Construction and functional characterization of polyomavirus genomes that separately encode the three early proteins.

(1)

0022-538X/84/070170-11$02.00/0

Construction and

Functional

Characterization of Polyomavirus

Genomes That Separately Encode the Three Early

Proteins

ZUOYAN ZHU,'t GEERTRUIDAM. VELDMAN,'t ALISON COWIE,1t ANTHONYCARR,' BRIAN

SCHAFFHAUSEN,2 ANDROBERT KAMENlt*

Transcription Laboratory, ImperialCancerResearch Laboratories, London WC2A 3PX, England,' andDepartmentof

Biochemistry

and

Pharmacology,

Tufts

New

England

Medical

Center, Boston,

Massachusetts

021112

Received 3January 1984/Accepted 4 April 1984

Modified polyomavirusgenomesthatindividuallyencode t-helarge-and small T proteinswereconstructed by

exchanging restriction endonuclease fragments between cDNA copies of the respective mRNAs and cloned genomic DNA.The efficacies ofthenewconstructs,and that of the middle T proteingenedescribed previously

(R. Treisman,U. Novak, J.Favaloro,and R. Kamen, Nature [London] 292:595-600, 1981),were

demonstrat-ed with simian virus 40 (SV40)-polyomavirus recombinants in which partorall of theSV40 late regionwas

replaced with the modified polyomavirus early genes. Each of the three recombinant viruses induced the synthesis of only theexpectedpolyomavirus early protein ininfectedCV-1 cells. Theratesof synthesisof large, middle, and small T proteinswere ca. 1.5, 4.0, and 9.0 times the rateof synthesis ofSV40large T protein, respectively. The deletion of introns had no detrimental effect on mRNA biogenesis. Indeed, a further

polyomavirus-SV40 recombinant, containing wild-type polyomavirusearlyregion DNA, expressedanaberrant

58,000-dalton formof the middle Tproteinwhichwebelievetoresultfromutilization ofacryptic splice site.

Immunofluorescence studied withmonkey cells infected by the recombinant viruses allowedustodeterminethe cellular locationsofthe polyomavirusearly proteins.Overproduction ofthe middle T protein didnotresultina

corresponding overproduction of themiddleT protein-associated tyrosinephosphokinase activity.

The oncogenic potential of polyomavirus is contained

within the early region of the viral genome (36, 44). This

2.9-kilobase segment ofDNA encodes three related proteins,

large T, middle T, and small T, with respective molecular

weights of100,000, 48,000, and 22,000 daltons (100k, 48k,

and22k) (8, 17-19, 39, 43). Determination of individualroles

for the three polypeptides in virally induced

oncogenic

transformation would be facilitated ifone could separately

transfer into cells thegenesforthethreeproteins. This isnot

possible

with unmodified genomic DNA because the se-quencesencodingthethreeearlyproteins overlap

extensive-ly. The mRNAs for the proteins share common 5' and 3'

regions (see Fig. 1A). They differ only in the size and

position ofa single intron excised by RNA splicing during

theirbiogenesis (45). Differential splicing accomplishes the

changesin translational

reading

frame necessaryto resolve

the overlapping information encoded in the

genomic

DNA

sequence (8, 43). The viral genome can be modified to

separately encode the

proteins

by

specific

deletion of the

corresponding

intervening

sequence. Inthis manner,

Treis-man etal. (46)constructed a

plasmid

containing

a

polyoma-virusgenome encoding onlythemiddleTprotein (pPyMT1)

and used it to demonstrate that expression of the middleT

protein alonewas sufficienttotransform established cells of

the F2408 ratfibroblast lineto an oncogenic state. We now describe the derivation ofanalogous constructs

lacking

the introns

of

the large Tand small T mRNAs. Introduction of each of the three intron-minus polyomavirus early

region

variants into the late region for simian virus 40(SV40) has allowedus tocharacterize the geneproductsof the modified genesand thustoconfirm thattheyeach

uniquely

encode the

anticipated polypeptide. A preliminary account of these

* Correspondingauthor.

t Present address: Institute of Hydrobiology ofthe Academia Sinica, Wuhan, People'sRepublic of China.

tPresent address:Genetics Institute, Boston, MA02115.

experiments has already appeared (31). The constructs we

describehere havebeen usedtostudytheindividualrolesof

polyomavirus early proteins in oncogenic transformation

(30-32) and have proved important in the definition oftwo

steps involved in transformation mediated by cellular and viral oncogenes (23, 35).

MATERIALS AND METHODS

Cells and viruses. All cells were grown in Dulbecco

modified Eagle medium supplemented with 5% fetal calf

serum. Mouse 3T6cells were infected with wild-type

poly-omavirus strainA2at a

multiplicity

of50 PFU percell. CV-1

monkey cells were infected with a 1:10 dilution of the

recombinant SV40-polyomavirus stocksand grownfor40to

48 h at 37°C.

Construction of modified viral genomes expressing the individual early proteins. The specific procedure used to constructthe mutantlackingthe middle T

protein

intronhas

already been described (46). pPyLT1, a mutant

lacking

the

large T protein intron, was made by

introducing

the

AccI-AvaI DNA

fragment

from plasmid pE2.1 (45), which

con-tainsa

partial

cDNA copyofthelargeT mRNA

spanning

the

splice

junction,

intoa

partial

AccIplusAvaI

digest

ofa

full-lengthgenome clonedattheBamHI site

(plasmid

p53.A6.6)

(Fig. 1A). Construction ofpPyST1, a mutant lacking the

small T protein intron, was more difficult because the

only

available partial cDNA clone (pE1.1) spanning the small T

splicejunctionlacked useful restriction sitesonthe 3' side.

Therefore,arestrictionfragment (PstItoHaeIII)from

pE1.1

was used to prime the synthesis of double-stranded DNA

with the genomic PstI fragment inserted into M13mp7

(M13PyPstI-1) as the single-stranded template. An M13

recombinant(M13PyPstI-1ST)that

lacked

the 48nucleotides

correspondingtothe small Tproteinintron wasisolated,and

the AvaI fragment of replicative form DNA

spanning

the

deletionwasintroduced into

plasmid

p53.A6.6,

replacing

the

genomicAvaI

fragment.

170

on November 10, 2019 by guest

http://jvi.asm.org/

(2)

POLYOMAVIRUS GENOMES THAT ENCODE THREE EARLY PROTEINS 171

A-

BamnHIdBBmH

_BBam_HI _Barm _HI

C.~~~~~C

t~~~~ H inc 11 t / ~~~~~~~~~~~~>~HincII

Ct

pP

3.

