Copyright © 1999, American Society for Microbiology. All Rights Reserved.
Proteolytic Activity, the Carboxy Terminus of Gag, and the Primer
Binding Site Are Not Required for Pol Incorporation into
Foamy Virus Particles
DAVID N. BALDWIN
ANDMAXINE L. LINIAL*
Division of Basic Sciences, Fred Hutchinson Cancer Research Center, Seattle, Washington 98109, and Department of
Microbiology, University of Washington, Seattle, Washington 98195
Received 3 March 1999/Accepted 4 May 1999
Human foamy virus (HFV) is the prototype member of the spumaviruses. While similar in genomic
orga-nization to other complex retroviruses, foamy viruses share several features with their more distant relatives,
the hepadnaviruses such as human hepatitis B virus (HBV). Both HFV and HBV express their Pol proteins
independently from the structural proteins. However unlike HBV, Pol is not required for assembly of HFV core
particles or for packaging of viral RNA. These results suggest that the assembly of Pol into HFV particles must
occur by a mechanism different from those used by retroviruses and hepadnaviruses. We have examined
possible mechanisms for HFV Pol incorporation, including the role of proteolysis in assembly of Pol and the
role of initiation of reverse transcription. We have found that proteolytic activity is not required for Pol
incorporation. p4 Gag and the residues immediately upstream of the cleavage site in Gag are also not
important. Deletion of the primer binding site had no effect on assembly, ruling out early steps of reverse
transcription in the process of Pol incorporation.
Human foamy virus (HFV) is the best-characterized
mem-ber of the
Spumavirus
genus of the family
Retroviridae
(33).
Foamy viruses are complex retroviruses, encoding the
canon-ical retroviral genes
gag
,
pol
, and
env
, as well as several
acces-sory genes (13). Despite clear sequence and genomic structural
homology with other retroviruses, several features of HFV
replication are similar to more distant relatives, the
hepadna-viruses, which are the only other mammalian reverse
transcrip-tase (RT)-encoding viruses (1, 40).
Like hepatitis B virus (HBV), HFV expresses its Pol protein
independently of structural proteins (11, 27, 40). Foamy viruses
express Pol from a spliced mRNA, whereas hepadnaviruses
use either ribosomal scanning or internal initiation (20). The
resulting HFV Pol polyprotein contains no Gag domains and
must therefore be assembled into particles by a mechanism
different from those used by other known retroviruses, where
Gag-Pol fusion proteins are incorporated into particles via
Gag-Gag interactions (14, 21, 35). We have previously
dem-onstrated that the requirement for HFV Pol during assembly is
similar to what has been found for other retroviruses and
different from that found for hepadnaviruses. As with other
retroviruses, abrogation of HFV Pol expression has no effect
on assembly of particles, packaging of viral genomic RNA, or
release of virus from the cell (1). For hepadnaviruses however,
the P protein is required to initiate proper assembly and is
essential for genome encapsidation (3, 5, 31, 32). While these
data suggest an HFV assembly pathway which is initiated as in
other retroviruses, they give no hint of how the Pol protein
might be incorporated into the particles.
The pathway of HFV reverse transcription also follows the
retroviral paradigm in which the initiation at the primer
bind-ing site (PBS) requires complex formation with a specific
tRNA. The HFV PBS contains 18 nucleotides of perfect
ho-mology to the 3
⬘
end of both rat and human tRNA
1,2Lys, and
there is evidence for synthesis of strong-stop DNA (23, 24). In
contrast, the HBV P protein binds in
cis
to a secondary
struc-ture (
ε
) in the genomic RNA (3, 5, 31, 32), an event which
initiates both reverse transcription and assembly, processes
which are intimately coupled (32). Priming of HBV reverse
transcription uses a tyrosine residue on the N-terminal domain
of the P protein (37). A HFV Pol deletion mutant still
pack-ages RNA (1), demonstrating a clear difference from the
as-sembly pathway of HBV.
The activities of the HFV Pol domains have been studied in
vitro. The RT activity from a foamy virus was first
demon-strated in 1971 (29), and later template-primer sets for
endog-enous RT activity were optimized for simian foamy virus 1 (7),
and the foamy virus “strain H4188” (26). The HFV RT domain
has been expressed in
Escherichia coli
and shown to have DNA
polymerase activity in in situ RT gel assays (23, 24). The RNase
H (RH) domain has also been shown to be active (6, 23). An
unusual feature of HFV is that Pol is activated before or during
viral assembly and release. About 25% of HFV particles
con-tain full-length DNA (40, 42), and experiments with RT
inhib-itors such as zidovudine are consistent with the fact that DNA
is the infectious genome (28, 40). It is unclear exactly when
reverse transcription begins. The finding that the RNA
ge-nome is packaged by Gag (1) does not rule out the possibility
that reverse transcription is initiated early in assembly.
There-fore, it is also possible that complex formation between Pol,
tRNA, and the PBS is required for packaging Pol protein into
virions.
Although HFV Pol contains a protease (PR) domain, the
proteolytic processing of Gag and Pol by the HFV PR is
dif-ferent from that in other retroviruses. Only two cleavage
events are known to occur (25). The 78-kDa HFV Gag protein
is processed once at its C terminus, to release a 4-kDa peptide,
an event which occurs in approximately 50% of the Gag
pre-cursor molecules. Recent work suggests that this cleavage is
required for efficient replication, since mutants which lack
cleavage site replicate less well and revert to wild type in
* Corresponding author. Mailing address: Division of Basic
Sci-ences, Fred Hutchinson Cancer Research Center, A3-015, 1100
Fair-view Ave. N., P.O. Box 19024, Seattle, WA 98109-1024. Phone: (206)
667-4442. Fax: (206) 667-5939. E-mail: [email protected].
