Copyright © 1997, American Society for Microbiology
Cloning of the Rainbow Trout (Oncorhynchus mykiss) Mx2 and
Mx3 cDNAs and Characterization of Trout Mx Protein
Expression in Salmon Cells
GRANT D. TROBRIDGE, PINWEN P. CHIOU,
ANDJO-ANN C. LEONG*
Department of Microbiology and Center for Salmon Disease Research,
Oregon State University, Corvallis, Oregon 97331-3804
Received 26 November 1996/Accepted 11 March 1997
Two rainbow trout (Oncorhynchus mykiss) Mx cDNAs were cloned by using RACE (rapid amplification of
cDNA ends) PCR and were designated RBTMx2 and RBTMx3. The deduced RBTMx2 and RBTMx3 proteins
were 636 and 623 amino acids in length with molecular masses of 72 and 70.8 kDa, respectively. These proteins,
along with the previously described RBTMx1 protein (G. D. Trobridge and J. A. Leong, J. Interferon Cytokine
Res. 15:691–702, 1995), have between 88.7 and 96.6% identity at the amino acid level. All three proteins contain
the tripartite GTP binding domain and leucine zipper motif common to Mx proteins. A monospecific polyclonal
antiserum to an Escherichia coli-expressed fragment of RBTMx3 was generated, and that reagent was found to
react with all three rainbow trout Mx proteins. Subsequently, endogenous Mx production in RTG-2 cells
induced with poly(IC) double-stranded RNA was detected by immunoblot analysis. The cellular localization of
the rainbow trout proteins was determined by transient expression of the RBTMx cDNAs in CHSE-214
(chinook salmon embryo) cells. A single-cell transient-transfection assay was used to examine the ability of
each Mx cDNA clone to inhibit replication of the fish rhabdovirus infectious hematopoietic necrosis virus
(IHNV). No significant inhibition in the accumulation of the IHNV nucleoprotein was observed in cells
expressing either trout Mx1, Mx2, or Mx3 in transiently transfected cells.
Mx proteins comprise a class of interferon (IFN)-inducible
proteins responsible for virus resistance in vertebrate cells.
Following IFN induction, Mx proteins accumulate
intracellu-larly to levels as high as 1% of the total cytoplasmic protein
(15). The Mx proteins are located in the nucleus and/or
cyto-plasm, and for some Mx proteins, specific antiviral activity has
been associated with their expression (3, 31). For example,
specific antiviral activity of murine Mx2, rat Mx2, and human
MxA against the rhabdovirus vesicular stomatitis virus has
been demonstrated (20, 26, 36, 37). The nuclear murine Mx1
inhibits the orthomyxoviruses influenza virus (32), Dhori virus
(34), and Thogoto virus (12), while the cytoplasmic human
MxA inhibits replication of influenza virus (17, 25, 26) and
Thogoto virus (10) but not Dhori (10). The human MxA also
has antiviral activity against the measles paramyxovirus (30)
and bunyavirus, phlebovirus, and hantavirus (11). These
vi-ruses replicate very differently in the cell, and one of the major
questions researchers have asked is how each Mx protein
ex-erts its specific antiviral effect.
The Mx proteins range in size from 70 to 80 kDa and contain
a tripartite GTP binding domain (6) which is essential to their
antiviral activity (23, 27). Close to the carboxyl-terminal end is
a leucine zipper motif (22). The leucine zipper of murine Mx1
is thought to mediate the aggregation of murine Mx1 into
dimers and trimers. There are Mx proteins such as the human
MxB (10, 26) and the avian Mx (4, 5) proteins which have no
defined antiviral activity observed to date. Further, the
homol-ogy of Mx proteins to other GTPases not directly involved with
viral defense, such as the yeast vacuolar sorting protein (29),
and to dynamins (7, 24) has led to the question of whether Mx
proteins may play some other role in the cell in addition to
inhibition of viral replication. Mx genes have been cloned from
diverse vertebrate species, such as humans (1, 16), rodents (19,
32), fish (33, 35), and birds (4, 5). In this paper we report the
cloning of two additional Mx genes from rainbow trout and a
preliminary study of their function against the trout pathogen
infectious hematopoietic necrosis virus (IHNV).
MATERIALS AND METHODS
Cell lines and viruses.The chinook salmon embryo (CHSE-214) and rainbow trout gonad (RTG-2) cell lines used for propagating IHNV and producing mRNA were obtained from J. L. Fryer, Oregon State University, Corvallis. The cells were grown as monolayers in minimal essential medium (MEM) (Gibco-BRL, Gaithersburg, Md.) supplemented with 10% fetal bovine serum (FBS) and
2 mML-glutamine. For virus propagation, CHSE-214 cells were supplemented
with 5% FBS, 2 mML-glutamine, 14 mM HEPES
(N-2-hydroxyethylpiperazine-N9-ethanesulfonic acid) (pH 7.8), 100 IU of penicillin G per ml, 100mg of
streptomycin per ml, and 0.25mg of amphotericin B per ml. The IHNV used in
this study was isolated in 1975 from an adult steelhead trout at the Round Butte Hatchery in Oregon. The chinook cells were infected with IHNV at a multiplicity of infection (MOI) of 0.001 and incubated at 16°C for 7 days. At that time the
supernatant was harvested, centrifuged at 2,5003g for 10 min at 4°C, and then
filtered through a Gelman (Ann Arbor, Mich.) 0.22-mm low protein binding
filter. The cell-free supernatant contained 7.5310650% tissue culture infective
doses of virus per ml.
