Virions released from cells transfected with a molecular clone of human T-cell leukemia virus type I give rise to primary and secondary infections of T cells.

JOURNAL OFVIROLOGY, Mar. 1995, p. 1907–1912 Vol. 69, No. 3 0022-538X/95/$04.0010

Copyrightq1995, American Society for Microbiology

Virions Released from Cells Transfected with a Molecular

Clone of Human T-Cell Leukemia Virus Type I Give Rise to

Primary and Secondary Infections of T Cells

DAVID DERSE,

_{* JUDY MIKOVITS,}

_{MARIA POLIANOVA,}

_{BARBARA K. FELBER,}

AND

FRANCIS RUSCETTI

Laboratory of Leukocyte Biology, Biological Response Modifiers Program,

_{Biological Carcinogenesis and Development}

Program, PRI/DynCorp,

_{and Human Retrovirus Pathogenesis Group, ABL-Basic Research Program,}

_National

Cancer Institute-Frederick Cancer Research and Development Center, Frederick, Maryland 21702-1201

Received 16 August 1994/Accepted 19 October 1994

The ability of molecular clones of human T-cell leukemia virus type I (HTLV-I) to direct the synthesis of

infectious virions has not previously been demonstrated. An HTLV-I provirus originating from an adult T-cell

leukemia patient was cloned into a plasmid vector and is designated pCS-HTLV. This molecular clone was

shown to direct the synthesis of viral mRNAs and proteins in transiently transfected cells; in addition, virus

structural proteins were released into the culture medium. Viral proteins were assembled into virions that

sedimented at a buoyant density characteristic of retrovirus particles and whose morphology was verified by

electron microscopy. Virions concentrated from transiently transfected cell supernatants were incubated with

primary cord blood lymphocytes or with transformed T-cell lines to establish that these particles were

infectious. Expression of spliced, viral mRNAs in the T-cell cultures after both primary and secondary

infections with cell-free virus revealed that pCS-HTLV encodes an infectious provirus.

Human T-cell leukemia virus type I (HTLV-I) is the

etio-logic agent of adult T-cell leukemia and is also associated with

progressive, degenerative neurological disorders referred to as

tropical spastic paraparesis or HTLV-I-associated myelopathy

(10, 13, 26, 27, 39). HTLV-I characteristically infects CD4

T

cells in vivo and in vitro (3, 11, 12, 27–29). However,

HTLV-I-infected B cells and CD8

T cells have been obtained after

culture of peripheral blood mononuclear cells (PBMCs) from

infected individuals or after coculture of cord blood

lympho-cytes or PBMCs with HTLV-I-producing cells (4, 14, 20, 21, 25,

31, 38). In vitro infections of other cell types, including

fibro-blasts (2), endothelial cells (15, 17), and neural (32),

monocy-toid (14), and microglial (16) cells, have been reported.

Cell-free infection with HTLV-I is inefficient compared with that of

other retroviruses, and it has been calculated that one in one

million virus particles is infectious (5). Therefore, most studies

of HTLV-I infection and T-cell transformation employ

cocul-tivation techniques. It is still unclear whether the virion is

unusually labile, is poorly released from the infected cell, or

inefficiently binds and penetrates the host cell. Expression of

HTLV-I is highly restricted both in vivo and in vitro and is

regulated at transcriptional and posttranscriptional levels by

inducible, cellular transcription factors and by the products of

the viral tax and rex genes (7, 8, 18, 19, 34–36, 40).

In addition to obstacles imposed by the biological properties

of the virus, molecular genetic studies of HTLV-I infectivity

and replication have progressed slowly because of the lack of

an infectious molecular clone. Several molecular clones of

HTLV-I have been constructed and examined in different

lab-oratories, and some of these have been shown to transiently

express mRNAs and proteins in transfected cells (1, 23, 24);

however, their ability to direct the production of infectious

virus particles has not yet been demonstrated. Although

ge-netic defects in the cloned proviruses may abrogate their

in-fectivity, it is more likely that the lack of demonstrable

infec-tivity results from difficulties attributable to (i) poor infecinfec-tivity

intrinsic to HTLV-I virions; (ii) highly restricted expression of

the virus in infected cells, which limits both detection and

spread of the virus through the cell culture; and (iii) potential

cytopathic effects of the virus in productively infected cells.

These problems are compounded in the analyses of cloned

proviruses since a virus stock generated from transfected cells

must be produced in sufficient quantities for subsequent

infec-tion experiments. Here, we show that cells transfected with the

provirus clone pCS-HTLV released HTLV-I virions that were

able to infect primary or transformed T cells in vitro.