6387
on November 9, 2019 by guest
http://jvi.asm.org/
culture. Mutants lacking the C-terminal p4 protein can also
replicate, but at very low levels (10). The exact Gag cleavage
site has been identified biochemically by using recombinant PR
(30). PR also cleaves the 127-kDa Pol polyprotein once to
release a 45-kDa integrase protein (IN), but the exact site of
cleavage between the reverse transcriptase (RT/RH) and IN
remains unknown. This cleavage is probably essential, as a PR
active site mutant (HFV-D/A) is not replication competent
(25). There are no data bearing on the role of proteolytic
processing for packaging of Pol proteins into virions.
In this report, we investigate the role of proteolytic cleavage,
complex formation of RT at the PBS, and initiation of reverse
transcription with respect to their importance for the
incorpo-ration of the Pol protein into particles. We demonstrate that
neither PR activity nor the PBS is required for Pol assembly.
MATERIALS AND METHODS
Recombinant plasmid DNAs.A shuttle vector was generated to facilitate cloning and manipulation of five unique restriction-derived fragments from the original molecular clone of HFV, human spumaretrovirus clone 13 (HSRV13) (33). An annealed set of kinase-treated linker oligonucleotides was added to the NEB193 (New England Biolabs) polylinker at thePacI site to generate plasmid HFVLink2 (L2). The insertion destroyed the existingPacI site. These oligonu-cleotides were Linktop (5⬘-CGGCCGATTTAAATTAATTAATCCGGAGCTG AGCTTAAGCCTAGGGATATCATGCATAT-3⬘) and Linkbot (5⬘-ATGCAT GATATCCCTAGGCTTAAGCTCAGCTCCGGATTAATTAATTTAAATCG GCCGAT-3⬘). This insert contains all of the unique sites from the viral sequence of HSRV13. The insert was screened for orientation such that the enzyme sites were in the following order with respect to the NEB193 polylinker:BamHI (NEB193),EagI,SwaI,PacI,BspEI,BlpI,AflII,AvrII,EcoRV,NsiI,XbaI (NEB193),SalI (NEB193).
Five unique fragments of the HFV genome from HSRV13 were then cloned into the L2 vector. Each subclone was named according to the position of the unique fragment in the genome. Sub1 containsEagI-SwaI, Sub2 containsSwa
I-PacI, Sub3 containsPacI-BspEI, Sub4 containsBspEI-BlpI, and Sub5 contains
BlpI-SalI. These subclones were subsequently used for PCR mutagenesis. PCR mutagenesis.The general strategy for mutagenesis was as follows. Two oligonucleotides corresponding to sequences outside the NEB193 polylinker were used in all mutagenesis reactions. The external primers were 193(⫹), corresponding to positions 21 to 40 in NEB193 (5⬘-GGTGAAACCTCTGACA CAT-3⬘), and 193(⫺), corresponding to positions 577 to 558 (5⬘-CCCAGGCT TTACACTTTATG-3⬘). Internal primers were designed to contain mutations and a uniqueNheI site for ligation of PCR products. Ligated PCR products were digested with enzymes unique to the L2 polylinker and subcloned into L2.
A protein kinase A (PKA) phosphorylation site was introduced in the C terminus of the IN domain of Pol. The consensus PKA sequence is Arg-Arg-X-Ser-X (RRxSx), where x is preferably a small hydrophobic amino acid (4, 5, 38). Nucleotide positions 6262 to 6265 were changed from ATT to CGT, converting isoleucine to arginine. Positions 6269 to 6275 were changed from ACTTCT to GCTAGC, converting a threonine to alanine such that the amino acid sequence IRTSL was changed to RRASL. The oligonucleotides for PCR were Nhe1top (5⬘-TTACAGGAACGTCGTGCTAGCTTATACCATCCATCCACCCCTCCA GCC-3⬘) with 193(⫺) and Nhe1bot (5⬘-ATGGTATAAGCTAGCACGACGTT CCTGTAAAAGAGAAAGTTCTTCTTC-3⬘) with 193(⫹); 5 ng of Sub3 was used as a template for PCR. PCR products were digested withNheI and ligated to each other. The ligation product was digested withBamHI andSalI and subsequently cloned intoBamHI/SalI-digested L2 vector. ThePacI/BspEI frag-ment containing the PKA (Sub3-PKA) site was then cloned back into HSRV13 and named HFV-PKA. The samePacI/BspEI fragment was then cloned into different mutant backgrounds.
The PR active site mutant HFV-D/A contains an aspartic acid-to-alanine mutation at the active site of the viral PR (25). Sub3-PKA was cloned into the D/A background as described above and named HFV-D/A-PKA. The negative control for assembly,⌬ATG was generated by digesting the Sub1 vector with
MfeI andNcoI, filling in with Klenow, and religating. This was then transferred to the PKA and the D/A-PKA backgrounds, which were called⌬ATG-PKA and
⌬ATG-D/A-PKA, respectively. Three Gag mutants were constructed in a similar fashion, using the Sub2 vector; these are called 78T/A, 74Stop, and 68Stop. For each mutant, two separate PCRs were performed with mutagenic oligonucleo-tides and the vector-based oligonucleooligonucleo-tides 193(⫹) and 193(⫺). Both PCR products contained anNheI site in the region downstream of the desired muta-tion in Gag. PCR products were digested with NheI, ligated together, and redigested with enzymes unique to the polylinker flanking the HSRV13 unique sites. The Sub2 mutants were then cloned back into the viral background with the enzymesSwaI andPacI. The oligonucleotides used for these reactions were 78T/A-1 (5⬘-AGCCTTGCTAGCCAGAGTGCCACGTCCTCCACAGATC-3⬘), 78T/A-2 (5⬘-CAGTTCGCTAGCTGCGGCGACAGCGCGTGAGTCACCAG
C-3⬘), 74STOP-2 (5⬘-GTACGCTAGCTTACTAATTGACAGCGCGTGAGTC ACCAGC-3⬘), 68STOP-1 (5⬘-AGCCTTGCTAGCCGCGGAGGAAGAGGTA ACCACAACCG-3⬘), and 68STOP-2 (5⬘-GTACGCTAGCTTACTAAGCTGG TCTGGGAGTTTGTGACTG-3⬘). Primer pairs were as follows for the initial reactions: 78T/A, 193(⫹) plus 78T/A-2 and 193(⫺) plus 78T/A-1; 74STOP, 193(⫹) plus 78T/A-2 and 193(⫺) plus 74STOP-1); 68STOP, 193(⫹) plus and 68STOP-2 and 193(⫺) and 68STOP-1. For the STOP mutants, the coding se-quence was unaltered prior to the TAA insertion. The cleavage site mutant 78T/A contains four mutations at and near the cleavage site, changing the amino acid sequence from NTVT to AAAS. The amino acids alanine and serine (AS) correspond to the coding sequence of theNheI site (GCTAGC) used to ligate the PCR products. These mutants were generated twice, once in the wild-type HFV-PKA [HFV (wt)] background and once in the D/A-HFV-PKA background.
