612.314.546.188.680.2]

10

⫺4

to 3.1

⫻

10

⫺3

substitutions per nucleotide [Table 2]).

There was no obvious correlation between fitness decrease and

mutation types or frequencies; for example, clone G7, which

was debilitated to the point of not allowing a reliable

determi-nation of fitness value (78), showed a mutation frequency that

was sevenfold lower than that of I15 (Table 2).

Unusual distribution of mutations.

Mutation frequencies in

env

are generally higher than in

gag

and

pol

when natural

HIV-1 isolates are compared (35, 44, 57, 58). In contrast, the

HIV-1 clones debilitated by serial plaque transfers showed

average mutation frequencies that were threefold higher for

gag

than

env

(Fig. 2). No mutations were found in

tat, vpu

, and

rev

. Most remarkable was the absence of mutations in the

regions encoding variable loops of gp120, particularly the V3

loop. The asymmetric distribution of mutations was visualized

by dividing the HIV-1 genome into three arbitrary regions of

similar length: region 1, residues 1 through 3028; region 2,

residues 3029 through 6065; and region 3, residues 6066

through 9035. Taking into account all mutations scored for

clones D15, G7, I15, and K15 (as quantitated in Table 2), we

found mutation frequencies for regions 1, 2, and 3 of 2.5

⫻

10

⫺3

, 9.0

⫻

10

⫺4

, and 6.6

⫻

10

⫺4

substitutions per nucleotide,

respectively. The results suggest that plaque-to-plaque

trans-fers of HIV-1 lead to accumulation of mutations at multiple

sites of the HIV-1 genome, following a pattern which is quite

different from that observed in the natural evolution of HIV-1

in infected hosts.

Conservation of the V3 loop.

The unusual distribution of

mutations found in D15, G7, I15, and K15 and the absence of

mutations in the region encoding the variable V3 loop of gp120

prompted us to extend nucleotide sequence determinations to

additional HIV-1 clones subjected to serial bottleneck events.

These additional analyses included two clones from each of the

lineages D15, G7, and K15, one clone from I15, and clones

from independent lineages which were previously described

(78), including three clones from F15 and one clone from H13

(Fig. 1). The analysis involved nucleotide sequences of residues

7071 to 7333 (which include the V3-coding region) and

resi-dues 1337 to 1598 (within the p24-coding region). The

com-parison of nucleotide sequences with those of the

correspond-ing initial clones fully confirmed the bias in the distribution of

mutations; in all, 13 replacements were found in the

gag

region

analyzed (which represents a mutation frequency of 4.5

⫻

10

⫺3

substitutions per nucleotide), while no replacements were

found in the V3-coding region (mutation frequency,

⬍

3.5

⫻

10

⫺4

substitutions per nucleotide). The statistical significance

of the biased distribution of mutations was evaluated by

com-paring the expected versus the actual number of mutations in

gag, pol

, and

env

for regions 1, 2, and 3 into which the genome

was arbitrarily divided (Fig. 2), as well as for the short

gag

and

env

stretches for the additional clones from populations D15,

F15, G7, H13, I15, and K15. These results (Table 3) indicate

high statistical significance of the biased mutant distribution.

The degree of statistical significance of the biased distribution

did not vary when either all G

¡

A mutations or just G

¡

A

mutations found in clone I15 were excluded from the

calcula-tions (in all cases,

P

⬍

0.001 [

␹

2

test]). Therefore,

accumula-tion of mutaaccumula-tions that were associated with serial bottleneck

events and with fitness loss of HIV-1 affected genomic regions

that are less variable during the natural evolution of the virus.

DISCUSSION

The results reported here describe the numbers and types of

mutations associated with fitness loss of HIV-1 as a result of

the operation of Muller’s ratchet (Table 2; Fig. 2). For clones

D15, G7, and K15, the average mutation frequency (1.3

⫻

10

⫺4

substitutions per nucleotide, measured relative to the genomic

nucleotide sequence of their respective parental clones D1,

G1, and K1) was 12 mutations per genome (range, 10 to 15),

with a predominance of transitions (75% of all mutations) over

transversions. These figures are similar to those of previous

de-terminations of the number of mutations accompanying

Mul-ler’s ratchet in the FMDV genome—an average of six

muta-tions per genome, with 77% of these transition mutamuta-tions (24).