A6.6v\

pPyLTI

0~~~~~~~0

BamHIEoR 3m 9 c

BgBI AvaI7

competeolyoavirsgeomeineaizedattAdH Bdnt HI Eco RI

ST

MT~~~~~~~~~~

~~Bgl

1 9

LT

~~~~~~~~~~~~~~410

410 747

Barn HI Bar H

Hinc11 0 HincI

p

PyMT IT

pPySTI

0S()eaasp36wclkenvuirsxefmr.3eae,dm.

EcoRI Eco RI

BarnHIAIBrHI 5

747~~~~~~~~~~9

FIG. 1. Mapsof theplasmids containing polyomavirus early regionmutantslackingthe individual earlyregionintrons. (A)p53.A6.6isa

completepolyomavirusgenome linearized atthe BamHl site and cloned intopAT153Aval7 (46). The early regionmRNAs andsplice sites

(numbersrefertothenucleotidenumberingsystem of Soedaetal.,seereference43)areindicated. The threereadingframes whichareusedto

encode small T(ST),middle T(MT),andlargeT(LT)proteinsareshownby black,hatched,ordottedregions.pPyLT1 (B), pPyMT1 (C),and

pPyST1(D)arevariants ofp53.A6.6whichlack the individual introns excised from thelarge T, middleT,orsmall TmRNA,respectively.

Construction of

SV40-polyomavirus

recombinants. The

SV40-polyomavirus recombinantsused in this

study

(Fig. 2)

represent asubsetofmanyconstructs

developed during

the courseof thisproject. We present heredescriptionsofeach

recombinant plasmid mentioned in the present manuscript.

All structures wereconfirmed

by

restriction

mapping

and

by

sequencingthe

junctions

between viral DNAs. The

nomen-clature we have used is either the SV40 DNA numbering

system (indicated by the

prefix "SV")

(44)orthe

polyoma-virus DNAnumberingsystem(indicated bythe

prefix "Py")

(43). Allplasmidsarerepresentedin

Fig.

2andaredescribed in the counterclockwise direction starting from the top of each circle.

p85.3.SP. p85.3.SP comprises a fragment containing the

complete earlyregion of SV40plus the late promoter region

fromtheBamHIsite(SV-nucleotide

[nt]

2,534) totheHpaII siteat SV-nt 348 (the HpaII site was blunted and ligated to

an XhoI linker), a genomic fragment of the polyomavirus

early regionfrom Py-nt 134 (theXhoI site in pdI3035) (20) to

theEcoRI site (Py-nt 1,565), a fragment containing part of the SV40 lateregion from theEcoRI site (SV-nt 1,782) to the BamHI site (SV-nt 2,534), inserted in theBamHIsite of the vectorpAT153 (47).

pspLT5. pspLT5 consists of a fragment containing the early region of SV40 from the BamHI site (SV-nt 2,534) to

theHpaIIsiteatSV-nt 348 (convertedinto anXhoIsite with

a linker). This early region DNA derives from the SV40 deletion mutant d12005 (41) which lacks about 250

nucleo-tides located in the SV40 large T protein intron. This

construct, therefore, expresses a normal SV40 large T

protein but is deficient in expression of SV40 small T

protein. The plasmid further comprises afragment

contain-ingthepolyomavirusearly region fromtheHphlsite(Py-nt

154) to the HincII (Py-nt 2,964) but lacking the large T

protein intron(Py-nt410-794). TheHphIsite andthe HincII

site were converted into an XhoI site and a BamHI site,

respectively, by blunt end ligation with the appropriate

linkers. The vector in this construct ispXf3 (24).

pspMTI. The recombinantpspMT1comprises afragment

containing the early region ofthe SV40 mutant d12005 (41)

from theBamHI site(SV-nt, 2,534) totheHpaII site at

SV-nt348 (converted into an XhoI site), a fragment containing

part of the polyomavirus early region from Py-nt 105 (an

XhoIsitewasinsertedatthisposition)totheEcoRI site

(Py-nt 1,565)but lackingthemiddle Tprotein intron(Py-nt

747-808), afragment containingpartoftheSV40lateregion from

the EcoRIsite(SV-nt 1,782)totheBamHIsite(SV-nt2,534), and the vectorpA6 (46),which is an AvaI-negative deriva-tive ofpAT153.

pspST18. pspST18 comprises a fragment containing the

complete SV40 early region from the BamHI site (SV-nt

2,534)toSV-nt 282; the SV40major late cap site (SV-nt 325) (33) is not present in this construct. The plasmid further consists ofafragment containing part of the polyomavirus early region from Py-nt 146 to theEcoRI site (Py-nt 1,565)

but lacking the small T protein intron (Py-nt 747-794), a

VOL.51,1984

on November 10, 2019 by guest

http://jvi.asm.org/

[image:2.612.140.473.72.383.2]

(3)

[Hpa ir] -[Hph

,HI

BamHI

pspST18 a

SV-282 I

Py-146

BornHI

EcoRI ST Intron

B

280 290 300 310 320 330 340

Major

Cap Site

PvuII KpnI

SV40 16S

Late mRNA

E

4 I i I I r I

AGCTGGTTCTTTCCGCCTCAGAAGGTACCTAACCAAGTTCCTCTTTCAGAGGTTATTTCAGGCCATGGTGCTGC(

SV40

I .. - r . 1

350

Hpa II

360

;TCACGCCA

pspMTl-t2

Xho I Linkers] p85.3.SP-{XhoI Linker p

pspST18 pspLT5

fXho

I Linkers

100 110 120 130 140 150 160 170 180

POLYOMA

|

l

TGGAGGCGCTGTGGGGCCACCCAAATTG,|ATAATAlC CCC AACCGCCTCTTCCCGCCTCAsTTTCAGCCTCACCA

CCATCE3gGATAGA

Bgl I Major Cap Sites Hph I

Py

Early

mRNA

FIG. 2. Maps of plasmidscontaining SV40-polyomavirus recombinants. (A)Adetaileddescriptionof eachplasmidisgivenin thetext.In brief, p85.3.SPcontains the 5' half of the polyomavirus early region inserted between the HpaIIandEcoRI sites ofSV40DNA. Stippled regions indicate SV40 DNA,openregionsindicatepolyomavirus DNA,and thin linesindicate the vector.TheexpectedmRNAsencoding smallT, middle T, anda truncated largeTproteinareindicated;thecoding regionsareboxed and indicate three differentreadingframes (black, hatched,ordotted).spMT1andspST18arevariants ofp85.3.SPlackingthe introns of the middle T and small TmRNAs, respectively. spLT5contains thevirtually complete polyomavirus early region lacking onlythelargeTproteinintron.(B)Junctions between theSV40late promoterregion and the polyomavirus earlygenesin the recombinantsp85.3.SP, pspLT5,pspMT1,andpspST18.Nucleotide numbers refer tothe SV system(44)forSV40andtoSoedaetal.(43)forpolyomavirus.Thelocations ofprincipalcapsites and thepolyomavirusTATAbox,

aswellas theATGcodoninitiating early proteintranslation, areindicated.

fragment containing part of the SV40 late region from the

EcoRI site (SV-nt 1,782) to the BamHI site (SV-nt 2,534), inserted into the vector pA6 (46). All of the plasmids described,and the details of the strategiesusedtoconstruct

them,are available upon request.

Growth of recombinant virus stocks. The SV40 polyoma-virus recombinant DNAs and theSV40early regiondeletion mutantpdl1055 (28)weredigestedwithBamHI and

recircu-larizedby ligationatlow DNA concentration(10 ,ug/ml).The

[image:3.612.89.541.72.583.2]

ligation mixtures were extracted with phenol mixture (6),

[Hpa II]

-o1XhoI

on November 10, 2019 by guest

http://jvi.asm.org/

(4)

POLYOMAVIRUS GENOMES THAT ENCODE THREE EARLY PROTEINS 173 lyophilized, redissolved in 100 pd of 1% NaOAc (pH

5.3)-0.1% sodium dodecyl sulfate (SDS), precipitated with

etha-nol, and run on a 1% low-melting-point agarose gel (Bethesda Research Laboratories, Gaithersburg, Md.). The super-coiled DNA bands were excised from the gel, heated for 5

minat 70°C, and cooledto 37°C. The DNA, without further

purification, was transfected into CV-1 cells with DEAE-dextran (25). For each transfection, 75 ng of supercoiled recombinantDNA plus 75ngof SV40 helper DNAwasused per

106

cells.After 10 days at37°C, the cellswere harvested by freezing and thawing them three times. These extracts (1 ml) were used undiluted to infect fresh monolayers(3 x 106 cells) of CV-1 cells. This cycle was repeated once more to

obtain the third-passage virus stocksusedin the experiments reported here.

Analysis of polyomavirus early proteins. The procedures for labeling cells with

[35SJmethionine,

protein extraction, and immunoprecipitation have been described previously (19). The proteins were separated on 10% SDS-polyacryl-amide gels (22). Mouse monoclonal antibodytoSV40 large T protein L16 (15) was generously provided by Ed Harlow.

Inmunofluorescence. Cellson cover slips were fixed witha

10% Formalin inphosphate-buffered saline solution at 42 to

48 h postinfection and stained for polyomavirus early