The PBS was deleted from Sub1 and subsequently recloned into various viral backgrounds. The PBS sequence (5⬘-TGGCGCCCAACGTGGGG-3⬘; positions 1124 to 1142 of the proviral DNA) was replaced with anNheI site (AGCGCT) by the PCR strategy described above. The oligonucleotides used for the PBS deletion were PBS-NHE-1 (5⬘-AGTGATGCTAGCCTCGAATATAAGTCGG GTTTATTTG-3⬘) and PBS-NHE-2 (5⬘-TCAGATGCTAGCATTGTCATGGA ATTTTGTATATTG-3⬘). Primer sets were 193(⫹) plus PBS-NHE-2 and 193(⫺) plus PBS-NHE-1.
Cell culture and transient transfection.FAB indicator cells expressing -ga-lactosidase from the HFV long terminal repeat were maintained in Dulbecco’s modified Eagle’s medium supplemented with 5% fetal bovine serum. Transfec-tion and infecTransfec-tion efficiencies were measured directly with FAB cells by fixing and staining with a colorometric substrate for-galactosidase (41). FAB cells stain blue only when the HFV transactivator Tas (present in all proviral con-structs) is expressed. Human embryonic lung fibroblasts, COS cells, and 293T cells were maintained in Dulbecco’s modified Eagle’s medium–10% fetal bovine serum. Transfections were performed with Lipofectamine reagent (Gibco-BRL) according to the manufacturers instructions and optimized for our cells and DNA as previously described (1).
Gradient purification of HFV particles.Transfected cell supernatants were clarified of cell debris by low-speed centrifugation (2,000 rpm; IEC clinical HN-SII tabletop centrifuge) and filtered through a Nalgene 0.45m-pore-size syringe filter. Virus was pelleted through standard buffer (50 mM Tris [pH 7.5], 1 mM EDTA, 140 mM NaCl) containing 20% sucrose by ultracentrifugation in an SW28 rotor (Beckman Instruments) at 24,000 rpm for 2 h. Virus was resus-pended in standard buffer and placed on a 10 to 40% step gradient of iodixanol (Optiprep; Nycomed Pharma). The 5-ml gradients were formed by sequentially underlaying 1-ml aliquots of increasing concentrations of iodixanol at 10, 20, 30, and 40%. Gradients were centrifuged from 4 to 12 h at 36,000 rpm in a Ti55 rotor (Beckman Instruments). Gradients were made in 5-ml Beckman Ultraclear tubes (13 by 51 mm); 0.7-ml fractions were collected from the top of the gradient, and proteins were precipitated from each by adding trichloroacetic acid (TCA) to a final concentration of 10%. The precipitates were pelleted at 14,000 rpm in a microcentrifuge (Eppendorf), washed once with 10% TCA to remove the iodixa-nol, and finally washed with acetone to remove the TCA. Pellets were resus-pended in Tris-EDTA (TE) containing 1% sodium dodecyl sulfate (SDS) and boiled to solubilize the precipitate; 10% of each fraction was then analyzed by Western blotting for viral Gag protein, using polyclonal anti-Gag antibody de-rived from the central (capsid) domain of Gag (1), and the remaining 90% was diluted 1:10 in TE (pH 8.0) (0.1%, final concentration) for immunoprecipitation (IP)-PKA analysis of the Pol proteins (see below).
Protein kinase assay for detection of Pol.The catalytic subunit of PKA (Sig-ma) was used to phosphorylate viral and cellular Pol proteins containing the recognition sequence RRxSx (4, 5, 38). For all figures in this report, Pol proteins were immunoprecipitated from cell lysates or viral pellets by using polyclonal anti-RH rabbit serum (1). Pol expression was also verified by two independent criteria. The same Pol proteins were detected by IP-kinase reactions using either anti-IN serum (Martin Lo¨chelt, Heidelberg, Germany) or anti-RH serum. In addition, radioimmunoprecipitation with the anti-RH serum as previously de-scribed (1) (data not shown) verified that the 127-kDa band seen in the IP-kinase assays was in fact the Pol protein. Cellular Pol protein was immunoprecipitated from one transfected plate of FAB cells. Lysates for IP were prepared by resuspending cells or virus in antibody buffer (20 mM Tris [pH 7.5], 50 mM NaCl, 0.5% Nonidet P-40 [NP-40], 0.5% SDS, 0.5% sodium deoxycholate [DOC], 0.5% aprotinin), cellular nucleic acids were sheared with a 23-gauge needle, and insoluble materials were pelleted and discarded; 2 to 4l of antiserum was added to the lysate and vortexed. The immune complexes were precipitated with pro-tein A-Sepharose for 3 h at 10°C, washed twice with high-stringency radioimmu-noprecipitation assay (RIPA) buffer (10 mM Tris [pH 7.4], 150 mM NaCl, 1% NP-40, 1% DOC, 0.1% SDS, 0.5% aprotinin), washed once with high-salt buffer (10 mM Tris [pH 7.4], 2 M NaCl, 1% NP-40, 1% DOC), and finally washed with 1⫻PKA buffer (20 mM Tris [pH 7.5], 100 mM NaCl, 12 mM MgCl2, 4 mM dithiothreitol). PKA was added in 1⫻PKA buffer (20 U/reaction) in the pres-ence of 10 to 25Ci of [␥-32P or33P]ATP. Reactions were carried out at 37°C for 30 to 60 min. The complex was then washed twice with RIPA buffer to remove most of the unincorporated label. A second IP was performed by boiling the complex in TE–1% SDS, removing the supernatant, and diluting it 1:10 in TE (pH 8.0). Fresh anti-Pol antiserum and protein A-Sepharose were added for 3 h. This complex was again washed three times with RIPA buffer and once with TE.