Cloning of the rainbow trout Mx2 and Mx3 cDNAs.The RACE (rapid am-plification of cDNA ends) method used to obtain the Mx2 and Mx3 cDNA clones has been described in detail previously (35). Briefly, after use of PCR to obtain
both the 59and 39ends of each RBTMx cDNA, primers were directed to the 59
and 39noncoding regions to amplify the complete Mx1 (59 primer, ME 254
[59GCATCAGATAGCAGAAAATC39]; 39primer, ME 158 [59TGAACTGAG
ATCACAGAATCTAC]), Mx2 (59primer, ME 257 [59TGCAGTTGCAGTGT
ATTAACC39]; 39primer, ME 253 [59CCATTAACCAACCTATCTGAAG39]),
and Mx3 (59primer, ME 199 [59TTATCAGAGAGCAGGACACT39]; 39primer,
ME 197 [59TGAATATGTTGTTATCCTCC39]) open reading frames (ORFs).
To improve PCR fidelity, reactions were performed with reduced final concen-trations of 2.5 mM magnesium, 100 mM deoxynucleoside triphosphates, and 1 U
of Taq DNA polymerase in a total reaction volume of 50ml. The denaturing,
annealing, and extension times were reduced to 1, 1.5, and 1.5 min, respectively. The number of cycles was reduced from 35 to 30, the minimum necessary to obtain enough product for subsequent cloning.
The PCR products were cloned into the Invitrogen (San Diego, Calif.) PCRIII TA cloning vector according to the manufacturer’s protocols. This vector con-tains the cytomegalovirus (CMV) immediate-early promoter with transcription
* Corresponding author.
5304
on November 9, 2019 by guest
http://jvi.asm.org/
termination and polyadenylation signals from the bovine growth hormone gene.
Theb-galactosidase construct, with theb-galactosidase gene inserted into the
pcDNA3 vector (Invitrogen), was used as a control throughout the experiment. This vector also contains the CMV immediate-early promoter and bovine growth hormone polyadenylation and transcriptional termination signals. Plasmid prep-arations for sequencing and for transfection were purified with Qiagen (Chats-worth, Calif.) plasmid preparation columns and reagents.
Nucleotide sequence analysis of trout Mx cDNAs.DNA sequence analysis was performed at the Oregon State University Center for Gene Research and Bio-technology Central Services facility on an Applied Biosystems 373A DNA se-quencer by using the Taq dideoxy terminator cycle sequencing kit with AmpliTaq (Perkin-Elmer, Norwalk, Conn.). Both strands of each clone were sequenced. The deduced Mx protein sequences were aligned with minor adjustment of the Clustal V program (14) from the Genetics Data Environment set of sequence manipulation programs developed by Steven Smith (University of Illinois and Harvard University). Sequences were compared by using the Bestfit (9) program in the Genetics Computer Group set of programs.
The RBTMx2 clone contained the AAUAAA polyadenylation signal 14 nu-cleotides (nt) upstream of the poly(A) tail and a potential alternate ACUAAA polyadenylation signal 58 nt upstream of the poly(A) tail. The RBTMx3 clone contained a nonoptimal AAUUAA poly(A) signal 12 nt upstream of the poly(A) tail. The human Mx B gene has been shown to use an alternative polyadenylation site (1), and we have previously seen a variation in transcript size over time with poly(IC) induction of Mx mRNA (35).
In vitro transcription and translation of RBTMx1, -2, and -3.The RBTMx1, RBTMx2, and RBTMx3 cDNA clones were analyzed in a Promega (Madison, Wis.) TnT T7/SP6 coupled reticulocyte lysate translation system. One microgram of each plasmid DNA, along with a negative control of TE buffer (10 mM Tris-Cl [pH 8], 1 mM EDTA [pH 8]) used to resuspend the DNA samples, was added to
the kit components according to the manufacturer’s protocols, and then 4ml of
[35S]methionine (10 mCi/ml) (Amersham, Arlington Heights, Ill.) was added to
each reaction mixture. The coupled transcription-translation reaction mixture was incubated at 30°C for 2 h, mixed with an equal volume of sodium dodecyl sulfate (SDS) sample buffer (125 mM Tris hydrochloride [pH 6.8], 2% SDS, 10%
glycerol, and 5% 2-mercaptoethanol), and boiled for 3 min. A 15-ml portion of
sample in SDS running buffer was analyzed on an SDS–12.5% polyacrylamide gel with a 5% stacking gel. An autoradiogram of the gel was made and scanned with a Molecular Dynamics densitometer by using Imagequant software.
Preparation of rainbow trout Mx antibodies. (i) Fusion protein construction.
A polyclonal antiserum to a fragment of the rainbow trout Mx3 protein expressed in Escherichia coli was generated by using the Qiaexpress (Qiagen) histidine tag system. A trout Mx fragment was generated with PCR primers containing SphI and BglII ends compatible with the pQE-70 prokaryotic expression vector
(Qia-gen). The forward primer ME 224 (59TAGGCATCCTGACCAAGCCTGAC39)
and the reverse primer ME 246 (59ACCATATCTTTCCAGCTCGGCATG39),
with engineered SphI and BglII restriction sites, respectively, were used to PCR amplify a DNA fragment encoding a 114-amino-acid (114-aa) fragment corre-sponding to aa 209 to 323 of RBTMx3 (Genbank accession number OMU47946). A standard PCR was run for 25 cycles, and the resulting PCR product was cloned into the TA cloning kit PCRII vector. The SphI-to-BglII fragment was then subcloned into the pQE-70 expression vector and transformed into E. coli M15 cells according to the Qiaexpress protocols. A positive clone, designated PQE-MX7, was identified by restriction digestion of plasmid DNA. The protein ex-pression clone was confirmed by small-scale induction of protein according to the manufacturer’s protocol and by direct DNA sequence analysis.