pro-teins with a rat antipolyomavirus tumor serum followed by incubation withafluorescein-conjugated rabbit anti-rat anti-body.

DNA binding assays. The large T protein-DNA binding assay was initiallydescribed by McKay (26). Herewe useda

procedure with modifications described in Haydayetal. (16) and a mixture of two monoclonal antibodies (aLT1 and xLT4) (4)specific forthe polyomavirus largeTprotein. The SV40 antibody was L16 (15).

Protein kinase assays.Theinvitro kinase reactions (37,42) were done as follows. Infected cells werelysed inabuffer (1

ml per 3x 106 cells) containing 0.02 M Tris-hydrochloride

(pH 8.0)-1% Nonidet P-40-0.15 M NaCl. Polyomavirus early proteins were immunoprecipitated from5 to

50-RI

samples(madeup to 150pul with NETbuffer containing 0.15 M NaCl, 0.005 M EDTA, 0.05 M Tris-hydrochloride [pH 7.4], 0.25%gelatin, 0.05%Nonidet P-40, and0.02% sodium azide) by incubationwith 6pul ofratantipolyomavirus tumor

serum and 150pul of 20% protein A-Sepharose (Pharmacia Fine Chemicals, Piscataway, N.J.) for 45 min at4°C. The immunoprecipitates werewashed oncewith phosphate-buff-ered saline, twicewith 0.5 M LiCl-0.1 M Tris-hydrochloride (pH 8.0), and resuspended into 80 pAl of 0.02 M Tris-hydrochloride (pH

7.5)-0.005

MMgCl2. [ry-32P]ATP (10to30

pCi) wasadded, and the mixturewasincubated for15 min at

30°C.

Theimmunoprecipitates were washed threetimeswith NET buffer, resuspended into 30 [L of dissociation buffer (0.02 M Tris-hydrochloride [pH 6.8],2% SDS, 10%glycerol, 0.1 M dithiothreitol, 0.03% [wt/vol] bromophenol blue),

boiled for 3 min, and analyzed on a 10%

SDS-polyacryl-amide gel. Partial proteolysis with chymotrypsin and

two-dimensional gel electrophoresis were done as described by

Schaffhausen et al. (39).

RESULTS

Construction of polyomavirus deletion mutants precisely

lacking introns of early region mRNAs. Our goal was to

separatelydelete from polyomavirusDNA thesingle introns

of the threedifferentearly region mRNAs (Fig.1A).

Remov-al of the middle T protein intron has been described

previ-ously (46). This was done by exchanging a unique AvaI

fragment spanning the 63-nucleotide intron with the

corre-sponding fragmentderived from a cloned partial cDNA copy

ofthemiddle Tprotein mRNA to generateplasmidpPyMT1.

(Fig.

1C)

(46). Exchange betweengenomic and cDNA clones was used in analogous but somewhat more complex con-structions (see above) to produce plasmids pPyLT1 and

pPyST1

(Fig.

1B

and D) which lack the 385 or the 49 nucleotides, respectively,

corresponding

to the large T and small T protein introns. Removal of the intervening se-quences resolves the overlapping coding information of the polyomavirus early region at the DNA level. The DNA sequences of the viral early regionin pPyLT1, pPyMT1, and pPyST1 are such that their primary transcripts should be identical to the mature mRNAs, and therefore, if there were no interference with efficient mRNA biogenesis caused by intron deletion, they should uniquely encode large T, middle T, and small Tproteins.

SV40-polyomavirus

recombinants expressing individual polyomavirus early proteins. We have already established that pPyMT1 encodes only the middle T protein (46) and published evidence suggesting thatpPyLT1 contains a func-tional large T protein gene (48). Further analysis of the coding capacities of the three modified early genes was facilitated by use of

SV40

viral vectors (10, 11, 14, 27) to express the proteins at elevated levels. To this end, we inserted the early genes of polyomavirus into the lateregion of

SV40.

Adetailed descriptionof the recombinants isgiven above. The initial construction was p85.3.SP (Fig. 2A), comprising a genomic polyomavirus DNA fragment encod-ing small T, middle T, and a truncated large T protein, inserted into

SV40

and replacing the 5' portion of the SV40 late region DNA; the recombinant was cloned into pAT153 (47).

pspMT1

and

pspST18

(Fig. 2A) are similar constructs. The polyomavirus genes, however, lack the middle T or small T protein introns and therefore encode only the respective T proteins. pspLT5 (Fig. 2A) contains acomplete early region of the polyomavirus genome lacking only the large T protein intron. The SV40 DNA fragment encoding part of the VP1 gene, which is present in the constructs p85.3.SP,

pspMT1,

and

pspST18,

is missing in pspLT5. The mRNA derived from the polyomavirus DNA in pspLT5 should use the polyadenylation site at the end of the large T protein gene, whereas transcription of p85.3.SP, pspMTI, and

pspST18

should generate recombinant mRNAs compris-ing the 5' part of the polyomavirus early mRNAs and the 3' part of the

SV40

VP1 mRNA. Polyadenylation in these constructs should occur at the signal normally used for the

SV40

late messengers.

Recombinant virus stocks were produced by excision of the viral genomes from recombinant plasmids (Fig. 2A) and cotransfection of CV-1 cells with these DNAs and the SV40 helper

dllO55

(28),a deletion mutant defective in earlyregion function (see above). After two subsequent undiluted pas-sages onto CV-1 monolayers, high-titer virus stocks were obtained which produced total cytopathic effect on CV-1 cells within 60 to 80 h after infection. Characterization ofthe viral DNA extracted from the infected cells demonstrated that 10 to 50% of the molecules were the expected SV40-polyomavirus recombinants (the rest being helper DNA) and that, in the virus stocks used for subsequent studies, rear-ranged DNAs were only minor components.

We made virus stocks from a number of SV40-polyoma-virus recombinants with different junctions between the

SV40

late promoter and the beginning of the polyomavirus early region. The presence or absence of the majorinitiation site of

SV40

late transcription (nt 325) (33) did not influence the expression level of the polyomavirus early proteins.

VOL.51,1984

on November 10, 2019 by guest

http://jvi.asm.org/

(5)

Furthermore, the presence ofthe polyomavirus early cap

sites (1, 27) was also irrelevant to the expression level

obtained. The particular junctions in p85.3.SP, pspLT5,

pspMT1, andpspST18 areshown inFig. 2B. The SV40 late promoterregion is linkedtopolyomavirus earlyDNAeither

preciselyatthe majorcapsite (pspLT5)or atpointsat most

50base pairs upstream (pspMT1). The translation initiation

codon(43)for theearlyproteins of

polyomavirus (Fig.

2B) is

in all cases located at least 18base pairs downstream from

the junctions between the SV40 and polyomavirus DNA

sequences.Although analysis of transcripts derived from the

SV40-polyomavirus recombinants (datanotshown) revealed

no quantitative differences in mRNA levels among

con-structs with differentjunctions, the positions of5' termini

varied. One observation in particular is worthy ofnote. All

constructs including the polyomavirus major early

region

cap sites

(polyomavirus

nt

148-153)

synthesized

mRNAs

principally initiatedatthesepositions, irrespective of

wheth-er the polyomavirus TATAbox was present and also

irre-spective of the presence of the SV40 major late cap site

(SV40nt 325).

Expression of polyomavirus earlyproteins in CV-1 cells. If

theintron-minus variants ofthe

polyomavirus

early region

indeedfunctionally encodethe threeearlyproteins,then the

SV40-polyomavirus recombinants containing them should

individuallyexpress theproteinsinrelatively largeamounts.

CV-1 cells infected with the different viruses were labeled

for2 h with

[35S]methionine.

The cell

lysates

were divided among three samples which were then

immunoprecipitated

(Fig. 3) with rat

antipolyomavirus

tumor serum (lanes P),

normal rat serum (lanes N),or as areference standard with

mousemonoclonalantibody (15) directed

against

SV40 large

Tprotein. spLT5-infected cells containedthe90kSV40

large