However, clone I15 displayed a different pattern in that its

mutation frequency corresponded to 28 mutations per genome

with an overabundance of G

¡

A transitions (43% of all

mutations [Table 1]). G

¡

A is one of the substitutions that

have been associated with hypermutagenesis in HIV-1 (72,

73) and a number of other viruses (reviewed in 5, 43). In clone

I15, G

¡

A transitions were distributed rather uniformly along

the genome. Several possible mechanisms have been proposed

to explain biased hypermutagenesis (5, 43), including

alter-ations in intracellular deoxynucleotide pools. The sequence

context of 67% of the G

¡

A transitions in clone I15 was GpA

or GpG, which suggests a possible influence of low dCTP levels

during minus cDNA synthesis in the origin of this mutation

type (43). Our results with debilitated HIV-1 clones emphasize

the stochastic nature of the G

¡

A mutation bias because it

was observed in only one of four clones derived from the same

viral isolate, and these clones were subjected to identical

treat-TABLE 2. Number and types of mutations in the genome of HIV-1 clones subjected to serial plaque transfers

Clones compareda

Fitness decrease

(%)b

Mutation frequencyc

No. of mutationsd

A3C A3G C3A C3G C3T G3A G3T T3A T3C T3G Other Total

D1, D15

85

6.6

⫻

10

⫺4

₀

2

1

₀

₀

3

₀

₀

₀

₀

₀

6

G1, G7

ND

4.4

⫻

10

⫺4

₀

2

₀

₀

₀

₀

2

₀

₀

₀

₀

4

I1, I15

99

3.1

⫻

10

⫺3

1

2

₀

₀

1

12

1

1

5

4

1

28

K1, K15

63

1.2

⫻

10

⫺3

₀

4

1

1

₀

3

₀

₀

2

₀

₀

11

Total

1

10

2

1

1

18

3

1

7

4

1

49

a_{The entire genomic nucleotide sequence of the indicated clones was determined as described in Materials and Methods.}

b_{Fitness decrease refers to the comparison of D15, I15, and K15 with their corresponding initial clones D1, I1, and K1; it is expressed as percent reduction, calculated}

as described in reference 78. For G7 a relative fitness value could not be calculated because the virus yield was insufficient to perform competition passages (78).

c_{Mutation frequency is the number of mutations found in the genome of D15, G7, I15, or K15 (when compared with the corresponding initial clones D1, G1, I1,}

or K1) divided by the total number of nucleotides sequenced (in this case, the entire HIV-1 genome, or 9.1 kb); therefore, values are expressed in substitutions per nucleotide.

d_{Transversions A3T and G3C were not found in the genomes of the clones analyzed. Other, nsertion of one nucleotide at genomic residue 584 (according to}

the numbering for the genome of HXB2 [35]) in the leader sequence. The location of mutations in the HIV-1 genome is given in Fig. 2 and is discussed in the text.

on November 9, 2019 by guest

http://jvi.asm.org/

[image:3.612.53.552.84.175.2]

ment during the serial plaque transfers (Fig. 1). If the

mech-anism of nucleotide pool bias was in operation (43), it must

have been triggered either by extremely subtle perturbations in

the intracellular environment or by differences among the

ge-nomes of the four clones, differences that existed initially or

that were generated in the course of passaging. In the latter

case, the mutational biases must be subjected to

indetermina-tions derived from the dynamics of mutant generation within

the quasispecies swarms (reviewed in 10, 20).

A dominance of G

¡

A transitions was also found in an

analysis of mutations in a

lacZ

␣

-based reporter gene, which

was constructed to study a single cycle of HIV-1 replication

(39). However, there are important differences in the mutant

repertoire found following a single cycle of replication and in

our clones subjected to serial plaque transfers. In the former

study, G

¡

A, C

¡

T, and T

¡

C mutations occurred at

frequencies of 1.7

⫻

10

⫺3

, 7.1

⫻

10

⫺4

, and 1.3

⫻

10

⫺4

substi-tutions per nucleotide, respectively, while in our study these

same mutations occurred at frequencies of 4.9

⫻

10

⫺4

, 2.7

⫻

10

⫺4

, and 1.9

⫻

10

⫺4

, respectively (Table 2). After a

single-cycle replication, T

¡

G, T

¡

A, and A

¡

G each occurred at

a frequency of 6.5

⫻

10

⫺5

substitutions per nucleotide, while in

our clones the values for these substitutions ranged from 2.7

⫻

[image:4.612.91.514.69.364.2]

10

⫺4

to 2.7

⫻

10

⫺5

substitutions per nucleotide. In addition,

A

¡

C, C

¡

A, C

¡

G, and G

¡

T mutations found in HIV-1

FIG. 2. Location of mutations found in HIV-1 clones D15, G7, I15, and K15, relative to their parental counterparts. The upper part indicates HIV-1 genes and regulatory regions based on the compilation of Korber et al. (35). The four horizontal bars in the center of the figure indicate the positions of mutations along the genome (9.1 kb) in the four clones analyzed (from top to bottom, D15, G7, I15, and K15 [described in Materials and Methods]); vertical lines within these bars indicate one, two, or three mutations, according to thickness. Mutations were found at positions 35, 171, 377, 379, 570, 584, 760, 807, 833, 988, 1128, 1161, 1188, 1351, 1467, 1545, 1578, 1596, 1810, 1863, 1875, 1937, 1961, 1966, 2145, 2174, 2329, 2668, 2804, 3068, 3114, 3129, 3945, 4458, 5239, 5270, 5342, 5422, 5684, 5686, 6588, 6655, 6670, 7962, 8095, 8890, 8900, and 8989 according to the numbering of HIV-1 isolate HXB2 (35). The gp120-coding region ofenvhas been enlarged to depict the positions of variable loops V1 to V5; two mutations affected the V1-coding region. The two shaded rectangles correspond to genome positions 1337 to 1598 (gag[left shaded rectangle]) and 7071 to 7333 (env[right shaded rectangle]), which have been sequenced for a number of additional HIV-1 clones to confirm the asymmetric distribution of mutations (see text). The mutations found in these additional clones are not included in this scheme. The bottom part shows the three arbitrary regions into which the HIV-1 genome was divided to illustrate the bias in the distribution of mutations along the genome. Procedures used for nucleotide sequence determination are described in Materials and Methods, and the oligonucleotide primers are listed in Table 1.