(ii) Production of fusion proteins.Purified rainbow trout Mx fusion protein was prepared according to the Qiaexpress protocol for large-scale purification of insoluble proteins. Briefly, cells containing the clone PQE-MX7 were grown in
large scale and induced with IPTG (isopropyl-b-D-thiogalactopyranoside). The
RBTMx fusion protein was purified by loading onto a nickel-nitrilotriacetic acid column and eluting through a pH gradient of guanidine hydrochloride buffer. Fractions containing the fusion protein were pooled and dialyzed overnight in phosphate-buffered saline (PBS) (137 mM NaCl, 2.7 mM KCl, 4.3 mM
Na2HPO4z7H2O, 1.4 mM KH2PO4). The purified protein was analyzed by gel
electrophoresis in an SDS–10% polyacrylamide gel followed by Coomassie blue staining.
(iii) Immunizations and antiserum purification.Purified Mx recombinant protein in 2 ml of PBS at 1.4 mg/ml was emulsified 1:1 with Freund’s complete adjuvant and injected subcutaneously into two New Zealand White female rab-bits. Both rabbits were boosted subcutaneously at 4, 6, and 10 weeks with 1 ml of protein (0.7 mg/ml) emulsified 1:1 in Freund’s incomplete adjuvant. Blood was collected and allowed to form a clot overnight at 4°C before the serum was collected. Subsequently, 5 ml of serum was adsorbed sequentially to two
CHSE-214 monolayers in 150-cm2tissue culture flasks. The adsorbed serum was further
purified from nonimmunoglobulin proteins by using a protein A absorption kit (Immunopure IgG kit; Pierce, Rockford, Ill.) according to the manufacturer’s instructions.
Western blot analysis of Mx antisera.For in vitro analysis of RTG-2 Mx proteins, confluent monolayers of RTG-2 cells in six-well tissue culture plates
were treated either with 50mg of poly(IC) double-stranded RNA (dsRNA)
(Pharmacia, Piscataway, N.J.) per ml in MEM or with PBS. At 48 h
postinduc-tion, cells in control and induced wells were lysed in 200ml of SDS sample buffer
and boiled for 3 min, and 15ml of each sample was loaded per lane. Samples
were electrophoresed in an SDS–10% polyacrylamide gel, and the separated proteins were transferred to a nitrocellulose membrane. The membrane was then incubated in 25 ml of polyclonal rabbit anti-RBTMx at a 1:200 dilution of 1 mg of immunoglobulin G purified antibody per ml in Tris-buffered saline (TBS) (100 mM Tris-Cl [pH 7.5], 0.15 mM NaCl) with 1% bovine serum albumin and 0.02% Tween 20 for 1 h. The membrane was washed four times with 100 ml of TBS with 1% bovine serum albumin and 0.02% Tween 20. The membrane was then incubated with a 1:2,000 dilution of 2 mg of goat anti-rabbit–alkaline phospha-tase (Promega) per ml in TBS–0.02% Tween 20 for 1 h. The membrane was washed four times in 100 ml of TBS–0.02% Tween 20 and incubated in 5-bromo-4-chloro-3-indolylphosphate–nitroblue tetrazolium alkaline phosphatase sub-strate with the Kierkegaard-Perry (Gaithersburg, Md.) One Step detection kit.
Transfection and immunofluorescence detection. (i) Transfection.CHSE-214 cells were plated at approximately 70 to 80% confluency on eight-chamber Supercell (Fisher, Philadelphia, Pa.) multiwell slides and allowed to attach over-night. Cell monolayers were washed twice in Optimem (Gibco-BRL) before
transfection. One microgram of RBTMx1, RBTMx2, RBTMx3, orb
-galactosi-dase control plasmid DNA in the PCRIII vector was mixed with 200ml of
Optimem and then mixed with 200ml of Optimem containing 9ml of
Lipo-fectamine (Gibco-BRL). The 400-ml mixture was then incubated at room
tem-perature for 1 h before Optimem was added to a final volume of 2 ml. The transfection mixture was then put on the monolayers of CHSE-214 cells at 0.2 ml
per 1-cm2well and incubated at 17°C overnight. Following transfection, the
monolayers were washed twice in MEM with 5% FBS, 100 IU of penicillin per
ml, and 100mg of streptomycin per ml and incubated for 3 days before challenge
with IHNV.
(ii) Infection with IHNV and immunofluorescence staining.The transfected monolayers were infected with IHNV (RB-1) at an MOI of 0.1, 1, or 10 and incubated at 17°C. Sets of control (either transfected and uninfected or untrans-fected and inuntrans-fected) cells were also incubated at 17°C. At 20 h postinfection the monolayers were washed in 0.2 ml of ice-cold PBS and fixed for 20 min with 0.5 ml of freshly prepared 3% paraformaldehyde in PBS. The cells were then per-meabilized with 0.5 ml of 0.1% Triton X-100 for 10 min, followed by one wash in PBS. The monolayers were blocked with 5% nonfat dry milk in PBS for 30 min. Primary antibody incubations were carried out for 1 h with (per chamber) 0.2 ml of either 1-mg/ml rabbit anti-RBTMx diluted 1:500 or 2-mg/ml rabbit
anti-b-galactosidase (Cappel, Durham, N.C.) diluted 1:1,000 and mouse
anti-IHNV N protein monoclonal antibody 14D (28) at 1:1,000. The cells were then washed three times for 5 min each and incubated with the secondary antibodies. The secondary antibodies were goat anti-rabbit–Texas Red at 2 mg/ml (Molec-ular Probes, Eugene, Oreg.) diluted 1:2,000 and goat anti-mouse–fluorescein (Molecular Probes) at 2 mg/ml diluted 1:1,000. Following staining, the slides were briefly air dried, treated with Slow Fade (Molecular Probes), and mounted with Cytoseal (Stephens Scientific, Riverdale, N.J.). Slides were visualized on a fluorescence microscope with a triple-bandpass filter (Omega Optical). Confocal microscope images were captured with a Leica TCS4 confocal microscope and compiled with Adobe (Mountain View, Calif.) Photoshop software.