Tprotein, which wasexpressed fromtheSV40 early region

of the recombinant viralgenome,anda100k

protein

precip-itated by antipolyomavirus tumorserumwith the same

gel

mobilityasthepolyomavirus largeTprotein.

spMTl-infect-ed cells expressed, besides SV40 large T

protein,

the 56k

spLT5 spMTI

polyomavirus middle T protein. Immunoprecipitation of the

spST18-infected cell lysate with antipolyomatumor virus

serumshowedthe 22k small T protein. Each of the polyoma-virus proteins synthesized in the monkey cells comigrated with the corresponding polypeptides immunoprecipitated from mouse cells infected with wild-type polyomavirus (data not shown). In no case was a polyomavirus protein other than the anticipated one detectable.

Thestability of the polyomavirus proteins expressed in the CV-1cells was determined in the same experiment. After the 2-hlabeling period, the cultures were chased for 2 and 5 h

(Fig. 3). The protein bands were excised from the gel and

quantitatedbyscintillation counting. The middle T and small

Tproteins had half-lives of 4 to 5 h, whereas polyomavirus large T protein was more stable, with a half-life of about 11 h.

Data from the experiment

presented

in

Fig.

3 further

allowed the estimation ofsynthetic rates relativeto that of

theSV40largeT

protein

forthe

polyomavirus early proteins

produced in themonkey cells. We chosetocompareratesof

synthesis to the SV40 large T reference standard because

this protein was encoded

by

the same DNA molecules as

were the polyomavirus proteins (Fig. 2) rather thanby the

helperDNA. Wefoundthat the

polyomavirus large, middle,

andsmall Tproteinswere

produced

at ca.

1.5, 4.0,

and9.0

times the molarrateoftheSV40

large

T

species,

respective-ly. These proportions varied somewhat among different

experimentsinwhichanumberof

independent

virus stocks

were used, but the trend was the same: production rates

werelow with largeTand moderate withmiddle

T,

and

only

with the small T protein were they at the

anticipated high

level for

synthesis

directed

by

theSV40late promoter.

To assure that the polyomavirus

proteins

were indeed

expressed under control of the SV40 late promoter, we

demonstratedthattheir

synthesis

was blocked

by

the DNA

synthesis inhibitorcytosine

arabinoside,

whereas the SV40

large T expression was not affected, as shown for

spMT1-infected cells in

Fig.

4.

Cytosine

arabinoside blocks viral

spSTI8

0 2 5 0 2 5

S N P S N P S N P S N P S N P S N P

Q 2 5

0

25I

PP P

Py-_Py-Lt~~~~~LT _ _~~** _*~~~*

3-V-LT

SL

SV-LT X

MT- i

-MT-4w'

0 2 5

S N P S N P S N P

6w-SV-LT- T..

I.

-*-ST- , *

FIG. 3. Immunoprecipitationof polyomavirus early proteins fromCV-1cells infected with the recombinant virus stock spLT5,spMT1,or

spST18.The cells were labeled 40 h postinfection with[35S]methioninefor 2 h and subsequently chased in Dulbecco modified Eagle medium

containing methionine for2 or 5 h.Polyomavirus early proteins as well asSV40large T protein were immunoprecipitated from cell lysates and

analyzed on 10% SDS-polyacrylamide gels. Symbols: S, SV40 large T monoclonal antibody (L16) (15); N, normal rat serum; P, rat

antipolyomavirustumorserum. In thespMT15-hchase, the amount of material loaded on the gel was lower due to a technical error. The

im-munoprecipitations with antipolyomatumor serum from spMT1 lysates chased for 0, 2, or 5 h were repeated and are shown in the adjacent

three lanes. These datawereusedtodeterminedthehalf-life ofpolyomavirus middle T protein expressed in CV-1 cells.

on November 10, 2019 by guest

http://jvi.asm.org/

[image:5.612.86.541.474.665.2]

(6)

POLYOMAVIRUS GENOMES THAT ENCODE THREE EARLY PROTEINS

39h

26h

18h

_ _

~+

- +

S N P S N P S N P S N P S N P

...,,j

_~~,,

A

_zw SE i -1'~~

spMTI

85.3.SP

S N P N P S N P N P

:

:Zw=

.

. .1

.~~~~~~~~~I.,

s,

X

2 -.- =

_58 K -MT(56 K)

-Truncated LT (40K)

FIG. 4. CV-1 cells infected with spMT1 were grown in the presence(+)orabsence (-)of 40,g of cytosinearabinosideperml for18to39 hasindicated. The cellswerelabeled with

[35S]methion-ineand lysed, and samples oflysateswereimmunoprecipitated and

analyzed on SDS-polyacrylamide gel (see legend to Fig. 3 for details).

DNA replication and consequently late SV40 transcription. Our results, therefore, imply that the expression of the polyomavirus early proteins is under control of the late

promoterofSV40.

Individual expression of the polyomavirus early proteins was achieved bydeletion of the introns. In the case of the

rabbit beta-globin(13, 14) and SV40 VP1genes(12), removal

of intervening sequences drastically reduced the level of functional gene expression. Our previous experience (46)

suggested that RNAsplicingwas,bycontrast, notimportant for the efficient production of polyomavirus early region mRNAs. To address directly the question of whether intron deletion accounted for the rather low rate ofpolyomavirus proteinproduction measured in themonkey cells, we

com-pared theamount ofpolyomavirus middle Tprotein synthe-sized by spMT1 (intron-minus) with that made by the corresponding virus stock 85.3.SP (intron-plus) (Fig. 2A). The intron-minus polyomavirus DNA in spMT1-expresses the56k middle Tproteineven moreefficiently than doesthe unmodified genomic DNA in 85.3.SP (Fig. 5). Direct analy-sisof the mRNAsproducedby spMT1 showed thatthevast

majority initiatedatthepolyomavirus early regioncap sites (Fig. 2B), and thus they could not have been spliced by removal of introns within 5'-untranslated regions derived from SV40sequences in the vector.

The immunoprecipitationanalysis oftheproteins

synthe-sized in CV-1 cellsinfected by 85.3.SP (Fig. 5) revealed, in addition to the expected 56k middle T and 40k truncated largeT proteins, a prominent band at 58k. The 58k protein wasshowntobe relatedtomiddle Tprotein by immunopre-cipitation in which a middle T-specific antipeptide serum wasused(38) andby two-dimensional gel electrophoresis of

partial chymotryptic digests. Itdidnot reactwithSV40VP1 antiserum and therefore is unlikely to represent a fusion protein. Forreasons explainedbelow,wetentatively identi-fy this58kspecies as theproduct ofan erroneously spliced

mRNA resulting from utilization of a cryptic splice site withinthe middle T mRNAintron.

We conclude that the modified polyomavirus DNAs

in-FIG. 5. Analysis ofpolyomavirus early proteins expressed by

CV-1 cells infected with spMT1 or 85.3.SP. Infected cells were labeledwith[35S]methionine, and samplesoflysateswere

immuno-precipitated with either SV40 large T monoclonal antibody (S),

normal rat serum (N), or rat antipolyomavirus tumor serum (P).

85.3.SP-infectedcells expressed three polyomavirus proteinswith molecularweightsof58k, 56k (middle T),and 40k(truncatedlarge T), respectively; the22k small T protein, alsoexpressed in these

cells, was run off the gel shown here. spMTl-infected cells

ex-pressed only the 56k middleTprotein.

deedindividuallyexpresstheexpectedpolypeptides, but the expression levels obtained in SV40vectors were in general lower than expected. Splicing isnotanimportantstepinthe production of recombinant SV40-polyomavirus mRNAs. Moreover, introduction of polyomavirus genomicDNAinto recombinantgenomescanleadtotheactivation ofacryptic splice site which results in the synthesis of at least one

aberrantprotein.

Intracellular localization of polyomavirus early proteins. The individual expression of polyomavirus large, middle, and small Tproteins in CV-1 cells infected with the

appropri-ate SV40-polyomavirus recombinant viruses enabled us to

examine the intracellular localization of these proteins by simple indirect immunofluorescence with polyclonal

antitu-morserum(Fig. 6); thisserumdidnot reactwithCV-1 cells infectedby SV40 alone. Cells expressing polyomavirus large Tprotein showed the classicpatternof nuclear