TABLE 3. Expected versus actual number of mutations in different

genomic regions of HIV-1 clones subjected to

serial plaque transfers

Genomic regions compared

No. of mutations (Pf₎

Expected Found

gag, pol, enva _{8gag, 15.7pol, 13.2env}b _{19gag, 10pol, 5env}

(⬍0.001) R1, R2, R3a,c _{15.8 R1, 15.8 R2,}

15.8 R3b 30 R1, 11 R2, 8 R3_(⬍0.001)

gag(1337–1598),

env(7071–7333)d 6.8gag, 6.8env

e _{13gag, 0env}

(⬍0.001)

a_{Comparisons involve mutations found in clones D15, G7, I15, and K15} relative to their corresponding parental clones D1, G1, I1, and K1 (Table 2).

b_{The expected numbers of mutations are based on the mutation frequencies} given in Table 2, assuming a random distribution of mutations along the genome. c_{R1, R2, and R3 indicate genomic regions 1, 2, and 3, as depicted in Fig. 2.} d_{Comparisons involve mutations at genomic residues 1337 through 1598 and} 7071 through 7333 found in three clones from lineage F15, two clones each from lineages D15, G7, and K15, and one clone each from lineages H13 and I15, as described in the text and in Fig. 1.

e_{The expected numbers of mutations are based on the average mutation} frequencies for genomic residues 1337 through 1598 (gag) and 7071 through 7333 (env) assuming a random distribution of mutations along the two genomic stretches.

f_{Pvalues were calculated by the␹}2_test.

on November 9, 2019 by guest

http://jvi.asm.org/

[image:4.612.311.551.527.614.2]

clones (Table 2) were not represented among the mutations

found after a single infectious cycle (39). These variations in

mutation types and frequencies probably arose not only from

differences in the number of replication cycles but also from

the sequence context in the template being copied in a

differ-ent biological environmdiffer-ent (43).

The most unexpected finding in the analysis of low-fitness

HIV-1 clones was the distribution of mutations along the

ge-nome (Fig. 2), with a statistically significant accumulation of

mutations in

gag

and the first third of the genome, relative to

env

, which appears as the most conserved genomic region in all

clones examined (Fig. 2; Table 3). This is in sharp contrast to

results with natural HIV-1 isolates (35, 44, 57, 58) and with

large-population passages of HIV-1 clones—derived also from

natural isolate S61—in cell culture (64); in all of these

analy-ses,

gag

and

pol

showed more nucleotide and amino acid

sequence conservation than

env

. Several mechanisms could

contribute to this striking difference in the distribution of

mu-tations. In the course of plaque-to-plaque transfers, fitness

gains or purifying selection is probably diminished since

com-petition among genomes from the quasispecies is limited to the

period of plaque development (10, 25). In this view, the higher

variation normally seen in

env

relative to

gag

and

pol

would be

essentially due to selection for immune evasion, for adaptation

to alternative cellular receptors, increased particle stability,

etc. Evidence for selection in vivo has been obtained for HIV-1

and for simian immunodeficiency virus (2, 3, 26, 34, 48, 54, 62,

77). However, even if replicative optimization of the mutant

spectrum was limited as a result of bottlenecking, the deficit in

mutations in

env

remains to be explained. There are at least

two possibilities (which are not mutually exclusive):

env

may

have a lower tolerance for mutations than

gag

and the 5

⬘

third

of the genome under the cell culture environment in which the

passages were carried out, or HIV-1 genome replication may

be more error prone in the process of copying

gag

than when

copying

env

. Constraints to accept replacements in surface

proteins were documented through functional and structural

studies with FMDV (12 and references therein). The mutant

repertoire in viral quasispecies could be strongly influenced by

tolerance to nucleotide and amino acid substitutions,

includ-ing silent replacements in codinclud-ing regions (12, 38, 40, 67). In

HIV-1, constraints in surface proteins could come about from

the need always to use the cellular receptors presented by

MT-4 cells in culture and to enter this same cell type

monot-onously in an invariant cell culture environment. Purifying

selection during plaque growth, which must include many

cy-cles of replication, may have contributed to the observed bias

in the distribution of mutations along the genome.