Nucleotide sequence accession number.The rainbow trout Mx2 and Mx3
se-quences including the 59and 39noncoding regions (RBTMx2 and RBTMx3) have
been deposited in GenBank with accession no. OMU47945 and OMU47946, re-spectively.
RESULTS
Cloning of the rainbow trout Mx2 and Mx3 cDNAs.
In order
to improve the fidelity of PCR over that for our original RACE
clones (35), some of which had interrupted ORFs, we modified
the PCR amplification of the reverse-transcribed mRNA. The
modified PCR procedure resulted in cDNA clones whose
se-quence differences were reduced by approximately threefold
and which were longer than the original cDNA clones. Clones
containing contiguous full-length ORFs of RBTMx1 and
RBTMx3 were obtained and used for transfection analyses
of antiviral activity. Two complete clones for each of the
RBTMx2 and RBTMx3 ORFs were sequenced along with
other overlapping 5
9
and 3
9
clones to give consensus cDNA
sequences for each gene from four clones.
One full-length clone for RBTMx1, called R1B1, and one
full-length clone for RBTMx3, called R3B5, were chosen for
subsequent analyses. The two full-length RTGMx2 clones, R2A2
and R2B1, contained different interrupted ORFs, presumably
from PCR amplification, so a contiguous RBTMx2 clone was
constructed by replacing a 1.3-kb AccI-to-HpaI interrupted
ORF fragment from R2B1 with its R2A2 uninterrupted
coun-terpart. The construction of this repaired RBTMx2 clone,
on November 9, 2019 by guest
http://jvi.asm.org/
RBTMx2rep, was confirmed by restriction digestion, and the
AccI and HpaI ligation sites were checked by DNA sequencing.
The RBTMx1 and RBTMx3 full-length expression clones
dif-fered from the consensus sequences deposited in GenBank at
the following locations: the RBTMx1 clone has a serine in
place of a glycine at aa 238, and the RBTMx3 expression clone
R3B5 has a proline residue in place of a leucine at aa 165.
These point mutations were considered to be reverse
transcrip-tion errors, PCR errors, or allelic differences. Mutatranscrip-tional
anal-yses of the murine Mx1 protein have suggested that Mx
pro-teins are refractory to point mutations in these regions (21),
and these clones were thus judged to be suitable for
transfec-tion assay.
Sequence analysis of the RBTMx2 and RBTMx3 cDNA
clones.
The alignment of the ORFs from rainbow trout Mx1,
Mx2, and Mx3 are given in Fig. 1. All three Mx proteins
contain the characteristic tripartite GTP binding domain
com-mon to all Mx proteins. In addition, the putative leucine zipper
repeats reported for RBTMx1 were also found in RBTMx2
and RBTMx3. Potential glycosylation signals were found in all
three Mx proteins, and their positions are shown in Fig. 1.
Neither N- nor O-linked glycosylation has been reported for
murine Mx1 (22), despite the presence of two potential
N-linked sites. We did not investigate whether the trout Mx
proteins were glycosylated. The trout Mx proteins have
ap-proximately 50% identity with other Mx proteins at the amino
acid level, with the highest conservation of sequence in the
amino-terminal half (35). Table 1 shows the sizes of the cDNA
transcripts (without polyadenylation), the deduced lengths and
molecular weights of the proteins, and their percent identities
at the nucleotide and amino acid levels.
In vitro transcription-translation of rainbow trout Mx
cDNAs.
The size of each trout Mx protein was analyzed by
using a coupled in vitro transcription-translation system (Fig.
2). The presence of a major product of approximately 70 kDa
in each lane confirmed that each cDNA clone was able to
express a full-size protein. No proteins were produced in the
negative control lane containing a sample from a
transcription-translation reaction with only TE buffer. The in
vitro-trans-lated products ran at approximately 71, 69, and 72 kDa, in
close agreement with the predicted sizes of 70.6, 72, and 70.8
kDa for RBTMx1, RBTMx2, and RBTMx3, respectively.
Production of antiserum to rainbow trout proteins.
A
poly-clonal antiserum to the rainbow trout proteins was generated
with a fragment of rainbow trout Mx3 protein. This fragment
was chosen to be in a region where the sequences of the three
RBTMx proteins were highly conserved. Care was taken to
exclude the GTP binding region, where Mx proteins have
strong homologies with other GTP binding proteins. The
114-aa rainbow trout Mx3 fragment differed by only 1 aa from
RBTMx1 and by 9 aa from RBTMx2. These differences were
clustered near the carboxyl end of the fragment. The protein
fragment antigen was thus designed to generate an antiserum
that would react with all three rainbow trout Mx proteins and
not cross-react with other GTP binding proteins. The
PCR-generated fragment was expressed in the pQE-70
histidine-tagged vector and purified by using a nickel-nitrilotriacetic acid
column. The resulting purified fusion protein used for the
immunization is shown in Fig. 3A.
Western blot analysis of poly(IC)-induced rainbow trout Mx
proteins.
The specificity of the antiserum was tested by
induc-ing the RTG-2 fish cell line with poly(IC) dsRNA for 48 h and
performing Western blotting on the induced and control
ex-tracts. Figure 3B shows the presence of a large unique band of
approximately 70 kDa in the RTG-2 poly(IC)-induced extracts.
The size of this protein band corresponded to that obtained
by in vitro translation of transcripts of the cloned trout Mx
cDNAs.
Transfection analyses of trout Mx protein localization.