on November 9, 2019 by guest
http://jvi.asm.org/
Then 1⫻SDS-polyacrylamide gel electrophoresis (PAGE) sample buffer was added directly, and the samples were boiled for 5 to 10 min. Proteins were separated by SDS-PAGE, dried onto Whatman 3MM, and exposed to film or a PhosphorImager screen.
RESULTS
Proteolytic processing of Gag or Pol is not required for
assembly of Pol into HFV particles.
To better understand the
role of the viral PR during assembly, we wanted to test whether
the HFV PR active site mutant (HFV-D/A) was capable of
assembling Pol into virions. However there are inherent
diffi-culties in detecting the small amount of Pol protein present in
virions from transiently transfected cells. Since traditional
methods such as Western blot analysis and
radioimmunopre-cipitation analysis failed to convincingly detect Pol, we
intro-duced a consensus recognition sequence for the catalytic
sub-unit of PKA (HFV-PKA) into the
pol
gene. This method had
previously been used to detect the HBV P protein (4, 5). The
PKA site was introduced near the C terminus of IN via
site-directed PCR mutagenesis, by changing the amino acid
se-quence IRTSL to RRASL (Fig. 1A). Using antibodies raised
against the RH domain of Pol, we were able to
immunopre-cipitate and specifically phosphorylate the 127-kDa Pol
precur-sor from transfected cells (Fig. 1B, lane 3; Fig. 1C, lane 1).
Although we used anti-RH serum, we also detected the
cleaved form of IN (45 kDa) by SDS-PAGE. This suggests that
either cleavage can occur in vitro after IP or that the complex
between the cleaved Pol proteins is stable under the conditions
used for the IP. Interactions between RT and IN have been
demonstrated for other retroviral Pol proteins (19, 39). In the
wild-type HFV-transfected cells (Fig. 1B, lane 2), no specific
bands were seen, indicating that phosphorylation of Pol
re-quires the engineered PKA site. Analysis of the Gag proteins
demonstrated that cleavage of Gag by the HFV-PKA Pol is
similar to that seen for HFV (wt) (Fig. 1D, lanes 1 and 2).
While the expression and processing of Gag and Pol appear
normal for HFV-PKA, infectivity was reduced 1,000-fold with
respect to HFV (wt) (data not shown). We presume but have
not established that this difference is due to a defect in
inte-gration. Since all of our analyses are done during the first
round of replication, before reinfection can occur, the
integra-tion status is not important.
[image:3.612.68.271.68.325.2]We next subcloned the PKA mutation into the PR active site
mutant background, HFV-D/A, in order to study the role of
proteolysis during assembly. As expected for HFV-D/A-PKA,
we no longer detected cleavage of either Pol (by the IP-kinase
assay [Fig. 1C, lane 2]) or Gag (by Western blot analysis [Fig.
1D, lane 3]). As a negative control for virus assembly, we
constructed a mutant with a deletion spanning the initiation
codon for Gag. This mutant,
⌬
ATG-D/A-PKA (Fig. 2A),
con-tains a deletion of 1,240 bases beginning at position 1120 of the
proviral sequence and ending at position 2368, upstream of the
3
⬘
splice site for
pol
.
⌬
ATG-D/A-PKA makes no detectable
Gag by Western blot analysis (Fig. 3C, lane 1) but regularly
FIG. 1. IP-PKA and Western blot analysis of HFV-PKA andHFV-D/A-PKA. Assay conditions are as described in Materials and Methods except that the second IP step was omitted for PKA analysis of cellular Pol proteins. Anti-RH antiserum was used to immunoprecipitate Pol, and anticapsid antiserum was used for Gag Western blots. (A) Schematic diagram of HFV (wt) and HFV-PKA Pol proteins. (B) IP-PKA analysis of HFV-PKA. Lanes: 1, positive control for PKA phosphorylation; purified interleukin-1 receptor (38); 2, HFV (wt)-trans-fected cells; 3, HFV-PKA-trans(wt)-trans-fected cells. (C) PKA analysis of cell lysates mock transfected (lane 3) or transfected with HFV-PKA and HFV-D/A-PKA (lanes 1 and 2, respectively). (D) Western blot analysis of HFV-PKA Gag proteins. Lanes: 1, HFV (wt); 2, HFV-PKA; 3, HFV-D/A-PKA.