A possible molecular basis for a difference in accuracy

dur-ing copydur-ing of different genome segments of HIV-1 is not

ob-vious. The lowest number of mutations was seen in the

geno-mic region copied immediately after the first strand transfer in

the synthesis of minus-strand DNA by reverse transcriptase

(RT) (reviewed in reference 68). Since processivity of RT is

limited, it could be proposed that as synthesis proceeds inside

the nucleocapsid, accuracy may decrease as a result of

envi-ronmental alterations (ionic composition, deoxynucleoside

tri-phosphate pools, etc. [43]). It has been suggested that

misalign-ment mutagenesis could be more frequent during dissociation

and reinitiation of RT-catalyzed reactions (reviewed in 1).

However, examination of the sequence context of each

muta-tion suggests that the frequency of mutamuta-tions which may have

occurred as a result of template misalignment (1, 53) is not

significantly different for regions 1, 2, and 3, into which we have

divided the HIV-1 genome (52, 64, and 63%, respectively).

Other effects on fidelity or, more likely, a combination of

factors outlined in previous paragraphs may converge to

pro-duce the unusual distribution of mutations seen in HIV-1

clones as a result of operation of Muller’s ratchet.

A total of 8 out of 20 nonsynonymous replacements found

among the HIV-1 clones analyzed have not been recorded in

current sequence data banks (35; Table 4). An attractive

pos-sibility is that replacements in

gag

could have multiple effects in

RNA-protein interactions, nucleocapsid assembly, and protein

stability (16, 30) and that such effects could contribute to

fit-ness loss. It must also be considered that Vif, Vpr, and Nef are

dispensable functions for HIV-1 replication in some permissive

cell lines, including MT-4 (7, 49). Therefore, the accumulation

of nonsynonymous replacements in

vif, vpr,

and

nef

genes (Fig.

2) could be of little consequence for plaque formation in MT-4

cells. However, an evaluation of the influence of amino acid

replacements (individually or in combination) in viral fitness

would require analysis of the effects of candidate mutations

when introduced into infectious clones or examination of

pos-sible reversions and fixation of compensatory mutations upon

fitness recovery of the debilitated HIV-1 clones. These studies

are now in progress.

[image:5.612.312.551.93.386.2]

In conclusion, some mutations associated with the operation

TABLE 4. Amino acid replacements associated with nonsynonymous

mutations during plaque-to-plaque transfers of HIV-1

Amino acid

replace-menta

Accept-abilityb Frequency in_databasec

HIV-1 protein and possible structural and functional

significanced

R15K 5 High p17 matrix

S67A 5 High p17 matrix

S209A 5 High p 24 capsid C-terminal

dimer-ization domain

K14R 5 Not found p7 nucleocapsid flanking first zinc finger motif

F16L 4 Not found p7 nucleocapsid in first zinc finger motif

I14S 2 High p6

E40G 4 Not found RT in an␣-helix in fingers subdomain

V189Ie _{5 Not found RT in palm subdomain near}

active site

E194K 4 Not found RT in palm subdomain near

active site

V466I 5 High RT in a␤-sheet of RNase H

V77I 5 Not found Integrase, in catalytic D, D-35-E domain (␤2)

P67T 4 High Vif

K77R 5 High Vif

T101N 4 Low Vif

V128I 5 High Vif

G43E 4 Low Vpr

S144I 2 Not found gp160, in V1 loop in gp120

E148G 4 Not found gp160, in V1 loop in gp120

V580I 5 High gp160, in gp41 ectodomain

D624G 4 Low gp160, in gp41 ectodomain

A32T 5 Not found Nef

R35Q 3 High Nef

E65Stopf _Nef

E154K 5 Low Nef

a_{Amino acids are numbered for each individual protein, according to the}

numbering for isolate HXB2 found in the data banks (35).

b_{The degree of acceptability of the amino acid substitution is given according}

to reference 27; the acceptability scale is from 0 to 6, with the latter value representing replacement by the same amino acid.

c_{The database consulted is the one presented in reference 35, and it was again}

retrieved on April 18, 2000, by entering GenBank and EMBL databases.

d_{Location of amino acid replacements and their possible significance is based}

on current databases (35) and overviews on HIV-1 structure-function relation-ships (references 7, 9, 28, and 30 and references therein).

e_{This replacement has been correlated with resistance to nonnucleoside RT}

inhibitors (references 11, 28, 33, 35, and 46 and references therein).

f_{This mutation leads to an amber termination codon in Nef.}

on November 9, 2019 by guest

http://jvi.asm.org/

of Muller’s ratchet in HIV-1 have not been previously reported

among natural isolates evolved over more than two decades

(35; Table 4). Furthermore, the mutations were distributed

along the viral genome, unlike mutations in natural HIV-1

isolates, and

env

was the most conserved genomic region. An

interesting possibility is that, in vivo, HIV-1 is not subjected to

as severe bottleneck events as in experiments designed to

ac-centuate Muller’s ratchet. The observations reported here add

to the complexities inherent in the relationships between

oc-currence of mutations and what can be eventually observed

upon examination of genomic nucleotide sequences. The

HIV-1 mutational pattern could be made to vary with respect to

hundreds of sequences recorded in data banks simply by

changing the passage regimen, without intervening, externally

applied, selective forces.