The
rainbow trout Mx1, -2, and -3 proteins were expressed in
CHSE-214 cells to (i) determine the localization of Mx
expres-sion within the cell and (ii) determine if trout Mx expresexpres-sion
would confer protection against a well-characterized fish
rhab-dovirus, IHNV. We chose to express the RBTMx cDNA clones
under the control of the CMV immediate-early promoter
be-cause this promoter-enhancer had been found previously to
work very efficiently in fish cells (2, 13). Figure 4 shows the
intracellular localization of all three rainbow trout Mx
pro-teins. Confocal microscopy of a section through the nucleus
was used to confirm the subcellular location of each trout Mx
protein. Cells expressing transfected RBTMx1 exhibited
cyto-plasmic staining in a large globular pattern surrounding the
nucleus. Long string-like patterns of staining were also
ob-served in a few cells. The predominant pattern obob-served for
RBTMx2 was highly punctate staining of the nucleus. In some
cells, the punctate staining was observed in both the cytoplasm
and the nucleus. Rainbow trout Mx3 was expressed strictly in
the cytoplasm. The staining pattern for RBTMx3 differed from
that for RBTMx1 in that it was found throughout the
cyto-plasm as uniform, diffuse staining.
Trout Mx proteins do not inhibit viral nucleoprotein
expres-sion in IHNV-infected cells.
In order to determine if any of the
rainbow trout Mx proteins conferred protection against the fish
rhabdovirus IHNV, double-label immunofluorescence studies
were performed. In this assay, transiently transfected
CHSE-214 cells expressing one of the three Mx proteins were infected
with IHNV. Cells expressing the transfected Mx protein were
detected with Texas Red-labeled antibody, and cells infected
with IHNV were detected with fluorescein-labeled antibody to
the viral N protein. A
b
-galactosidase construct was also used
as a negative control to demonstrate that any virus resistance
was not due to the transfection procedure. This double-label,
single-cell assay was similar in design to the experimental
pro-cedures used by previous investigators (5, 21, 32) to assess
antiviral activity of Mx proteins. At 17°C, the viral N protein
was detectable in the cytoplasm at 15 h postinfection and
increased in the cytoplasm to 24 h postinfection (data not
shown). Transfected CHSE-214 cells were fixed and stained at
18 h postinfection.
At an MOI of 10, greater than 90% of the monolayer
ex-hibited strong staining for the IHNV N protein. Figure 5 shows
the typical staining patterns observed for cells expressing both
Mx protein and IHNV N protein. All of the transfected cells in
the 1-cm
2transfection were scored as positive or negative for
IHNV N expression as evidenced by fluorescein staining, and
the results are shown in Table 2. The rainbow trout Mx
pro-teins did not appear to confer a high degree of resistance to
IHNV in CHSE-214 cells.
DISCUSSION
The RBTMx1, RBTMx2, and RBTMx3 proteins of rainbow
trout have approximately 50% identity with other Mx proteins
and contain the characteristic GTP binding domain and
leucine zipper motif common to this protein family. In
addi-tion, trout Mx proteins were also tightly regulated by IFN as
demonstrated by their response to poly(IC) dsRNA and viral
infection in vitro and in vivo. Injection of poly(IC) and IHNV
infection of rainbow trout resulted in the production of two
distinct mRNA transcripts in the liver (33, 35). The cDNA
sequence lengths reported here suggested that the large,
ap-proximately 2.9-kb transcript may be the polyadenylated form
on November 9, 2019 by guest
http://jvi.asm.org/
of the 2.6-kb Mx1, while the smaller, 2.6-kb transcript band was
comprised of the polyadenylated RBTMx2 and RBTMx3, both
of which are 2.1 kb in size.
The high degree of sequence identity (96.6%) between
RBTMx1 and RBTMx3 suggested that these cDNAs might
have been derived from different alleles of the same gene.
[image:4.612.98.513.73.592.2]However, the divergence of the 5
9
and 3
9
noncoding regions
and the difference in amino acid length strongly suggested that
these cDNAs were derived from separate genes. Although
both of these proteins are found in the cytoplasm, they exhibit
very different staining patterns. Further, restriction fragment
length polymorphism analysis of inbred trout lines by using a
FIG. 1. Amino acid sequences of rainbow trout Mx1, Mx2, and Mx3. The amino acid ORFs from RBTMx1, RBTMx2, and RBTMx3 as deduced from the cDNA sequences (GenBank accession numbers U30253 [RBTMx1], OMU47945 [RBTMx2], and OMU47946 [RBTMx3]) are shown. The tripartite GTP binding domains of the Mx proteins are underlined. The putative leucine zipper repeats are boxed, and the potential N-linked glycosylation sites are marked with asterisks. Sequence identity is represented by dots, and sequence gaps are represented by dashes.
on November 9, 2019 by guest
http://jvi.asm.org/
single exon probe (data not shown) suggested that there are at
least three Mx genes. Similar analyses of inbred lines of rats
were used to determine that the rat Mx2 and Mx3 proteins,
which are 98.8% identical, were derived from separate genes
(20).
The sizes of the in vitro-translated Mx proteins
corre-sponded well to the sizes predicted from the sequence data and
to those of the induced endogenous RTG-2 protein(s)
de-tected by Western blot analysis. The antiserum produced to the
RBTMx3 fragment was able to detect a broad 70-kDa band
among the proteins of induced RTB-2 cells and distinct trout
Mx proteins in SDS gels of lysates from transfected cells.