FIG. 2. Optiprep gradient purification and analysis of Gag and Pol proteins from HFV-D/A-PKA virus particles. Gradients and analyses were performed as described in Materials and Methods. (A) Schematic of negative control for virus assembly and Pol incorporation,⌬ATG-PKA. (B) IP-PKA analysis of cell-asso-ciated Pol proteins from⌬ATG-PKA and HFV-D/A-PKA, using anti-RH serum. Cells were transfected with⌬ATG-D/A-PKA (lane 1) or HFV-D/A-PKA (lane 2) or mock transfected (lane 3). (C) Western blot analysis of purified HFV-D/ A-PKA particles, using anti-Gag antiserum. Fraction densities (in grams per cubic centimeter) are listed above the lanes. Lanes 1 to 7 correspond to fractions 1 to 7 from the gradient; 78 kDa is the expected size for unprocessed Gag from HFV-D/A-expressing constructs (Fig. 3A). (D) IP-PKA analysis of gradient-purified HFV-D/A-PKA virus particles. Lanes 1 to 4 correspond to fractions 3 to 6 from the gradient. Fraction densities (in grams per cubic centimeter) are listed above the lanes. (E) IP-PKA analysis of gradient fractions from cell supernatants of the negative control for virus assembly, ⌬ATG-D/A-PKA. Lanes 1 to 4 correspond to fractions 3 to 6.
on November 9, 2019 by guest
http://jvi.asm.org/
[image:3.612.340.521.72.322.2]expresses Pol at higher levels than Gag-expressing proviral
constructs such as HFV-D/A-PKA (Fig. 2B, lanes 1 and 2)
when transfection efficiencies are comparable as measured by

-galactosidase activity in FAB cells.
We then purified HFV-D/A-PKA virus particles of the
cor-rect density from cell supernatants to determine whether Pol is
encapsidated. To this end, viral pellets were resuspended and
centrifuged to density equilibrium on gradients of iodixanol
(Optiprep). Iodixanol gradients have previously been used to
study the incorporation of Vif into human immunodeficiency
virus type 1 virions (9). We found that HFV-D/A-PKA
parti-cles sedimented at the appropriate density of 1.12 to 1.15 g/cm
3(Fig. 2C, lanes 4 and 5) as detected by Gag Western blot
analysis of the gradient fractions. When we analyzed the same
fractions for the presence of Pol, we were able to detect
HFV-D/A-PKA Pol cosedimenting with Gag (Fig. 2D, lane 2).
Im-portantly, extracellular Pol was not detected in gradient
frac-tions of comparable density from cells expressing Pol but no
Gag (Fig. 2E). Thus, we conclude that detection of Pol in
fractions at 1.12 to 1.15 g/cm
3requires particle formation.
Taken together, these data indicate that proteolytic activity is
not necessary for the specific incorporation of HFV Pol into
virions.
The primary structure at the cleavage site in Gag is not
important for Pol incorporation into particles.
We were
inter-ested in determining whether the binding event which initiates
the single cleavage of Gag by PR might be responsible for
recruiting Pol into particles. We tested several mutations at or
near the cleavage site (Fig. 3A). The Gag cleavage site was
mutated to block cleavage (78T/A); two Gag truncation
mu-tants, 74Stop (truncated exactly at the cleavage site) and
68Stop (truncated 25 amino acid residues upstream of the
cleavage site) were also generated. We introduced these
mu-tations into the HFV-PKA (wtPR) background. We found that
Gag proteins of the expected sizes were expressed by all of
these clones after transfection (Fig. 3B, lanes 3 to 5).
Detection and quantitation of HFV-PKA Pol in virions
proved difficult due to HFV PR activity either before or during
the IP-kinase assay. Although the signal-to-noise ratio was
greatly improved by the use of a second IP after the IP-kinase
reaction, cleaved forms of IN might be lost during the second
IP, preventing quantitative comparison of the Gag mutants to
the PR active site mutant. As PR activity was not required for
Pol incorporation, the same Gag mutations were generated in
the D/A-PKA background. When the resultant mutant viruses
were analyzed by Western blotting, Gag proteins of the correct
size were detected (Fig. 3C, lanes 4 to 6). No Gag was
synthe-sized by the Gag deletion mutant,
⌬
ATG-D/A-PKA (Fig. 3C,
lane 1). In the IP-kinase assay, Pol proteins were expressed at
similar levels in cell extracts after transfection with the Gag
mutant constructs (Fig. 3D, lanes 2 to 4).
Virus particles produced after transfection with the Gag
mutants were purified on iodixanol gradients and probed for
Gag by Western blotting (Fig. 4A, lanes 4 and 5). All of the
mutants analyzed sedimented at a density similar to that of the
D/A-PKA parental virus (Fig. 2B). When the corresponding
fractions were analyzed for Pol, we were able to detect Pol in
each of the Gag mutants (Fig. 4B, lanes 1 and 2). No Pol could
be detected in other fractions of the gradient (data not shown).
These results demonstrate that while the cleavage of Gag
seems to be an important step in the replication cycle of HFV
(10), neither the Gag cleavage site itself nor the primary
se-FIG. 3. Analysis of cellular Gag and Pol expression from HFV-PKA and [image:4.612.317.546.70.319.2]HFV-D/A-PKA mutants. (A) Schematic of expected Gag protein products from mutant proviral constructs. (B) Western blot analysis of Gag proteins from cells mock transfected (lane 6) or transfected with the constructs indicated at the top. (C) Western blot analysis of Gag proteins from cells mock transfected (lane 7) or transfected with the HFV-D/A-PKA-expressing constructs indicated at the top. (D) IP-PKA analysis of cellular Pol proteins. Shown are the mutants in the D/A-PKA background which were tested for Pol incorporation into virus particles. These experiments included a second IP step after the phosphorylation reaction.
FIG. 4. Gradient purification and analysis of Gag mutant viruses. (A) West-ern blot analysis of gradient fractions for viral Gag. Lanes 1 to 7 correspond to gradient fractions 1 to 7. (B) IP-PKA analysis of fractions 4 to 6 from the gradients shown in panel A. Lanes 1 to 3 correspond to fractions 4 to 6. 78A, 78T/A; 74S, 74Stop; 68S, 68Stop (see Fig. 3B for schematic). Fraction densities (in grams per cubic centimeter) are listed above the lanes.
on November 9, 2019 by guest
http://jvi.asm.org/
[image:4.612.72.274.72.321.2]quence immediately surrounding it is required for
incorpora-tion of Pol into virus particles.
The PBS is not essential for Pol incorporation.