ACKNOWLEDGMENTS

Work at Centro de Biología Molecular “Severo Ochoa” was

sup-ported by grants FIS98/0054-01 and PM97-0060-C02-01 and that at

Centro Nacional de Biología Fundamental was supported by grants

FIS00/0266 and FIS98/0054-02. E.Y. was supported by a postdoctoral

fellowship from Comunidad Autónoma de Madrid.

REFERENCES

1. Bebenek, K., and T. A. Kunkel. 1993. The fidelity of retroviral reverse tran-scriptases, p. 85–102.InA. M. Skalka and S. P. Goff (ed.), Reverse tran-scriptase. Cold Spring Harbor Laboratory Press, Gold Spring Harbor, N.Y. 2. Borrow, P., H. Lewicki, X. Wei, M. S. Horwitz, N. Peffer, H. Meyers, J. A.

Nelson, J. E. Gairin, B. H. Hahn, M. B. Oldstone, and G. M. Shaw.1997.

Antiviral pressure exerted by HIV-1-specific cytotoxic T lymphocytes (CTLs) during primary infection demonstrated by rapid selection of CTL escape virus. Nat. Med. 3:205–211.

3. Borrow, P., and G. M. Shaw. 1998. Cytotoxic T-lymphocyte escape viral variants: how important are they in viral evasion of immune clearance in vivo? Immunol. Rev. 164:37–51.

4. Carrillo, C., J. Plana, R. Mascarella, J. Bergada, and F. Sobrino. 1990. Genetic and phenotypic variability during replication of foot-and-mouth disease virus in swine. Virology 179:890–892.

5. Cattaneo, R., and M. A. Billeter. 1992. Mutations and A/I hypermutations in measles virus persistent infections. Curr. Top. Microbiol. Immunol. 176:63– 74.

6. Chao, L. 1990. Fitness of RNA virus decreased by Muller’s ratchet. Nature

348:454–455.

7. Chen, I. S. Y., H. Koprowski, A. Srinivasan, and P. K. Vogt (ed.). 1995. Transacting functions of human retroviruses. Springer-Verlag KG, Berlin, Germany.

8. Coffin, J. M. 1995. HIV population dynamics in vivo: implications for genetic variation, pathogenesis, and therapy. Science 267:483–489.

9. Coffin, J. M., S. H. Hughes, and H. E. Varmus. 1997. Retroviruses. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.

10. Domingo, E., C. Biebricher, J. J. Holland, and M. Eigen. 2000. Quasispecies and RNA virus evolution: principles and consequences. Landes Bioscience, Austin, Tex.

11. Domingo, E., C. Escarmís, L. Menéndez-Arias, and J. J. Holland. 1999. Viral quasispecies and fitness variations, p. 141–161.InE. Domingo, R. G. Web-ster, and J. J. Holland (ed.), Origin and evolution of viruses. Academic Press, San Diego, Calif.

12. Domingo, E., M. G. Mateu, C. Escarmís, E. Martínez-Salas, D. Andreu,

E. Giralt, N. Verdaguer, and I. Fita.1996. Molecular evolution of

aphtho-viruses. Virus Genes 11:197–207.

13. Domingo, E., R. G. Webster, and J. J. Holland (ed.). 1999. Origin and evolution of viruses. Academic Press, San Diego, Calif.

14. Dougherty, J. P., and H. M. Temin. 1988. Determination of the rate of base-pair substitution and insertion mutations in retrovirus replication. J. Vi-rol. 62:2817–2822.

15. Drake, J. W. 1993. Rates of spontaneous mutation among RNA viruses. Proc. Natl. Acad. Sci. USA 90:4171–4175.

16. Druillennec, S., A. Caneparo, H. de Rocquigny, and B. P. Roques. 1999. Evidence of interactions between the nucleocapsid protein NCp7 and the reverse transcriptase of HIV-1. J. Biol. Chem. 274:11283–11288. 17. Duarte, E., D. Clarke, A. Moya, E. Domingo, and J. Holland. 1992. Rapid

fitness losses in mammalian RNA virus clones due to Muller’s ratchet. Proc. Natl. Acad. Sci. USA 89:6015–6019.

18. Eigen, M. 1971. Self-organization of matter and the evolution of biological macromolecules. Naturwissenschaften 58:465–523.

19. Eigen, M. 1996. On the nature of virus quasispecies. Trends Microbiol. 4: 216–218.

20. Eigen, M., and C. K. Biebricher. 1988. Sequence space and quasispecies distribution, p. 211–245.InE. Domingo, P. Ahlquist, and J. J. Holland (ed.), RNA genetics, vol. 3. CRC Press, Inc., Boca Raton, Fla.