Further-more, virus produced by these infected T cells was capable of

secondary infections of primary, cultured T cells. pCS-HTLV

should therefore prove valuable in future examinations of the

biological and biochemical interactions of HTLV-I with the

host cell.

pCS-HTLV was constructed by transferring the HTLV-I

provirus from a bacteriophage lambda clone containing one of

the three proviruses resident in CS-1 cell DNA to a plasmid

vector. The transformed T-cell line CS-1 was originally

ob-tained by cocultivation of cord blood lymphocytes with

HTLV-I-infected cells from an American adult T-cell leukemia

pa-tient (20, 21). In the process of constructing pCS-HTLV, all

flanking cellular DNA was removed; in addition, 30 bp from

the 5

9

end and 70 bp from the 3

9

end of the provirus were

deleted (these sequences would be regenerated after infection

and replication). pCS-HTLV was previously shown by

North-ern (RNA) blotting, reverse transcription PCR (RT-PCR), and

cDNA cloning experiments to direct the synthesis of major and

minor viral mRNAs in transiently transfected cells (1). In

ad-dition, functional activities of viral Tax and Rex proteins

en-coded by pCS-HTLV have been demonstrated (reference 6

and unpublished information). Enzyme-linked immunosorbent

assays revealed that p24

_{protein was released into the}

growth medium shortly after transfection of both HeLa and

* Corresponding author. Mailing address: Laboratory of Leukocyte Biology, National Cancer Institute, NCI-FCRDC, Frederick, MD 21702-1201. Phone: (301) 846-1504. Fax: (301) 846-6107.

1907

on November 9, 2019 by guest

http://jvi.asm.org/

FIG. 1. Electron micrograph showing mature HTLV-I particles released from transiently transfected HLtat cells and persistently infected MT-2 cells. HLtat cells (HeLa cells stably transfected with human immunodeficiency virus type 1 Tat) in four 60-mm-diameter plates were transfected with 10mg of pCS-HTLV DNA. Two days later, cells were collected by scraping, pooled, and pelleted by centrifugation. At the same time, virus in the cell culture supernatant was concentrated by ultracentrifugation. The cell pellet was washed twice with phosphate-buffered saline and suspended in 5 ml of 1.25% glutaraldehyde. (A and B) HTLV-I particles associated with transfected HLtat cells; (C) virus particles pelleted from the culture supernatant; (D) HTLV-I particles produced from the HTLV-I-infected cell line MT-2. Magnification,381,000.

1908 NOTES J. VIROL.

on November 9, 2019 by guest

http://jvi.asm.org/

FIG. 2. Sucrose density gradient centrifugation of virus released into the supernatant growth medium from 293 cells transfected with pCS-HTLV. (A) Density of fractions; (B) immunoblot of sucrose density gradient fractions. Two days after transfection of 293 cells in 10-cm-diameter dishes with 10mg of pCS-HTLV, 10 ml of growth medium was collected from one plate and clarified by low-speed centrifugation. Virus was pelleted by centrifugation in a 50Ti rotor at 35,000 rpm for 2 h. The virus pellet was suspended in 0.5 ml of 50 mM Tris-HCl–100 mM KCl–1 mM dithiothreitol, layered on a 15 to 60% sucrose gradient, and centrifuged at 21,000 rpm for 16 h in an SW41 rotor. Fractions of approximately 100ml were collected, and the refractive index was determined for each fraction. Fifty microliters of each fraction was resolved by electrophoresis on a 12% polyacrylamide–SDS gel. After electrophoresis, proteins were electrophoretically transferred to an Immobilon-P (Millipore) polyvinylidene difluoride membrane and incubated with HTLV-I-infected human serum (Scripps) and then with horseradish peroxidase-conjugated goat anti-human immunoglobulin antibody. Specific HTLV-I bands were visualized by chemiluminescent staining (ECL; Amersham).

FIG. 3. Map of pCS-HTLV showing genetic organization, transcription pattern, and locations of PCR primers. Sequences of the PCR primers were as follows: HT460 (sense), 59TGTGGTGCCTCCTGAACTGC39; HTex1-2 (sense, covers the splice junction of exon 1-exon 2 [ex1-2], positions 482 to 493 and 5015 to 5024), 59TCCGCCGTCTAG/CTTCCTGGTC39; HT5050 (sense), 59ACAGGAGGCTCTCCAAGAAG39; HT5275 (antisense), 59CTGGGGCTGTAATCACCGAAGAT GAG39; HT7356 (antisense), 59AAAGAAGACTCTGTCCAAACCC39; and HT7875 (antisense), 59CATTGGTGAGGAAGGCCCCGAGC39. LTR, long terminal repeat.