Binding of
Pol to the PBS occurs at an early stage of HFV assembly, and
it is possible that this step is responsible for its incorporation
into particles. Such a scenario would be similar to what is
found for HBV, where P protein binds to
ε
and initiates both
reverse transcription and assembly (3, 5, 31, 32). Since HFV
Pol is active during assembly, rather than at an early stage after
infection, the mechanism of HFV Pol assembly could involve a
specific stage of reverse transcription. We deleted the PBS by
PCR mutagenesis (Fig. 5A). In the
⌬
PBS constructs, Gag was
expressed as expected. Gag was processed in the HFV-PKA
background (Fig. 3B, lane 2) and not processed in the
D/A-PKA background (Fig. 3C, lane 3).
⌬
PBS-D/A-PKA Pol was
expressed in transfected cells at levels similar to those of other
D/A-PKA-expressing mutants (Fig. 3D, lane 1).
Gradient-pu-rified particles from the
⌬
PBS-D/A-PKA-transfected cells
sedimented at 1.12 to 1.15 g/cm
3, as seen for other mutant
viruses (Fig. 5B, lanes 4 and 5), and Pol was detected in the
same fractions (Fig. 5C, lanes 2 and 3), demonstrating that Pol
was indeed present in these particles. Thus, the PBS is not
required for Pol assembly.
DISCUSSION
During the course of these studies on the mechanisms of Pol
expression and assembly, we noticed that HFV Pol expression
is quite low, both at the mRNA level (40) and at the protein
level (1, 2). We were unable to detect Pol in virus particles
without radiolabeling in vitro. The regulation of Gag and Pol
stoichiometry is an important aspect of retroviral replication.
Conventional retroviruses have evolved sophisticated
mecha-nisms to regulate both Pol expression and activation (reviewed
in references 8 and 21). Synthesis of Pol as a Gag-Pol fusion
protein keeps the level of Pol protein low, allows incorporation
of Pol into particles via Gag domains, and prevents activation
of Pol until a subsequent round of infection. It could be
det-rimental to the host cell to have active RT in the cytoplasm
where mRNA substrates are abundant. In the case of
con-ventional retroviruses, overexpression of Gag-Pol and the
resulting activation of PR in the cytoplasm has been shown to
negatively affect virus assembly (22). While on average,
retro-viruses contain two copies of their genomic RNA per virion,
they contain one Gag-Pol fusion for every 20 Gag molecules
(21), or about 100 Pol proteins per virion (36). Hepadnaviruses
have a much lower ratio of P protein to core protein per virion.
Since P binds to the
ε
signal in the RNA, there are only one or
two P proteins per virion (5). It is not known how many Pol
molecules there are per HFV particle. If Pol-RNA interactions
are required, then the ratio of Pol to Gag in virions could be as
low as one to two Pol proteins per virion, which is consistent
with difficulty in detecting Pol in particles. However, even if
Gag-Pol interactions are responsible for assembly, low levels of
Pol synthesis could be the limiting factor. Quantitative analyses
of the ratio of Gag and Pol in cells and particles have not yet
been done.
The mechanisms for regulation of expression and activation
of HFV Pol are not known. Splicing to generate
pol
mRNA is
one step where regulation could occur (11, 27, 40). Translation
of the spliced mRNA may also be regulated, as the
pol
gene
contains a very long 5
⬘
untranslated region. We were unable to
get Pol expression from cytomegalovirus promoter constructs
lacking the bona fide splice junction (data not shown),
consis-tent with a role for the untranslated region in protein
expres-sion. It has recently been shown for HBV that the dicistronic
message which results in P protein expression is regulated at
the translational level (20). The
⌬
ATG mutant, however, leads
to higher levels of Pol expression than Gag-expressing
provi-ruses (Fig. 2C; compare lanes 1 and 2). Perhaps for the
⌬
ATG
mutant, Pol can be translated from both spliced and unspliced
mRNAs, whereas for wild-type HFV,
gag
translation
down-modulates
pol
expression during viral replication. Another
out-standing question is how Pol is activated. Our data suggest
(Fig. 1 and 2) that PR activity is not important for Pol
incor-poration, but how are the activities of PR and RT temporally
controlled? It is likely that cleavage of Pol plays a role in
activation, a step which appears to be initiated after Pol
incor-poration. This is the case for other retroviruses where RT
activity is dependent on cleavage by PR during virion
matura-tion. For avian leukosis virus, Gag-Pol precursors have very
little RT activity until processed by PR in
trans
after assembly
and during maturation (34). While the mechanisms regulating
retroviral maturation remain a mystery, the regulation of RT
activation is clearly an important issue to both the virus and its
host. Perhaps a molecular chaperone, such as one of the Hsp
family members, sequesters the HFV Pol protein until it can
find its binding partners. In the case of HBV RT, the
chaper-one Hsp90 binds to and is essential for the activity of the
enzyme during assembly (16–18).
In this study, we examined the mechanism of Pol assembly in
HFV. We have considered both Pol-protein and Pol-RNA
interactions, as well as the role of proteolysis. We have found
that neither the activity of the viral PR nor the PBS is required
for assembly of Pol into particles. Our studies to date,
there-fore, do not answer the question of whether Pol incorporation
occurs through protein-protein or protein-RNA interactions.
If protein-protein interactions are important, the PR domain
remains a likely candidate. Delineation of a region in Gag
critical for Pol incorporation is an important next step.
[image:5.612.57.287.70.287.2]If Pol-RNA interactions are important, the region of the
FIG. 5. Gradient purification and analysis of⌬PBS-D/A-PKA. (A) Detailedschematic of the PBS deletion on the RNA genome. Shown is the homology with the 3⬘end of tRNA1,2Lysfrom which reverse transcription is initiated. Deleted nucleotides are underlined; a putative 5⬘encapsidation signal is labeled⌿. (B) Western blot analysis of Gag. Lanes 1 to 7 correspond to fractions 1 to 7. Fraction densities (in grams per cubic centimeter) are listed above the lanes. (C) IP-PKA analysis of Pol proteins. Lanes 1 to 4 correspond to fractions 3 to 6 shown in panel B.
on November 9, 2019 by guest
http://jvi.asm.org/
aHFV genome located at the 3
⬘
end of the
pol
gene, which has
been reported to be critical for HFV vector transfer (12, 15), is
a good candidate. While the role that this genome region plays
in vector transfer is not known, it might contain sequence
information or secondary structure which directs Pol binding.