The three different trout Mx proteins were localized in
trans-fected cells with an antiserum made to an RBTMx3 fusion
protein. Confocal microscopy localized RBTMx1 in the
cyto-plasm in perinuclear globular and stringlike aggregations,
RBTMx2 was found in the nucleus with distinctive punctate
staining, and RBTMx3 was found in the cytoplasm with diffuse
staining. Occasionally, RBTMx2 was found in the cytoplasm,
and its presence there may be an indication of its cytoplasmic
synthesis prior to its transit into the nucleus. Since these
stud-ies were carried out with cells transfected for 92 h prior to
staining, it was not possible to determine whether there was a
kinetic relationship between the cytoplasmic and nuclear
RBTMx2 proteins. The intracellular location of RBTMx2 is
very similar to that of duck Mx proteins, which are also found
in both the nucleus and cytoplasm (4).
There are no known Mx-negative fish cells; however, we
have previously shown that CHSE-214 cells have a delayed
response to poly(IC) induction of Mx mRNA (35), and other
investigators have demonstrated poor induction of antiviral
activity by poly(IC) dsRNA in CHSE-214 cells (18). For these
reasons, and because transfection protocols have been
[image:5.612.331.537.67.227.2]estab-lished for this cell line (2), we used CHSE-214 cells to examine
the antiviral activity of transient, constitutive expression of Mx
rainbow trout proteins. Mammalian Mx-positive COS cells
have been used successfully for transient-transfection analyses
FIG. 2. Coupled in vitro transcription-translation analyses of full-length trout Mx cDNA clones. One microgram of plasmid DNA for each trout Mx clone was analyzed by using a coupled transcription-translation system with35S-labeled
[image:5.612.316.559.413.678.2]methionine and analyzed by SDS-polyacrylamide gel electrophoresis in a 12.5% gel. Lane C, negative control of TE buffer used to resuspend the plasmid DNA; lanes 1, 2, and 3, samples from reaction mixtures containing transcripts of full-length clones RBTMx1, RBTMx2, and RBTMx3, respectively.
FIG. 3. Detection of trout Mx protein in vitro with a polyclonal antiserum generated to a recombinant trout Mx fragment. (A) Coomassie blue-stained 10% polyacrylamide gel of purified Mx antigen used for the generation of rabbit polyclonal anti-trout Mx. Lane M, prestained broad-range protein molecular mass markers; lane MxF, purified 114-aa fragment used for immunization after histidine tag purification and dialyzation of the E. coli lysate. (B) Western blot analysis of poly(IC) dsRNA induction of RTG-2 Mx proteins with the immuno-globulin G purified polyclonal rabbit anti-Mx serum. Cell extracts were electro-phoresed in an SDS–10% polyacrylamide gel, transferred to nitrocellulose, and detected with the monospecific polyclonal rabbit anti-trout Mx. Lane C, mock-induced control cells 48 h postinduction; lane pIC, cells 48 h postinduction with poly(IC) dsRNA.
FIG. 4. Localization of transfected trout Mx protein in CHSE-214 cells.
CHSE cells were transfected with either a CMV–b-galactosidase construct or
CMV-RBTMx1, -RBTMx2, or -RBTMx3. The b-galactosidase (Beta
Gal)-stained cells produced a diffuse cytoplasmic staining (data not shown). The antibody bound to expressed trout Mx proteins was stained red with Texas Red-conjugated antibody. Equatorial confocal images were captured through the nucleus.
TABLE 1. Comparison of rainbow trout Mx cDNA clones
Clone Transcriptlength
(nt)
Deduced ORF
(aa) Mol wt
% Identityawith:
RBTMx1 RBTMx2 RBTMx3
RBTMx1 2,514 621 70,600 88.7 (aa) 96.6 (aa)
RBTMx2 2,089 636 72,000 90.9 (nt) 88.2 (aa)
RBTMx3 2,113 623 70,800 96.2 (nt) 90.6 (nt)
aPercent identities at the nucleotide (nt) and amino acid (aa) levels were
calculated after pairwise alignment of the Mx cDNA sequences by using the Bestfit program of the Genetics Computer Group software package.
on November 9, 2019 by guest
http://jvi.asm.org/
[image:5.612.127.230.553.666.2]FIG. 5. Double-label immunofluorescence detection of Mx-transfected cells infected with IHNV. CHSE-214 cells were transfected transiently with CMV-RBTMx1,
-RBTMx2, -RBTMx3, or the control CMV–b-galactosidase (Beta Gal) for 72 h and then infected with IHNV at an MOI of 10. After 20 h, the cells were stained for
viral N protein synthesis and Mx expression. Photos were taken with a single-bandpass filter that detects fluorescein (IHNV N protein) alone (A) and with a triple-bandpass filter that detects both Texas Red (Mx protein) and fluorescein (IHNV N protein) (B). Transfected cells expressing IHNV N protein are indicated by arrows.
on November 9, 2019 by guest
http://jvi.asm.org/
of the murine Mx1 (21). This finding suggested that Mx
2/Mx
2cell lines are not critical for evaluating constitutive, transiently
expressed Mx antiviral activity. Trout Mx protein inhibited
IHNV N expression in 7.9, 8.8, and 3.4% of the RBTMx1-,
RBTMx2-, and RBTMx3-transfected cells, respectively, while
2.5% of the
b
-galactosidase-expressing cells inhibited IHNV N
accumulation. Other investigators have seen inhibition of
in-fluenza virus protein synthesis in over 90% of transfected cells
by using similar assays with the murine Mx1 (21, 32). We
conclude that the trout Mx proteins are not efficient inhibitors
of IHNV replication in salmon cells.
Studies analyzing Mx inhibition of the measles
paramyxovi-rus glycoprotein have shown that Mx can inhibit specific viral
proteins in a cell-type-specific manner. Although the trout Mx
proteins do not inhibit IHNV N protein accumulation in
CHSE-214 cells, we have not ruled out the possibility that trout
Mx proteins might interfere with IHNV replication by
specif-ically reducing other viral proteins, interfering with steps
fol-lowing viral protein synthesis, or that they may act in a
cell-type-specific manner. To date no antiviral activity has been
described for the avian Mx proteins or the human MxB
pro-tein. The function of these proteins and the trout Mx proteins
remains to be determined. However, the tight control of these
proteins by IFN and/or IFN inducers suggests they play a role
in IFN-mediated control of cellular proliferation or viral
rep-lication.