[image:6.612.317.535.65.264.2]

immunofluo-MT ST

FIG. 6. Immunofluorescence ofpolyomavirus earlyproteins ex-pressed in CV-1 cells infected by spLT5 (LT), spMT1 (MT), or

spST18 (ST). - SV-LT

- Py-MT

..,:.-. .:-,... ow-'%.V

'111w. .-,

..:V-domb-ow- --

d--- --. . lw

VOL. 51, 1984 175

on November 10, 2019 by guest

http://jvi.asm.org/

[image:6.612.49.285.66.250.2] [image:6.612.310.548.576.693.2]

(7)

rescence with dark nucleoli which characterizes polyoma-virus-infected mouse cells, and thus this pattern must be predominantly due to the large T protein. Expression of the middle T protein resulted in an entirely different result. We found marked perinuclear immunofluorescence, possibly indicating localization in the Golgi apparatus, plus a struc-tured distribution throughout the cytoplasm without obvious concentration in the plasma membrane (Fig. 6B). Our visual-ization of middle T protein in CV-1 cells is virtually indistin-guishable from the pictures obtained with mouse cells infect-ed by wild-type polyomavirus and middle T-specific monoclonal antibodies (S. Dilworth, personal communica-tion). The results obtained with CV-1 cells overexpressing the small T protein, however, were novel. Monoclonal antibodies specific for this protein do not exist, and thus it hasneverbeenvisualized in cells before. The small T protein is present in the nuclei and in thecytoplasm oftheinfected CV-1 cells (Fig. 6C). Most notable, however, was the coral-likeappearanceof CV-1cells expressing the protein. Phase-contrast observation of the cells revealed the same drastic change in morphology relative to uninfected CV-1 cells or CV-1 cells infected by other SV40-polyomavirus recombi-nant viruses. We suspect from these observations that

overexpression ofpolyomavirus small T protein is toxic to

cells and causes dramatic changes in the cytoskeleton. We shall return to this point below, when we compare our findings with other recent results obtained with both the

polyomavirus (M. Rassoulzadegan and F. Cuzin, personal

communication) andSV40 (D. Livingston, personal

commu-nication) small Tproteins.

Biochemical activities of the polyomavirus early proteins

expressedin CV-1cells. We tested the specificDNA binding

activity of the polyomavirus large T protein expressed in

CV-1 cells infectedwith spLT5 by the immunoprecipitation

method (26). Radiolabeled fragments of viral DNA were

incubated withcrude cell extract. The large Tprotein-DNA

complexes were precipitated with two monoclonal

antibod-ies(4) specificfor the polyomavirus large T protein, and the

precipitated DNA fragmentswere identifiedby agarose gel

electrophoresis. Cell lysates from polyomavirus-infected

3T6 cells and SV40-infected CV-1 cells served as controls. The amounts of lysate used in the binding assays were

adjusted so that approximately equal quantities of total

proteinwere used. Polyomavirus large Tprotein expressed

in monkey cells binds specifically to the same regions of

polyomavirus DNA asdoes authenticprotein from infected

mouse cells (Fig. 7A). As described elsewhere (S. M.

Dilworth, A. Cowie, R. I. Kamen, and B. E. Griffin, Proc.

Natl. Acad. Sci. U.S.A., in press; and A. Cowie and R. Kamen, manuscript in preparation), the majorbinding site

withinthe DNAfragment designated "a" inFig. 7A occurs

adjacentto theviral originofDNAreplication onthe early

region side. The minor binding site located in DNA fragment

b(Fig. 7A) maps from the TATA box to the cap sites of the

principal early region promoter. The amount of specific

DNAbinding activity recovered from the monkey cells was very similar to that extracted from the mouse cells. Howev-er, because CV-1 monkey cells do not reach the same cell densities as 3T6 mouse cells, the level of active polyoma-virus large T protein produced perculture infected by the recombinant virus spLT5 is lower than that of wild-type

polyomavirusinfections of 3T6 mouse cells. The SV40large

T protein extracted from SV40-infected CV-1 cells binds

efficientlyto the same polyomavirus DNAfragments as the

polyomavirus protein (for this measurement, we used a

monoclonalantibody specific forSV40largeTprotein)(Fig.

3T6 CVI CVI

x ~~x x

A,

rn

Py

wt sp LT5

SV40

m

A 0020--0

15 10 25 50 20 40 100 200 20 40100200

.. . ..

.w.

-S-

-

.4

:

- a

-b

CVI CVI 3T6

x x x

B -- s

spLT5

SV40

Py

wt

m

5 10 25 501 10 25

5df1t.25.5

6 12 "

*_i.

S

-c

0

FIG. 7. Immunoprecipitationassaysof thespecificDNAbinding activities of polyomavirus and SV40 large T proteins. Extracts

prepared from either mouse ormonkey cells infected with various virus stocks were incubated with 32P-labeled restrictiondigests of either cloned polyomavirusDNA (A) orSV40 DNA (B). Specific restrictionfragments boundtothelargeTproteinswere immunopre-cipitated withmonoclonal antibodies directedagainstthe polyoma-virus or SV40 large T proteins and identified by agarose gel electrophoresis followed by autoradiography. (A) The 32P-labeled

DNA wasderivedfrom plasmidp37.3.A2 (a recombinant substan-tiallyidentical top53.A6.6shown inFig. 1)by combineddigestion withrestriction endonucleasesBamHI, Bgll, andSacl to generate

the ninefragments run asmarkers in tracks m. Thetwofragments (designated aandb) knowntocontainhigh-affinity bindingregions (9, 29; Dilworthetal.,inpress;Cowie andKamen, inpreparation) for polyomavirus large T protein were immunoprecipitated by monoclonal antibodies to polyomavirus large T protein from ex-tractsofpolyomavirusstrain A2-infectedmouse3T6 cells(3T6xPy wild type) andfrom extracts of recombinant virusspLT5-infected CV-1 cells (CV-1 x spLT5). The numbers above each gel lane indicate the volumes ofextract used, whichwere adjusted among

differentlysatestoobtainca.30, 60,150, and300

F±g

of totalprotein for the fourassaysdoneoneachextracttested.PolyomavirusDNA

fragments aand b werealso immunoprecipitated fromextracts of SV40-infectedCV-1 cellsby reactionwithamonoclonalantibodyto

SV40largeTprotein(CV-1x SV40).(B)The32P-labeledDNAused was aHindIII digest of SV40DNA (track m) in whichfragmentc containsthe knownSV40largeT DNAbindingregions. Fragmentc was immunoprecipitatedfrom extractsofspLT5-orSV40-infected

CV-1 cellsbyantibodytoSV40largeT(CV-1x spLT5and CV-1 x SV40)butnotfromextractsofpolyomavirus-infected3T6cells(3T6

x Py wild type) by monoclonal antibodies to the polyomavirus protein.

7A). By contrast, the results in

Fig.

7B show that the

polyomavirus

protein

doesnotinteract with SV40DNA ina manner detectable

by

theassay weused.

Polyomavirus

middle T

protein

can be

phosphorylated

at

on November 10, 2019 by guest

http://jvi.asm.org/

[image:7.612.323.559.76.385.2]

(8)

POLYOMAVIRUS GENOMES THAT ENCODE THREE EARLY PROTEINS 177

tyrosine residues by usinganin vitro protein kinaseassay(3,

5, 40, 42). Although it is not definitely known whether the kinase involved isthemiddleTprotein itselforanassociated cellular enzyme, the recent work of Courtneidge and Smith (2) argued for the latter alternative and suggested that the kinase is pp60csr", complexed to middle T protein. We thought that it wouldbeof interesttodetermine whetherthe middle T protein synthesized in CV-1 monkey cells could be phosphorylated at tyrosine residues in vitro. Were this the case, we could exploit the relative overproduction of the protein in monkey cells to determine whether the kinase activity increased proportionally. Middle T protein was

immunoprecipitated from a lysate of spMT1-infected CV-1 cells with rat antitumor serum. The immune complex was

incubated with [_y-32P]ATP and analyzed on an

SDS-poly-acrylamide gel (see Fig. 9B). Two32P-labeled proteins were

observed, one of which comigrated with the 56k middle T species immunoprecipitated from a [35S]methionine-labeled cell extract (data not shown); the other protein represents