21. Eigen, M., J. McCaskill, and P. Schuster. 1988. Molecular quasispecies. J. Phys. Chem. 92:6881–6891.

22. Eigen, M., and P. Schuster. 1979. The hypercycle: a principle of natural self-organization. Springer-Verlag KG, Berlin, Germany.

23. Elena, S. F., F. González-Candelas, I. S. Novella, E. A. Duarte, D. K. Clarke,

E. Domingo, J. J. Holland, and A. Moya.1996. Evolution of fitness in

experimental populations of vesicular stomatitis virus. Genetics 142:673–679. 24. Escarmís, C., M. Dávila, N. Charpentier, A. Bracho, A. Moya, and E.

Do-mingo.1996. Genetic lesions associated with Muller’s ratchet in an RNA

virus. J. Mol. Biol. 264:255–267.

25. Escarmís, C., M. Dávila, and E. Domingo. 1999. Multiple molecular path-ways for fitness recovery of an RNA virus debilitated by operation of Mul-ler’s ratchet. J. Mol. Biol. 285:495–505.

26. Evans, D. T., D. H. O’Connor, P. Jing, J. L. Dzuris, J. Sidney, J. da Silva,

T. M. Allen, H. Horton, J. E. Venham, R. A. Rudersdorf, T. Vogel, C. D. Pauza, R. E. Bontrop, R. DeMars, A. Sette, A. L. Hughes, and D. I. Watkins.

1999. Virus-specific cytotoxic T-lymphocyte responses select for amino-acid variation in simian immunodeficiency virus Env and Nef. Nat. Med. 5:1270– 1276.

27. Feng, D. F., M. S. Johnson, and R. F. Doolittle. 1984. Aligning amino acid sequences: comparison of commonly used methods. J. Mol. Evol. 21:112– 125.

28. Flint, S. J., L. W. Enquist, R. M. Krug, V. R. Racaniello, and A. M. Skalka. 2000. Virology: molecular biology, pathogenesis, and control. ASM Press, Washington, D.C.

29. Forns, X., R. H. Purcell, and J. Bukh. 1999. Quasispecies in viral persistence and pathogenesis of hepatitis C virus. Trends Microbiol. 7:402–410. 30. Freed, E. O. 1998. HIV-1 gag proteins: diverse functions in the virus life

cycle. Virology 251:1–15.

31. Goudsmit, J., A. de Ronde, E. de Rooij, and R. de Boer. 1997. Broad spectrum of in vivo fitness of human immunodeficiency virus type 1 sub-populations differing at reverse transcriptase codons 41 and 215. J. Virol. 71: 4479–4484.

32. Goulder, P., D. Price, M. Nowak, S. Rowland-Jones, R. Phillips, and A.

McMichael.1997. Co-evolution of human immunodeficiency virus and

cy-totoxic T-lymphocyte responses. Immunol. Rev. 159:17–29.

33. Havlir, D. V., S. Eastman, A. Gamst, and D. D. Richman. 1996. Nevirapine-resistant human immunodeficiency virus: kinetics of replication and esti-mated prevalence in untreated patients. J. Virol. 70:7894–7899.

34. Kimata, J. T., L. Kuller, D. B. Anderson, P. Dailey, and J. Overbaugh. 1999. Emerging cytopathic and antigenic simian immunodeficiency virus variants influence AIDS progression. Nat. Med. 5:535–541.

35. Korber, B., C. Kuiken, B. Foley, B. Hahn, F. McCutchan, J. Mellors, and J.

Sodroski.1998. Human retroviruses and AIDS: a compilation and analysis of

nucleic acids and amino acid sequences. Theoretical Biology and Biophysics Group T-10. Los Alamos, N.M.

36. Kurosaki, M., N. Enomoto, T. Nouchi, I. Sakuma, F. Marumo, and C. Sato. 1995. Fraction-specific populations of the hypervariable region of the hep-atitis C virus in a patient with cryoglobulinemia. J. Med. Virol. 46:403–408. 37. Lech, W. J., G. Wang, Y. L. Yang, Y. Chee, K. Dorman, D. McCrae, L. C.

Lazzeroni, J. W. Erickson, J. S. Sinsheimer, and A. H. Kaplan.1996. In vivo

sequence diversity of the protease of human immunodeficiency virus type 1: presence of protease inhibitor-resistant variants in untreated subjects. J. Vi-rol. 70:2038–2043.

38. Lobert, P. E., N. Escriou, J. Ruelle, and T. Michiels. 1999. A coding RNA sequence acts as a replication signal in cardioviruses. Proc. Natl. Acad. Sci. USA 96:11560–11565.

39. Mansky, L. M., and H. M. Temin. 1995. Lower in vivo mutation rate of human immunodeficiency virus type 1 than that predicted from the fidelity of purified reverse transcriptase. J. Virol. 69:5087–5094.