The poly(IC) dsRNA induction or viral induction of trout
Mx mRNA and protein expression occurs presumably through
IFN induction; to date there are no available fish IFN or
anti-fish IFN antibody reagents to conclusively demonstrate
IFN control. Although the trout Mx proteins did not inhibit
accumulation of nucleoprotein of the rhabdovirus IHNV,
fu-ture studies will be needed to determine if trout Mx proteins
confer resistance to other fish viruses. The effect of trout Mx
expression on the recently described orthomyxovirus infectious
salmon anemia virus (8) of Atlantic salmon (Salmo salar) will
be of specific interest. The clones and antibody reagents
de-veloped here will allow us to initiate these studies.
ACKNOWLEDGMENTS
We thank Carol Kim for assistance with the confocal microscope
and advice on experimental protocols. In addition, we thank Reg
McParland, Ann Marie Girard, and Barbara Revere of the Oregon
State University Center for Gene Research Central Facilities
Labora-tory.
This research was supported by the United States Department of
Agriculture (to the Western Regional Aquaculture Consortium) under
grant 92-38500-7195, project no. 92080441; by an Oregon Sea Grant
with funds from the National Oceanic and Atmospheric
Administra-tion, Office of Sea Grant, Department of Commerce, under grant
NA89AA-D-SG108, project R/FSD-16, and grant NA36RG451,
project R/FSD-23 and amendment no. 2; and by a grant from the
National Oceanic and Atmospheric Administration
(Saltonstall-Kennedy funds), NA46FD0490.
REFERENCES
1. Aebi, M., J. Fah, N. Hurt, C. E. Samuel, D. Thomis, L. Bazzigher, J. Pavlovic,
O. Haller, and P. Staeheli.1989. cDNA structures and regulation of two interferon-induced human Mx proteins. Mol. Cell. Biol. 9:5062–5072. 2. Anderson, E., D. V. Mourich, and J. C. Leong. 1996. Gene expression in
rainbow trout (Oncorhynchus mykiss) following intramuscular injection of DNA. Mol. Mar. Biol. 5:105–113.
3. Arnheiter, H., and E. Meier. 1990. Mx proteins: antiviral proteins by chance or by necessity? New Biol. 2:851–857.
4. Bazzigher, L., A. Schwarz, and P. Staeheli. 1993. No enhanced influenza virus resistance of murine and avian cells expressing cloned duck Mx protein. Virology 195:100–112.
5. Bernasconi, D., U. Schultz, and P. Staeheli. 1995. The interferon-induced Mx protein of chickens lacks antiviral activity. J. Interferon Cytokine Res.
15:47–53.
6. Bourne, H. R., D. A. Sanders, and F. McCormick. 1991. The GTPase super-family: conserved structure and molecular mechanism. Nature 349:117–127. 7. Chen, M. S., R. A. Obar, C. C. Schroeder, T. W. Austin, C. A. Poodry, S. C.
Wadsworth, and R. B. Vallee.1991. Multiple forms of dynamin are encoded by shibire, a Drosophila gene involved in endocytosis. Nature 351:583–586. 8. Dannevig, B. H., K. Falk, and E. Namork. 1995. Isolation of the causal virus of infectious salmon anaemia (ISA) in a long-term cell line from Atlantic salmon head kidney. J. Gen. Virol. 76:1353–1359.
9. Devereux, J., P. Haeberli, and O. Smithies. 1984. A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res. 12:387–395. 10. Frese, M., G. Kochs, U. Meier-Dieter, J. Siebler, and O. Haller. 1995.
Human MxA protein inhibits tick-borne Thogoto virus but not Dhori virus. J. Virol. 69:3904–3909.
11. Frese, M., G. Kochs, H. Feldmann, C. Hertkorn, and O. Haller. 1996. Inhibition of bunyaviruses, phleboviruses, and hantaviruses by human MxA protein. J. Virol. 70:915–923.
12. Haller, O., M. Frese, D. Rost, P. A. Nuttall, and G. Kochs. 1995. Tick-borne Thogoto virus infection in mice is inhibited by the orthomyxovirus resistance gene product Mx1. J. Virol. 69:2596–2601.
13. Hansen, E., K. Fernandes, G. Goldspink, P. Butterworth, P. K. Umeda, and
K. C. Chang.1991. Strong expression of foreign genes following direct injection into fish muscle. FEBS Lett. 290:73–76.
14. Higgins, D. G., A. J. Bleasby, and R. Fuchs. 1992. CLUSTAL V: improved software for multiple sequence alignment. Comput. Appl. Biosci. 8:189–191. 15. Horisberger, M. A. 1992. Interferon-induced human protein MxA is a GTPase which binds transiently to cellular proteins. J. Virol. 66:4705–4709. 16. Horisberger, M. A., G. K. McMaster, H. Zeller, M. G. Wathelet, J. Dellis,
and J. Content.1990. Cloning and sequence analyses of cDNAs for inter-feron- and virus-induced human Mx proteins reveal that they contain puta-tive guanine nucleotide-binding sites: functional study of the corresponding gene promoter. J. Virol. 64:1171–1181.
17. Huang, T., J. Pavlovic, P. Staeheli, and M. Krystal. 1992. Overexpression of the influenza virus polymerase can titrate out inhibition by the murine Mx1 protein. J. Virol. 66:4154–4160.
18. Macdonald, R. D., and J. C. Kennedy. 1979. Infectious pancreatic necrosis virus persistently infects chinook salmon embryo cells independent of inter-feron. Virology 95:260–264.