the inimunoglobulin G of which the heavy chain was phos-phorylated in this assay.

The 32P-labeled middle T protein was characterized in

more detail by partial chymotryptic digestion and two-dimensional gel electrophoresis (Fig. 8). Qualitatively, the patterns from the CV-1 cells and the 3T6 cells are identical. This result, as well as V8 protease and cyanogen bromide mapping results (datanotshown),indicatesthat the middle T protein expressed in CV-1 cells is phosphorylated at the same residues as the middle T protein from 3T6 cells. The major phosphorylation site is tyrosine 315, but tyrosine 322 is also significantly labeled (39; B. Schaffhausen, manuscript inpreparation). Quantitatively, there is a striking difference between the middle Tproteins expressed in3T6 cellsand in CV-1 cells. SchaffhausenandBenjamin (37) have shownthat

[35S]methionine-labeled

3T6 cells infected with polyoma-virus expresstwo forms ofmiddle T protein, the 56k and58k species, in a 10 to 1 ratio. The 58k species, which differs from the 56k species in its invivo phosphorylation pattern,

has a 10-foldhigher specific activity in the in vitro phosphor-ylation reaction, becausethe ratio of32P-labeled 56k and58k middle T proteinsfound afterin vitro phosphorylationisone

to one. Figure 8 compares the chymotrypticfragmentsofthe 56k and 58k middleTspecies afterinvitrophosphorylation. Mouse 3T6 cells or BMK cells infected with wild-type polyomavirus showed equal amounts of the doublet pairs 39k-33k (derived from 58k) and 37k-31k (derived from 56k). CV-1 cells infectedwith spMT1, however, showed clearlya much higher level ofthe 56k deriveddoublet compared with the 58k derived fragments after in vitro phosphorylation. Whether thisdifference wascausedbyalowerinitial ratioof 58k to 56k middleTproteinorbyareducedspecific activity of the 58k species in the in vitro phosphorylation reaction was furtherexaminedby analysis ofchymotrypticfragments of in vivo-phosphorylated middle T protein derived from spMT1-infected CV-1 cells (data not shown). No in vivo-phosphorylated 58k middle T protein could be detected, indicating indeed a reduced ratio of 58k to 56k protein in spMT1-infected cells compared with wild-type

polyoma-virus-infected mouse cells.

The overproduction of middle T protein in monkey cells

enabled us to study the correlation between the amount of

middle T protein and the in vitro kinase activity. We

compared lysates containing middle T protein from CV-1

cells infected with spMT1 with lysates from 3T6 cells

infected with either wild-type polyomavirus or a tempera-ture-sensitive large T protein mutant (7) which was grown

3T6

56

58

3r

3

31 cv-'

BMK

5856

1

.58

[image:8.612.315.554.80.284.2]

p.0

FIG. 8. Partial chymotryptic digestion of polyomavirus middleT proteins labeled in vitro with [y-32P]ATP. Polyomavirus proteins were isolated from 3T6 cells or BMK cells infected withwild-type polyomavirus or from CV-1 cells infected with spMT1. After immunoprecipitation, the proteins were labeled and run on 10-cm cylindrical 10% SDS-polyacrylamide gels. Digestion with chymo-trypsin was carried out on 12.5% SDS-polyacrylamide gels. Arrow-heads indicate positions of the 39k-33k and 37k-31k doubletsderived from the 58k and 56k middle T species, respectively.

for 36 h at the permissive temperature

(32°C)

and then shifted to the nonpermissive temperature

(39°C)

for an additional 6 h. This protocol derepresses early mRNA synthesis and results in the synthesis of elevated amountsof middle T protein. The quantities of middle T protein present in these infected cells were determined in a continuous labeling experiment. Cells were infected with the appropri-ate virus stocks and labeled with

[35S]methionine

for 42 h under conditions of methionine excess. Middle T protein was immunoprecipitated from cell lysates containing equal amounts of total protein. CV-1 cells infected with spMT1 contained5 times more middle T protein than the mouse cells infected with the temperature-sensitive mutant and 20 times more than cells infected with wild-type polyomavirus (Fig. 9). The results of in vitro kinase assays are shown in Fig. 9B. Increasing amounts oflysatescontaining 7, 28, and 70

,ug

of total protein were immunoprecipitated and incubat-ed with

[-y-32P]ATP.

The

32P-labeled

proteins were analyzed on an SDS-polyacrylamide gel (Fig. 9B). With each lysate, the amount of

32P-labeled

middle

T protein obtained was directly proportional to the quantity of extract protein add-ed. This indicated that neither the ATPconcentrationnorthe antibody concentration was limiting the assay. The level of kinase activity in the activity in the extract of spMT1-infected CV-1 cells was somewhat lower than the levels obtained with the mouse cell extracts (Fig. 9B). It is appar-ent that the level of kinase activity does notcorrelate at all with the amount ofmiddleT protein expressed by theCV-1 cells. This may indicate that a factor which is essential for the in vitro kinase activity is limiting in the monkey cell extract. Two possible explanations for this will be discussed.

DISCUSSION

We constructed polyomavirus mutants which lack the introns of the early region mRNAs. The mutants pPyLT1, VOL.51, 1984

on November 10, 2019 by guest

http://jvi.asm.org/

(9)

A

_{In vivo}

Continuous Labeling

3 3T6 3T6 CVI

x x x

Py wt Py tsAspMTI 7

'...M

B

_In

_v/f

_ro

Phosphory lat ion

T6 x Py wt 3T6 x Py tsA CVI x spMTI

I I --II I

28 70 7 28 70 7 28 70

_

FIG. 9. Comparison of middle T protein production and in vitro kinase activity in lysates of mouse 3T6 cells infected with either wild type or atemperature-sensitive (tsA) mutant of polyomavirus or of CV-1 cells infected with spMT1. (A) Cells were labeled continuously with

[35S]methionine during the infection period. Cell lysates containing equal amounts of total proteins were immunoprecipitated with rat

antipolyomavirus tumor serum and analyzed on 10% SDS-polyacrylamide gels. The middle T protein bands were quantitated by densitometry. (B) In vitro kinase activity assay onlysates containing increasing amounts (7, 28, or 70

pLg)

of total protein. The32P-labeled middle T protein bands were excised from the gel and counted in a scintillation counter.

pPyMT1, (46), and pPyST1 encode thepolyomavirus early

gene products large T, middle T, and small T protein,

respectively. SV40-polyomavirus recombinant DNAs, in

which part of the SV40 late region was replaced by the

modified polyomavirus early genes, were introduced into

CV-1 cells in the presence ofan SV40 helper DNA. The

recombinantvirus stocksobtained inducedtheexpression of

the individual polyomavirusearlyproteins uponinfection of

CV-1 cells as was shown by immunoprecipitation of the

proteins from

[35S]methionine-labeled

cellextracts.

The expressionlevelsobtained in CV-1 cells infected with the recombinantvirus stocksspLT5 and spMT1werelower thanexpectedfor synthesis directed bythe late promoterof

SV40. spST18-infected cells, however, expressed small T

protein at the anticipated high level. The mRNA levels

expressedbythe threerecombinantvirus stockswere

indis-tinguishable

by

Northern blot and

Si

mappinganalysis (data

notshown), suggestingthat thedifferenceinexpression may

be related to differences in the translation efficiency of the mRNAsor to otherundetermined factors.

The virus stock spLT5 is not veryuseful forthe

produc-tion of large amounts of polyomavirus large T protein because theexpressionlevelisessentiallythesame asthatof

wild-type polyomavirus-infected mouse cells. spMT1

ex-pressesmiddle Tproteinin CV-1 cellsat alevel that ishigher

thanwild-typepolyomavirus-infected mousecells. A

contin-uouslabeling experiment (Fig. 9A) showed thatweobtained