40. McKnight, K. L., and S. M. Lemon. 1996. Capsid coding sequence is re-quired for efficient replication of human rhinovirus 14 RNA. J. Virol. 70: 1941–1952.

41. McMichael, A. J., and R. E. Phillips. 1997. Escape of human immunodefi-ciency virus from immune control. Annu. Rev. Immunol. 15:271–296. 42. Meyerhans, A., R. Cheynier, J. Albert, M. Seth, S. Kwok, J. Sninsky, L.

Morfeldt-Manson, B. Asjo, and S. Wain-Hobson.1989. Temporal

fluctua-tions in HIV quasispecies in vivo are not reflected by sequential HIV isola-tions. Cell 58:901–910.

43. Meyerhans, A., and J.-P. Vartanian. 1999. The fidelity of cellular and viral polymerases and its manipulation for hypermutagenesis, p. 87–114.InE. Domingo, R. G. Webster, and J. J. Holland (ed.), Origin and evolution of viruses. Academic Press, Inc., San Diego, Calif.

44. Montagnier, L. 1999. Human immunodeficiency virus (Retroviridae).InA. Granoff and R. G. Webster (ed.), Encyclopedia of virology. Academic Press, Inc., San Diego, Calif.

on November 9, 2019 by guest

http://jvi.asm.org/

45. Muller, H. J. 1964. The relation of recombination to mutational advance. Mutat. Res. 1:2–9.

46. Nájera, I., A. Holguín, M. E. Quiñones-Mateu, M. A. Muñoz-Fernández, R.

Nájera, C. López-Galíndez, and E. Domingo.1995. Pol gene quasispecies of

human immunodeficiency virus: mutations associated with drug resistance in virus from patients undergoing no drug therapy. J. Virol. 69:23–31. 47. Nájera, I., D. D. Richman, I. Olivares, J. M. Rojas, M. A. Peinado, M.

Perucho, R. Najera, and C. Lopez-Galindez.1994. Natural occurrence of

drug resistance mutations in the reverse transcriptase of human immunode-ficiency virus type 1 isolates. AIDS Res. Hum. Retrovir. 10:1479–1488. 48. Nijhuis, M., R. Schuurman, D. de Jong, J. Erickson, E. Gustchina, J. Albert,

P. Schipper, S. Gulnik, and C. A. Boucher.1999. Increased fitness of drug

resistant HIV-1 protease as a result of acquisition of compensatory muta-tions during suboptimal therapy. AIDS 13:2349–2359.

49. Nishino, Y., M. Kishi, M. Sumiya, K. Ogawa, A. Adachi, K. Maotani-Imai, S.

Kato, K. Hirai, and K. Ikuta.1991. Human immunodeficiency virus type 1

vif, vpr, and vpu mutants can produce persistently infected cells. Arch. Virol.

120:181–192.

50. Novella, I. S., E. A. Duarte, S. F. Elena, A. Moya, E. Domingo, and J. J.

Holland. 1995. Exponential increases of RNA virus fitness during large

population transmissions. Proc. Natl. Acad. Sci. USA 92:5841–5844. 51. Novella, I. S., C. L. Hershey, C. Escarmis, E. Domingo, and J. J. Holland.

1999. Lack of evolutionary stasis during alternating replication of an arbo-virus in insect and mammalian cells. J. Mol. Biol. 287:459–465.

52. Novella, I. S., J. Quer, E. Domingo, and J. J. Holland. 1999. Exponential fitness gains of RNA virus populations are limited by bottleneck effects. J. Virol. 73:1668–1671.

53. Pathak, V. K., and H. M. Temin. 1992. 5-Azacytidine and RNA secondary structure increase the retrovirus mutation rate. J. Virol. 66:3093–3100. 54. Phillips, R. E., S. Rowland-Jones, D. F. Nixon, F. M. Gotch, J. P. Edwards,

A. O. Ogunlesi, J. G. Elvin, J. A. Rothbard, C. R. Bangham, C. R. Rizza, and

A. J. McMichael.1991. Human immunodeficiency virus genetic variation

that can escape cytotoxic T cell recognition. Nature 354:453–459. 55. Preston, B. D., and J. P. Dougherty. 1996. Mechanisms of retroviral

muta-tion. Trends Microbiol. 4:16–21.

56. Quiñones-Mateu, M. E., J. L. Albright, A. Mas, V. Soriano, and E. J. Arts. 1998. Analysis ofpolgene heterogeneity, viral quasispecies, and drug resis-tance in individuals infected with group O strains of human immunodefi-ciency virus type 1. J. Virol. 72:9002–9015.

57. Quiñones-Mateu, M. E., A. Holguín, J. Dopazo, I. Nájera, and E. Domingo. 1996. Point mutant frequencies in the pol gene of human immunodeficiency virus type 1 are two- to three-fold lower than those of env. AIDS Res. Hum. Retrovir. 12:1117–1128.