19. Meier, E., J. Fah, M. S. Grob, R. End, P. Staeheli, and O. Haller. 1988. A family of interferon-induced Mx-related mRNAs encodes cytoplasmic and nuclear proteins in rat cells. J. Virol. 62:2386–2389.
20. Meier, E., G. Kunz, O. Haller, and H. Arnheiter. 1990. Activity of rat Mx proteins against a rhabdovirus. J. Virol. 64:6263–6269.
21. Melen, K., and I. Julkunen. 1994. Mutational analysis of murine Mx1 pro-tein: GTP binding core domain is essential for anti-influenza A activity. Virology 205:269–279.
22. Melen, K., T. Ronni, B. Broni, R. M. Krug, C. H. von Bonsdorff, and I.
Julkunen.1992. Interferon-induced Mx proteins form oligomers and contain a putative leucine zipper. J. Biol. Chem. 267:25898–25907.
23. Nakayama, M., K. Nagata, A. Kato, and A. Ishihama. 1991. Interferon-inducible mouse Mx1 protein that confers resistance to influenza virus is GTPase. J. Biol. Chem. 266:21404–21408.
24. Obar, R. A., C. A. Collins, J. A. Hammarback, H. S. Shpetner, and R. B.
Vallee.1990. Molecular cloning of the microtubule-associated mechano-chemical enzyme dynamin reveals homology with a new family of GTP-binding proteins. Nature 347:256–261.
25. Pavlovic, J., O. Haller, and P. Staeheli. 1992. Human and mouse Mx proteins inhibit different steps of the influenza virus multiplication cycle. J. Virol.
66:2564–2569.
26. Pavlovic, J., T. Zurcher, O. Haller, and P. Staeheli. 1990. Resistance to influenza virus and vesicular stomatitis virus conferred by expression of human MxA protein. J. Virol. 64:3370–3375.
27. Pitossi, F., A. Blank, A. Schroder, A. Schwarz, P. Hussi, M. Schwemmle, J.
[image:7.612.57.299.91.164.2]Pavlovic, and P. Staeheli.1993. A functional GTP-binding motif is necessary
TABLE 2. Double-label immunofluorescence analysis of trout
Mx inhibition of IHNV nucleoprotein accumulation
aClone transfectedNo. of
cells No. of transfected cells expressing IHNV % IHNV inhibitionb
b-Galactosidase control
39
38
2.5
RBTMx1
88
81
7.9
RBTMx2
45
41
8.8
RBTMx3
86
83
3.4
aTrout Mx-transfected cells were stained with Texas Red-conjugated
anti-body, and IHNV N protein-expressing cells were detected with fluorescein-conjugated antibody.
bCalculated as (12the number of Mx-positive cells expressing IHNV
nucleo-protein divided by the total number of Mx-positive cells)3100.
on November 9, 2019 by guest
http://jvi.asm.org/
for antiviral activity of Mx proteins. J. Virol. 67:6726–6732.
28. Ristow, S. S., and J. M. Arnzen. 1989. Development of monoclonal antibod-ies that recognize a type 2 specific and a common epitope on the nucleo-protein of infectious hematopoietic necrosis virus. J. Aquat. Anim. Health
1:119–125.
29. Rothman, J. H., C. K. Raymond, T. Gilbert, P. J. O’Hara, and T. H. Stevens. 1990. A putative GTP binding protein homologous to interferon-inducible Mx proteins performs an essential function in yeast protein sorting. Cell
61:1063–1074.
30. Schneider-Schaulies, S., J. Schneider-Schaulies, A. Schuster, M. Bayer, J.
Pavlovic, and V. ter Meulen.1994. Cell type-specific MxA-mediated inhibi-tion of measles virus transcripinhibi-tion in human brain cells. J. Virol. 68:6910– 6917.
31. Staeheli, P. 1990. Interferon-induced proteins and the antiviral state. Adv. Virus Res. 38:147–200.
32. Staeheli, P., O. Haller, W. Boll, J. Lindenmann, and C. Weissmann. 1986.
Mx protein: constitutive expression in 3T3 cells transformed with cloned Mx cDNA confers selective resistance to influenza virus. Cell 44:147–158. 33. Staeheli, P., Y. X. Yu, R. Grob, and O. Haller. 1989. A double-stranded
RNA-inducible fish gene homologous to the murine influenza virus resis-tance gene Mx. Mol. Cell. Biol. 9:3117–3121.
34. Thimme, R., M. Frese, G. Kochs, and O. Haller. 1995. Mx1 but not MxA confers resistance against tick-borne Dhori virus in mice. Virology 211:296– 301.
35. Trobridge, G. D., and J. A. Leong. 1995. Characterization of a rainbow trout Mx gene. J. Interferon Cytokine Res. 15:691–702.
36. Zurcher, T., J. Pavlovic, and P. Staeheli. 1992. Mechanism of human MxA protein action: variants with changed antiviral properties. EMBO J. 11:1657– 1661.
37. Zurcher, T., J. Pavlovic, and P. Staeheli. 1992. Mouse Mx2 protein inhibits vesicular stomatitis virus but not influenza virus. Virology 187:796–800.
![FIG. 1. Amino acid sequences of rainbow trout Mx1, Mx2, and Mx3. The amino acid ORFs from RBTMx1, RBTMx2, and RBTMx3 as deduced from the cDNAsequences (GenBank accession numbers U30253 [RBTMx1], OMU47945 [RBTMx2], and OMU47946 [RBTMx3]) are shown](https://thumb-us.123doks.com/thumbv2/123dok_us/1263601.78642/4.612.98.513.73.592/sequences-rainbow-rbtmx-deduced-cdnasequences-genbank-accession-numbers.webp)