inmonkey cells five timesmoremiddleTproteinthanin 3T6 cells infected with the temperature-sensitive mutant. This system, therefore, could be used to produce middle T

protein forsubsequentpurification. The spST18virus stock

offers anexcellent systemforhigh-levelexpressionof small T protein which could subsequently be purified from cell

lysates

of infected CV-1 cells.

Theexpression of the individual polyomavirus early

pro-teins enabled us to study their intracellular localization by

indirect immunofluorescence. Large Tproteinwaslocalized

in the nucleus. Middle T protein was largely perinuclear,

probablyinthe Golgi apparatus, as well as found throughout

thecytoplasm in a structure which could be the endoplasmic

reticulum. Small T protein was found in the cytoplasm as

well as in the nuclei of infected CV-1 cells. Recently, SV40 small T protein was also observed in both the nuclei and

cytoplasm of infected CV-1 cells (D. Livingstone, personal

communication). Therole of small T protein,

especially

as a

nuclear protein, is still obscure. Another observation was that the cells expressing large amounts of polyomavirus small Tprotein were rounded up and detached easily from

theplasticculturedishes. This isconsistent withthe results

of effortstoestablish mouse or ratcell linesexpressing only

the small T protein by transfection with pPyST1 DNA (J. Griffin and R. Kamen,unpublished data;M.Rassoulzadegan and F. Cuzin, personal communication); the transfected

cells detach fromthesubstrate(butdonotdie)andcannotbe

propagated on unmodified plastic surfaces. It is, therefore,

likely that polyomavirus small T protein disrupts the

cyto-skeleton of the cells, as wasfound for SV40 smallTprotein

(34).

Inthe comparisonofmiddleTproteinexpressionin CV-1 cellsbythevirus stocks spMT1 (intron-minus) and 85.3.SP

(intron-plus), weobserved, besides theexpected56k(middle

T) and 40k (truncated large T)proteins,aprominent protein

of 58k immunoprecipitated by antipolyomavirus tumor

se-rumfrom85.3.SP-infected celllysates (Fig. 5). Thisprotein

could be precipitated with middle T-specific antipeptide serum (38) but notwith antiserum against SV40 VP1 (data not shown); it is therefore probably not a fusion protein

includingthe SV40 sequence. Moreover,peptidepatternsof

58k and56k middleTspeciesobtainedbypartial

chymotryp-tic digestion and two-dimensional gel electrophoresis were

AP

It

'P.,(i

*0

0 on November 10, 2019 by guest

http://jvi.asm.org/

[image:9.612.146.480.74.305.2]

(10)

POLYOMAVIRUS GENOMES THAT ENCODE THREE EARLY PROTEINS 179 virtually indistinguishable (i.e., the 37k-31k doublet was

found in both patterns). This distinguishes the

85.3.SP

58k

protein from the 58k middle Tcharacterized bySchaffhausen and Benjamin (37) because the latter yields a 39k-33k dou-blet. The 58k protein from 85.3.SP-infected CV-1 cells was further tested in the in vitro kinase assay and proved not to be a phosphorylatable substrate. This 58k middleTspecies, therefore, does not represent the modified form of 56k middle T identified by Schaffhausen and Benjamin (37), which was an enhanced activity as a substrate in the in vitro kinase assay. The two recombinants 85.3.SP and spMT1are virtually identical (Fig. 2) with no major differences in the regions of transcription initiation, the cap sites, or the 3'-junction between the polyomavirus and

SV40

sequences. They differ,

however,

in the presence of the 63-base pair middle T intron in 85.3.SP. We therefore suspect that the58k middleT species is the product of an aberrant splicing event within the intron for the middle T protein. Upon investiga-tion of the intron DNA sequences (nt 747-808) (44) anumber of potential splice sites were identified which do notchange the translation reading frame of the mRNA. Splicing be-tween nt 747 and nt 760 would generate a middle T species containing an extra 16 amino acids, whereas splicing be-tween nt 766 and nt 794 (43) would encode a proteinhaving an additional 11 amino acids; these would cause increasesin molecular weight of 2k and 1.3k, respectively, either of which could account for the observed 58k species. Such aberrant splicing has never been observed in wild-type polyomavirus early mRNAs. If the recombinant transcripts made by 85.3.SP indeed use one of the alternative splice sites, one might argue that a full-length polyomavirus early transcript somehow is required to prevent incorrectsplicing. In an experiment to study the correlation between the amount of middle T protein and in vitro kinase activity, we compared the specific activities of middle T from lysates of

spMT1-infected

CV-1 cells and polyomavirus-infected 3T6 cells (Fig. 9). Although5 to 20 times more middle T protein was present in

spMT1-infected

cell lysates, the in vitro kinase activity was very similar to the activity of lysates from polyomavirus-infected mouse cells. The absence of a proportional increase in activity might indicate that afactor which is essential for in vitro kinase activity is limiting in the CV-1 cell extract. This result is consistent with the proposal (2) that the enzyme responsible for in vitro phosphorylation of middle T protein is

pp60-src,

a protein present in small amounts in all mammalian cells. Because only a small proportion of the middle T protein present in infected cellsis associated with the kinase activity (3) or occurs as a complex with

pp60c-sr

(2), one would not expect, underthis hypothe-sis, to observe increased kinase activity by overproduction of the middle T protein. Another observation, however, must be considered. The ratio of the 58k and 56k middle T species expressed in monkey cells is lower than in wild-type polyomavirus-infected mouse cells. This was found by chy-motryptic mapping of protein phosphorylated in vitro and subsequent two-dimensional electrophoresis (Fig. 8). The relatively lower in vitro kinase activity of monkey cell lysates might reflect the amount of 58k middle T species rather than the total amount of middle T protein. It will be of interest to determine whether the fraction of middle T protein that is associated with

pp6O-crc

represents predomi-nantly in vivo phosphorylated middle T species such as the 58k protein.

The modified polyomavirus genomes whose construction and characterization are described have already been instru-mental in the elucidation of oncogenic transformation

in-duced

by

both viral and cellular oncogenes (23, 30-32, 35,

46).

Separate

roles have been assigned to the middle and

large T proteins in the alteration of cell growth regulation

(30-32). Future experiments will be directed towards

deter-mination of the function of the small T protein in the

transformation of nonestablished cells and towards an

un-derstandingoflarge Tprotein-mediated establishmentatthe

biochemical level.

ACKNOWLEDGMENTS

We thank Joe Sambrook forthe plasmid d12005, David

Living-stonefor providinguswith SV40 VP1 antiserum, Mary-Jane Geth-ing for useful discussions, and Marybeth Erker for her help in

preparingthe manuscript.

LITERATURE CITED

1. Cowie, A., P. Jat, and R. Kamen. 1982. Determination of

sequences atthe capped 5' ends of polyoma virus early region transcripts synthesized in vivo and in vitro demonstrates an

unusual microheterogeneity. J. Mol. Biol. 159:225-255. 2. Courtneidge, S. A., and A. E. Smith. 1983. Polyoma virus

transforming protein associates with the product of the c-src

cellular gene. Nature (London) 303:435-439.

3. Dilworth, S. M. 1982. Protein kinase activities associated with distinct antigenic forms of polyoma virus middle T antigen. EMBO J. 1:1319-1328.

4. Dilworth, S. M., and B. E. Griffin. 1982. Monoclonal antibodies against polyoma virus tumor antigens. Proc. Natl. Acad. Sci. U.S.A. 79:1059-1063.

5. Eckhardt, W., M. A. Hutchinson, and T. Hunter. 1979. An