If the
pol
region of the genome is important for Pol assembly,
the spliced
pol
mRNA might interfere, but this mRNA should
not be packaged since it does not contain the putative
⌿
region
required for vector transfer. Alternatively, the presence of
ribosomes on the
pol
message might block the ability of the
RNA to form the appropriate secondary structure for Pol
recognition. Additionally, posttranslational translocation of
Pol protein would also be required. Pol proteins would then
have a much higher probability of encountering the abundant
viral genome than the spliced
pol
message in the cytoplasm. If
Pol-RNA interactions are important for assembly, then
ge-nome dimerization could also play a role in secondary
struc-ture formation and hence Pol assembly. Dimerization of Pol
proteins and viral genomes might even act in concert to
as-semble Pol and RNA. It is also possible that Env plays a role
in the assembly of Pol since Gag-Env interactions are required
for very late stages of assembly (1).
While these studies do not reveal the actual mechanism of
Pol assembly, they have ruled out two essential processes in the
replication pathway. In the future, it will be important to study
domains of Gag and Pol and to look at the effects of
uncou-pling RNA packaging and Pol incorporation in Gag mutants.
Delineation of a mechanism could come from Gag mutants
lacking only one of these functions.
ACKNOWLEDGMENTS
D.N.B. was supported by Public Health Service National Research
Service Award T32 GM07270 from the National Institute of General
Medical Sciences. This investigation was also supported by grant
CA18282 from the National Cancer Institute to M.L.L.
We thank Christopher Meiering for thoughtful discussions and help
with the design and implementation of subcloning and mutagenesis
strategies. We thank Michael Emerman (FHCRC) for valuable
dis-cussion and critical reading of the manuscript, Markus Karl
Detten-hofer (Johns Hopkins University, Baltimore, Md.) for input regarding
the Optiprep reagents, and Martin Lo¨chelt and Rolf Flu¨gel
(Heidel-berg, Germany) for kindly providing IN antiserum.
REFERENCES
1.Baldwin, D. N., and M. L. Linial.1998. The roles of Pol and Env in the assembly pathway of human foamy virus. J. Virol.72:3658–3665. 2.Baldwin, D. N., and M. L. Linial.1998. Unpublished results.
3.Bartenschlager, R., M. Junker-Niepmann, and H. Schaller.1990. The P gene product of hepatitis B virus is required as a structural component for genomic RNA encapsidation. J. Virol.64:5324–5332.
4.Bartenschlager, R., C. Kuhn, and H. Schaller. 1992. Expression of the P-protein of the human hepatitis B virus in a vaccinia virus system and detection of the nucleocapsid-associated P-gene product by radiolabelling at newly introduced phosphorylation sites. Nucleic Acids Res.20:195–202. 5.Bartenschlager, R., and H. Schaller.1992. Hepadnavirus assembly is
initi-ated by polymerase binding to the encapsidation signal in the viral RNA genome. EMBO J.11:3413–3420.
6.Benzair, A. B., A. Rhodes-Feuillette, R. Emanoil-Ravicovitch, and J. Peries. 1983. Characterization of RNase H activity associated with reverse transcrip-tase in simian foamy virus type 1. J. Virol.47:249–252.
7.Benzair, A. B., A. Rhodes-Feuillette, R. Emanoil-Ravicovitch, and J. Peries. 1982. Reverse transcriptase from simian foamy virus serotype 1: purification and characterization. J. Virol.44:720–724.
8.Craven, R. C., R. P. Bennett, and J. W. Wills.1991. Role of the avian retroviral protease in the activation of reverse transcriptase during virion assembly. J. Virol.65:6205–6217.
9.Dettenhofer, M., and X.-F. Yu.1999. Highly purified human immunodefi-ciency virus type I reveals a virtual absence of Vif in virions. J. Virol. 73:1460–1467.
10. Enssle, J., N. Fischer, A. Moebes, B. Mauer, U. Smola, and A. Rethwilm. 1997. Carboxy-terminal cleavage of the human foamy virus Gag precursor molecule is an essential step in the viral life cycle. J. Virol.71:7312–7317.
11. Enssle, J., I. Jordan, B. Mauer, and A. Rethwilm.1996. Foamy virus reverse transcriptase is expressed independently from the Gag protein. Proc. Natl. Acad. Sci. USA93:4137–4141.
12. Erlwein, O., P. D. Bieniasz, and M. O. McClure.1998. Sequences inpolare required for transfer of human foamy virus-based vectors. J. Virol.72:5510– 5516.
13. Flu¨gel, R. M.1991. Spumaviruses: a group of complex retroviruses. J. Ac-quired Immune Defic. Syndr. Hum. Retrovirol.4:739–750.
14. Hatfield, D. L., J. G. Levin, A. Rein, and S. Oroszlan.1992. Translation suppression in retroviral gene expression. Adv. Virus Res.41:193–239. 15. Heinkelein, M., M. Schmidt, N. Fischer, A. Moebes, D. Lindemann, J.
Enssle, and A. Rethwilm.1998. Characterization of acis-acting sequence in the Pol region required to transfer human foamy virus vectors. J. Virol. 72:6307–6314.
16. Hu, J., and C. Seeger.1996. Expression and characterization of hepadnavirus reverse transcriptases. Methods Enzymol.275:195–208.
17. Hu, J., and C. Seeger.1996. Hsp90 is required for the activity of a hepatitis B virus reverse transcriptase. Proc. Natl. Acad. Sci. USA93:1060–1064. 18. Hu, J., D. O. Toft, and C. Seeger.1997. Hepadnavirus assembly and reverse
transcription require a multi-component chaperone complex which is incor-porated into nucleocapsids. EMBO J.16:59–68.