58. Quiñones-Mateu, M. E., A. Holguín, V. Soriano, and E. Domingo. 1996. env gene diversity of HIV type 1 isolates from Spain. AIDS Res. Hum. Retrovir.

12:955–957.

59. Ribeiro, R. M., S. Bonhoeffer, and M. A. Nowak. 1998. The frequency of resistant mutant virus before antiviral therapy. AIDS 26:461–465. 60. Robertson, D. L., B. H. Hahn, and P. M. Sharp. 1995. Recombination in

AIDS viruses. J. Mol. Evol. 40:249–259.

61. Robertson, D. L., P. M. Sharp, F. E. McCutchan, and B. H. Hahn. 1995. Recombination in HIV-1. Nature 374:124–126.

62. Rodrigo, A. G., and J. I. Mullins. 1996. Human immunodeficiency virus type 1 molecular evolution and the measure of selection. AIDS Res. Hum. Ret-rovir. 12:1681–1685.

63. Sala, M., and S. Wain-Hobson. 1999. Drift and conservation in RNA virus evolution: are they adapting or merely changing? p. 115–140.InE. Domingo, R. G. Webster, and J. J. Holland (ed.), Origin and evolution of viruses. Academic Press, Inc., San Diego, Calif.

64. Sánchez-Palomino, S., J. M. Rojas, M. A. Martínez, E. M. Fenyö, R. Nájera,

E. Domingo, and C. López-Galíndez.1993. Dilute passage promotes

expres-sion of genetic and phenotypic variants of human immunodeficiency virus type 1 in cell culture. J. Virol. 67:2938–2943.

65. Schuitemaker, H., N. A. Kootstra, R. E. de Goede, F. de Wolf, F. Miedema,

and M. Tersmette.1991. Monocytotropic human immunodeficiency virus

type 1 (HIV-1) variants detectable in all stages of HIV-1 infection lack T-cell line tropism and syncytium-inducing ability in primary T-cell culture. J. Vi-rol. 65:356–363.

66. Schuster, P., and P. F. Stadler. 1999. Nature and evolution of early replicons, p. 1–24.InE. Domingo, R. G. Webster, and J. J. Holland (ed.), Origin and evolution of viruses. Academic Press, Inc., San Diego, Calif.

67. Simmonds, P., and D. B. Smith. 1999. Structural constraints on RNA virus evolution. J. Virol. 73:5787–5794.

68. Telesnitsky, A., and S. P. Goff. 1993. Strong-stop strand transfer during reverse transcription, p. 49–83.InA. M. Skalka and S. P. Goff (ed.), Reverse transcriptase. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

69. Temin, H. M. 1989. Is HIV unique or merely different? J. Acquir. Immune Defic. Syndr. 2:1–9.

70. Temin, H. M. 1993. The high rate of retrovirus variation results in rapid evolution, p. 219–225.InS. S. Morse (ed.), Emerging viruses. Oxford Uni-versity Press, Oxford, United Kingdom.

71. Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673–4680.

72. Vartanian, J. P., A. Meyerhans, B. Asjo, and S. Wain-Hobson. 1991. Selec-tion, recombinaSelec-tion, and G3A hypermutation of human immunodeficiency virus type 1 genomes. J. Virol. 65:1779–1788.

73. Vartanian, J. P., A. Meyerhans, M. Sala, and S. Wain-Hobson. 1994. G3A hypermutation of the human immunodeficiency virus type 1 genome: evi-dence for dCTP pool imbalance during reverse transcription. Proc. Natl. Acad. Sci. USA 91:3092–3096.

74. Wain-Hobson, S. 1996. Running the gamut of retroviral variation. Trends Microbiol. 4:135–141.

75. Weaver, S. C., A. C. Brault, W. Kang, and J. J. Holland. 1999. Genetic and fitness changes accompanying adaptation of an arbovirus to vertebrate and invertebrate cells. J. Virol. 73:4316–4326.

76. Weiner, A., A. L. Erickson, J. Kansopon, K. Crawford, E. Muchmore, A. L.

Hughes, M. Houghton, and C. M. Walker.1995. Persistent hepatitis C virus

infection in a chimpanzee is associated with emergence of a cytotoxic T lymphocyte escape variant. Proc. Natl. Acad. Sci. USA 92:2755–2759. 77. Wolinsky, S. M., B. T. Korber, A. U. Neumann, M. Daniels, K. J. Kunstman,

A. J. Whetsell, M. R. Furtado, Y. Cao, D. D. Ho, and J. T. Safrit.1996.

Adaptive evolution of human immunodeficiency virus-type 1 during the natural course of infection. Science 272:537–542.

78. Yuste, E., S. Sánchez-Palomino, C. Casado, E. Domingo, and C.

López-Galíndez.1999. Drastic fitness loss in human immunodeficiency virus type 1

upon serial bottleneck events. J. Virol. 73:2745–2751.

on November 9, 2019 by guest

http://jvi.asm.org/