activity phosphorylating tyrosine inpolyomaTantigen immuno-precipitates. Cell 18:925-933.

6. Favaloro, J., R. Treisman, and R. Kamen. 1980. Transcription maps of polyoma virus-specific RNA: analysis by two-dimen-sional nuclease S1 gel mapping. Methods Enzymol. 65:718-749. 7. Fried, M. 1965. Cell transforming ability of a temperature-sensitive mutant of polyoma virus. Proc. Natl. Acad. Sci. U.S.A. 53:486-491.

8. Friedmann, T., A. Esty, P.LaPorte, andP.Deininger. 1979. The nucleotide sequence and genome organizationof the polyoma early region: extensive nucleotide and amino acid homology with SV40. Cell 17:715-724.

9. Gaudray, P., C. Tyndall, R. Kamen, and F. Cuzin. 1981. The

high affinity binding site on polyoma virus DNA for the viral large T protein. Nucleic Acids Res. 9:5697-5710.

10. Gething, M.-J., and J. Sambrook. 1981. Cell-surface expression of influenza haemagglutinin from a cloned DNA copy of the RNA gene. Nature (London) 293:620-625.

11. Gruss, P., and G. Khoury. 1982. Gene transfer into mammalian cells: useof viral vectors to investigateregulatory signalsfor the expression of eukaryotic genes. Curr. Top. Microbiol. Im-munol. 96:159-170.

12. Gruss, P., C.-J.Lai, R.Dhar, andG.Khoury. 1979.Splicingas a

requirement forbiogenesis offunctional 16S mRNAs of simian virus 40. Proc. Natl. Acad. Sci. U.S.A. 76:4317-4321. 13. Hamer, D. H., and P. Leder. 1979. Splicing andtheformation of

stable RNA. Cell 18:1299-1302.

14. Hamer, D. H., and P. Leder. 1979. Expression of the chromo-somal mouse,B-globin gene cloned in SV40. Nature (London) 281:35-40.

15. Harlow, E., L. V. Crawford, D. C. Pim, andN. M. Williamson. 1981. Monoclonal antibodies specific for the simian virus 40

tumor antigens. J. Virol. 39:861-869.

16. Hayday, A. C., F. Chaudry, and M. Fried. 1983. Loss of

polyoma virus infectivity as a result of a single amino acid change in a region ofpolyoma virus largeT-antigen which has

extensive amino acid homology with simian virus 40 large

T-antigen. J. Virol. 45:693-699.

17. Hunter, T., M. A.Hutchinson, and W.Eckhardt. 1978. Transla-tion of polyoma virusTantigensinvitro. Proc. Natl. Acad.Sci.

U.S.A. 75:5917-5920.

18. Hutchinson, M. A., T.Hunter, and W.Eckhardt. 1978. Charac-VOL. 51,1984

on November 10, 2019 by guest

http://jvi.asm.org/

(11)

terization of T antigens in polyoma-infected and transformed cells. Cell15:65-80.

19. Ito, Y., N. Spurr, and R. Dulbecco. 1977. Characterization of polyoma virus T antigen. Proc. Natl. Acad. Sci. U.S.A.

74:1259-1263.

20. Jat, P., U. Novak, A. Cowie, C. Tyndall, and R. Kamen. 1982. DNA sequences required forspecific andefficient initiation of transcription at the polyoma virus early promoter. Mol. Cell.

Biol. 2:737-751.

21. Kamen, R., P. Jat, R. Treisman, J. Favaloro, and W. R. Folk. 1982. 5' Termini of polyoma virus early region transcripts synthesized in vivo by wild type virus and viable deletion mutants. J. Mol. Biol. 159:189-224.

22. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature (London) 227:680-685.

23. Land, H., L. F. Parada, and R. A. Weinberg. 1983. Tumorigenic conversion of primary embryo fibroblasts requires at least two cooperating oncogenes. Nature (London) 304:596-602.

24. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular

cloning. Cold Spring Harbor Laboratory. Cold Spring Harbor,

N.Y.

25. McCutchan, J. H., and J. S. Pagano. 1968. Enhancementofthe

infectivity of simian virus 40 deoxyribonucleic acid with dieth-ylaminoethyl-dextran.J. Natl. Cancer Inst. 41:351-357. 26. McKay, R. D. G. 1981. Binding ofasimian virus40 Tantigen

related proteinto DNA. J. Mol. Biol. 145:471-488.

27. Mulligan, R. C., B. H. Howard, and P. Berg. 1979. Synthesis of

rabbitbetaglobin in cultured monkey cellsfollowing infection withaSV40 beta globin recombinant genome. Nature (London)

277:108-114.

28. Pipas, J. M., S. P. Adler, K. W. C. Peden, and D. Nathans. 1980.

DeletionmutantsofSV40that affectthestructure of viraltumor

antigens. Cold Spring HarborSymp. Quant. Biol. 44:285-291. 29. Pomerantz, B. J., C. R. Mueller, and J. A. Hassell. 1983.

Polyomavirus largeTantigenbinds independently tomultiple, unique regionson theviralgenome.J. Virol. 47:600-610. 30. Rassoulzadegan, M., A. Cowie, A. Carr, N. Glaichenhaus, R.

Kamen, and F. Cuzin. 1982. The roles of individual polyoma

virus early proteins in oncogenictransformation. Nature

(Lon-don)300:713-718.

31. Rassoulzadegan, M., A. Cowie, A. Carr, N. Glaichenhaus, R. Treisman, J. Favaloro, F. Cuzin, and R. Kamen. 1982.Separate butcomplementary roles for polyoma virusearly proteinsin the

alteration of cellgrowth requirementsleadingtotransformation,

p. 269-293. In D. L. Robberson and G. F. Saunders (ed.), Perspectives on genes and the molecular biology ofcancer. Raven Press,NewYork.

32. Rassoulzadegan, M., Z. Naghashfar, A. Cowie, A. Carr, M.

Grisoni,R.Kamen,and F.Cuzin. 1983. Expressionof thelarge

T protein of polyoma virus promotes the establishment in

culture of "normal" rodent fibroblast cell lines. Proc. Natl. Acad. Sci. U.S.A. 80:4354-4358.

33. Reddy, V. B., P. K. Gosh, P. Lebowitz, and S. M. Weissman. 1978.Gaps and duplicatedsequencesintheleaders of SV4016S RNA. Nucleic AcidsRes. 5:4195-4213.

34. Rubin, H., J. Figge, M. T. Bladon, L. B. Chen, M. Ellman, I. Bikel, M. Farrell, and D. M. Livingston. 1982. Role of small t antigen in theacutetransformingactivityofSV40. Cell 30:469-480.

35. Ruley, E. 1983.Adeno early region1Aenables viralandcellular transforminggenes totransform primary cells inculture.Nature (London) 304:602-606.

36. Schafibausen,B. 1982.Transforminggenesandgeneproducts of polyoma and SV40. Crit. Rev. Biochem. 13:215-286.

37. Schaffhausen, B., and T. L. Benjamin. 1981. Comparison of phosphorylation oftwopolyoma virus middleTantigens in vivo

and invitro. J.Virol. 40:184-196.

38. Schaffhausen, B., T. L. Benjamin, L. Pike, J. Casnellie, and E. Krebs. 1982. Antibody to the nonapeptide Glu-Glu-Glu-Glu-Tyr-Met-Pro-Met-Glu is specific for polyoma middleTantigen

andinhibits in vitro kinase activity. J. Biol. Chem. 257:12467-12470.

39. Schaffhausen, B., J. Silver, and T. Benjamin. 1978. Tumor

antigen(s) incells productively infected bywild type polyoma

virusand mutant NG18. Proc. Natl. Acad. Sci. U.S.A. 75:79-83.

40. Schaffhausen, B. S., and T. L. Benjamin. 1979. Phosphorylation ofpolyomaTantigens. Cell 18:935-946.

41. Sleigh, M. J., W. C. Topp, R. Hanich, and J. F. Sambrook. 1978. MutantsofSV40with an altered small Tproteinarereduced in theirabilitytotransformcells. Cell 14:79-88.

42. Smith, A. E., R. Smith, B. E. Griffin, and M. Fried. 1979.

Protein kinaseactivity associated with polyoma virus middle

T-antigenin vitro. Cell 18:915-924.

43. Soeda, E., J. R. Arrand, N. Smolar, J. E. Walsh, and B. E.

Griffin. 1980. Coding potential and regulatory signals of the polyoma virus genome. Nature(London)283:445-453.

44. Tooze,J. (ed.).1980. The molecularbiology oftumorviruses.II.

DNA tumor viruses. Cold Spring Harbor Laboratory, Cold SpringHarbor, N.Y.

45. Treisman, R., A. Cowie, J. Favaloro, P. Jat, and R. Kamen. 1981. The structuresofthe spliced mRNAsencoding polyoma

virusearly region proteins. J. Mol. Appl. Genet. 1:83-92. 46. Treisman, R., U. Novak, J. Favaloro, and R. Kamen. 1981.

Transformation ofratcellsbyanalteredpolyoma virusgenome

expressing only the middle-T protein. Nature (London) 292: 595-600.

47. Twigg, A. J., and D. Sherratt. 1980. Trans-complementable copy-numbermutantsofplasmid ColEl. Nature(London)382: 216-218.

48. Tyndall, C., G. LaMantia, C. M. Thacker, J. Favaloro, and R. Kamen. 1981. A region of the polyoma virusgenomebetween the replication origin and late protein coding sequences is required in cis forboth early gene expression and viral DNA

replication. Nucleic Acids Res. 9:6231-6250.