19. Hu, S. C., D. L. Court, M. Zweig, and J. G. Levin.1986. Murine leukemia viruspolgene products: analysis with antisera generated against reverse transcriptase and endonuclease fusion proteins expressed inEscherichia coli. J. Virol.60:267–274.
20. Hwang, W. L., and T. S. Su.1998. Translational regulation of hepatitis B virus polymerase gene by termination-reinitiation of an upstream minicistron in a length-dependent manner. J. Gen. Virol.79:2181–2189.
21. Jacks, T.1990. Translational suppression in gene expression in retroviruses and retrotransposons, p. 93–124.InR. Swanstrom and P. K. Vogt (ed.), Retroviruses; strategies of replication, 1st ed. Springer-Verlag, Berlin, Ger-many.
22. Karacostas, V., E. J. Wolffe, K. Nagashima, M. A. Gonda, and B. Moss.1993. Overexpression of the HIV-1 gag-pol polyprotein results in intracellular activation of HIV-1 protease and inhibition of assembly and budding of virus-like particles. Virology193:661–671.
23. Ko¨gel, D., M. Aboud, and R. M. Flu¨gel.1995. Molecular biological charac-terization of the human foamy virus reverse transcriptase and ribonuclease H domains. Virology213:97–108.
24. Ko¨gel, D., M. Aboud, and R. M. Flu¨gel.1995. Mutational analysis of the reverse transcriptase and ribonuclease H domains of the human foamy virus. Nucleic Acids Res.23:2621–2625.
25. Konvalinka, J., M. Lo¨chelt, H. Zentgraf, R. M. Flu¨gel, and H. G. Kra¨usslich. 1995. Active foamy virus proteinase is essential for virus infectivity but not for formation of a Pol polyprotein. J. Virol.69:7264–7268.
26. Liu, W. T., T. Natori, K. S. Chang, and A. M. Wu.1977. Reverse transcrip-tase of foamy virus. Purification of the enzymes and immunological identi-fication. Arch. Virol.55:187–200.
27. Lo¨chelt, M., and R. M. Flu¨gel.1996. The human foamy viruspolgene is expressed as a Pro-Pol polyprotein and not as a Gag-Pol fusion protein. J. Virol.70:1033–1040.
28. Moebes, A., J. Enssle, P. D. Bieniasz, M. Heinkelein, D. Lindemann, M. Bock, M. O. McClure, and A. Rethwilm.1997. Human foamy virus reverse transcrip-tion that occurs late in the viral replicatranscrip-tion cycle. J. Virol.71:7305–7311. 29. Parks, W. P., G. J. Todaro, E. M. Scolnick, and S. A. Aaronson.1971. RNA
dependent DNA polymerase in primate syncytium-forming (foamy) viruses. Nature229:258–260.
30. Pfrepper, K. I., H. R. Rackwitz, M. Schno¨lzer, H. Heid, M. Lo¨chelt, and R. M. Flu¨gel.1998. Molecular characterization of proteolytic processing of the Pol proteins of human foamy virus reveals novel features of the viral protease. J. Virol.72:7648–7652.
31. Pollack, J. R., and D. Ganem.1993. An RNA stem-loop structure directs hepatitis B virus genomic RNA encapsidation. J. Virol.67:3254–3263. 32. Pollack, J. R., and D. Ganem.1994. Site-specific RNA binding by a hepatitis
B virus reverse transcriptase initiates two distinct reactions: RNA packaging and DNA synthesis. J. Virol.68:5579–5587.
33. Rethwilm, A., G. Darai, A. Rosen, B. Maurer, and R. M. Flu¨gel.1987. Molecular cloning of the genome of human spumaretrovirus. Gene59:19–28. 34. Stewart, L., and V. M. Vogt.1991.trans-acting viral protease is necessary and sufficient for activation of avian leukosis virus reverse transcriptase. J. Virol. 65:6218–6231.
35. Swanstrom, R., and J. W. Wills.1997. Synthesis, assembly, and processing of viral proteins, p. 263–334.InJ. Coffin, S. Hughes, and H. Varmus (ed.), Retroviruses, 1st ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
36. Vogt, V. M., and M. N. Simon.1999. Mass determination of Rous sarcoma virus virions by scanning transmission electron microscopy. J. Virol.73:7050– 7055.
37. Wang, G. H., and C. Seeger.1993. Novel mechanism for reverse transcription in hepatitis B viruses. J. Virol.67:6507–6512.
38. Whitehorn, E. A., E. Tate, S. D. Yanofsky, L. Kochersperger, A. Davis, R. B. Mortensen, S. Yonkovich, K. Bell, B. Dower, and R. W. Barrett.1995. A
on November 9, 2019 by guest
http://jvi.asm.org/
generic method for expression and use of “tagged” soluble versions of cell surface receptors. Bio/Technology13:1215–1219.
39.Wu, X., H. Liu, H. Xiao, J. A. Conway, E. Hehl, G. V. Kalpana, V. Prasad, and J. C. Kappes.1999. Human immunodeficiency virus type 1 integrase protein promotes reverse transcription through specific interactions with the nucleoprotein reverse transcription complex. J. Virol.73:2126–2135. 40. Yu, S. F., D. N. Baldwin, S. R. Gwynn, S. Yendapalli, and M. L. Linial.1996.
Human foamy virus replication: a pathway distinct from that of retroviruses and hepadnaviruses. Science271:1579–1582.
41. Yu, S. F., and M. L. Linial.1993. Analysis of the role of thebelandbetopen reading frames of human foamy virus by using a new quantitative assay. J. Virol.67:6618–6624.
42. Yu, S. F., M. D. Sullivan, and M. L. Linial.1999. Evidence that the foamy virus genome is DNA. J. Virol.73:1565–1672.
on November 9, 2019 by guest
http://jvi.asm.org/