1909

on November 9, 2019 by guest

http://jvi.asm.org/

293 cells with pCS-HTLV; levels of p24 peaked at 2 days

posttransfection and decreased with time and cell passage to

low but detectable levels (data not shown). To determine

whether viral proteins released into the growth medium were

assembled into virions, transfected cells and supernatants were

examined by electron microscopy (Fig. 1). HLtat cells (a HeLa

cell line expressing human immunodeficiency virus type 1 Tat)

were transfected with pCS-HTLV, and 2 days later medium

was collected and virus was concentrated by

ultracentrifuga-tion; at the same time, cells were collected by scraping, washed

with phosphate-buffered saline, and fixed in 1.25%

glutaralde-hyde. Mature HTLV-I particles were observed both associated

with transfected cells (Fig. 1A and B) and in the supernatant

(panel C). The morphology of these particles was identical to

that of virus produced from the HTLV-I-infected T-cell line

MT2 (panel D). In subsequent experiments human 293 cells

were used, since they have a high transfection efficiency and

transiently expressed pCS-HTLV at high levels. Supernatant

from 293 cells transfected with pCS-HTLV was concentrated

by ultracentrifugation, applied to 15 to 60% sucrose density

gradients, and centrifuged in an SW41 rotor. Sucrose gradient

fractions were then analyzed by electrophoresis on 12%

poly-acrylamide–sodium dodecyl sulfate (SDS) gels, transferred to

polyvinylidene difluoride membranes, and developed with

anti-HTLV-I antisera (Fig. 2). Bands corresponding to anti-HTLV-I

p24

_{and p19}

_{proteins and gp46 envelope surface}

glyco-protein were observed with peak intensities centered around

fraction 10. Thus, HTLV-I proteins in the supernatant

sedi-mented at a buoyant density of approximately 1.15 gm/ml,

characteristic of retrovirus particles. The immunoblot shown in

Fig. 2 reveals that the profiles of the gag and env protein bands

are not superimposed, reflecting either a loss of envelope

dur-ing the course of centrifugation or heterogeneity in the virus

population related to the extent of virion maturation.

To determine whether the virus particles released into the

medium were infectious, 293 cells in 15-cm-diameter plates

were transfected with 20

m

g of pCS-HTLV DNA. Medium was

changed 2 days after transfection, and supernatants were

col-lected 1 day later. For each infection, virus was concentrated

from one 15-cm-diameter plate of transfected 293 cells.

Super-natants were underlaid with 3 ml of a 10% glycerol, and virus

was pelleted by centrifugation at 35,000 rpm in a 50Ti rotor for

2 h. Virus pellets were suspended in 0.2 ml of serum-free

RPMI 1640 medium containing DEAE-dextran (10

m

g/ml) and

DNase (80 U/ml; Boehringer) for 2 h at 37

8

C. For each cell

type infected, a matching virus suspension was incubated at

65

8

C as a negative control. MOLT4 cells, CEM cells, and

phytohemagglutinin–interleukin-2-activated cord blood

lym-phocytes were maintained as previously described (30). Prior

to infection, 10

_{T cells were suspended in 1 ml of RPMI 1640}

containing 10

m

g of DEAE-dextran per ml and mixed with 0.2

ml of virus suspension. Cells and virus were incubated for 2 h

at 37

8

C, and then 10 ml of complete medium was added.

Infected T cells were collected at various times after infection,

and total cellular RNA was extracted, converted to cDNA by

reverse transcriptase with random hexamer primers, and then

FIG. 4. RT-PCR analysis of RNA expressed in MOLT4 cells, CEM cells, and cord blood lymphocytes (CB) after infection with concentrated supernatants from transiently transfected 293 cells. Approximately 53106

T cells were collected 2 days after infection for preparation of total cellular RNA using RNA STAT-60 (TEL TEST Inc.). One microgram of total cellular RNA was incubated in 20ml of cDNA synthesis reaction mixture with random hexamer primers as previously described (22). Reactions were terminated by addition of 80ml of H2O and heating at 958C for 10 min. RNA was also prepared from transiently transfected 293 cells and converted to cDNA; this cDNA was diluted 1:103

or 1:102

, as indicated, prior to PCR amplification. Lanes i, infections with concentrated virus; lanes m, infections with heat-inactivated virus. The 195-bp tax/rex and the 280-bp env PCR products are indicated. (A) Nested (two-step) PCRs followed by Southern blotting detect Tax/Rex mRNA. Two sequential amplification reactions were used to detect the doubly spliced Tax/Rex mRNA; the first reaction mixture contained primers HT460 and HT7875, and the second contained primers HT5050 and HT7356. The first reaction mixture contained 5ml (5%) of the cDNA reaction mixture, 200 ng of each primer, 200mM (each) deoxynucleoside triphosphate (dNTP), 10 mM Tris-HCl (pH 8.3), 1.5 mM MgCl2, 50 mM KCl, and 2 U of Taq DNA polymerase (Boehringer-Mannheim) in a volume of 50ml. Amplification was achieved with 35 cycles of 948C for 30 s, 608C for 30 s, and 728C for 60 s. A 1-ml aliquot from the first PCR mixture was added to the second reaction and amplified under the same conditions. Twenty-five microliters from the second PCR was run on a 10% polyacrylamide gel, transferred to a nylon membrane, and hybridized with a32_{P-labelled DNA fragment containing exon 2. (B) Single-step PCRs with cDNA and PCR primers HT5050} and HT7356 were carried out in the presence of [32_{P]dCTP essentially as described by Saksela et al. (33). Products representing Tax/Rex mRNA were separated on} 10% polyacrylamide gels. Reaction mixtures contained, in 50ml, 5ml of diluted cDNA reaction mixture, 10 mM Tris-HCl (pH 8.3), 1.5 mM MgCl2, 50 mM KCl, 100 mM (each) dNTP, 100 ng of each primer, 0.25ml of [32_{P]dCTP (3,000 Ci/mmol, 10 mCi/ml; NEN), and 1 U of Taq DNA polymerase (Boehringer). The amplification} program consisted of 1 cycle of 948C for 40 s, 608C for 1 min, and 728C for 30 s followed by 32 cycles of 948C for 20 s, 608C for 30 s, and 728C for 20 s. Aliquots (25 ml) from each reaction mixture were run on nondenaturing 10% polyacrylamide gels, dried, and exposed to X-ray film. Molecular size markers (lane pKS) are from

HpaII-digested Bluescript pKS1plasmid DNA (Stratagene) 39end labelled with [32_{P]dCTP. (C) Single-step PCR mixtures contained cDNA and primers HTex1-2 and} HT5275, which amplify cDNAs representing the singly spliced Env mRNA. Reactions were carried out and visualized as described for panel B.

1910 NOTES J. VIROL.

on November 9, 2019 by guest

http://jvi.asm.org/

analyzed by PCR amplification. PCR primers that would

spe-cifically amplify spliced viral mRNAs were chosen (Fig. 3);

neither proviral DNA or viral genomic RNA would be

ampli-fied under these conditions. Initially, a nested PCR

amplifica-tion procedure followed by Southern blot analysis of reacamplifica-tion

products was used (Fig. 4A). This two-step process, using

prim-ers HT460 and HT7875 for the first reaction and primprim-ers

HT5050 and HT7356 for the second, specifically amplified the

doubly spliced Tax/Rex mRNA. Bands corresponding to the

Tax/Rex mRNA, as defined by their size and hybridization to

a Tax/Rex probe, were observed after infections of MOLT4

cells, CEM cells, and cord blood lymphocytes. The cDNAs

were also examined by single-step PCR amplification in the

presence of [

_{P]dCTP with either HT5050 and HT7356}

prim-ers to detect Tax/Rex mRNA or HTex1-2 and HT5275 primprim-ers

to detect Env mRNA (Fig. 4B and C). Again, bands of the

predicted size were observed in cells infected with virus from

pCS-HTLV-transfected 293 cells; no bands were ever observed

in cells infected with the heat-inactivated virus preparations.

The env-specific primers amplified additional cDNAs in CEM

cells, but the virus-specific band was seen only in virus-infected

cells (Fig. 4C). Band intensity was maximal at 2 days after

infection and began to decrease at day 4 (data not shown).

Thus, de novo viral mRNA synthesis in the infected cells

sug-gested that the virus had successfully completed the early steps

of infection, including penetration of the cell, RT, integration,

and transcription.

In order to determine whether the infected T cells released

infectious virus, MOLT4 cells were infected with cell-free virus

from 293 cells transfected with pCS-HTLV as described above.

Two days later, the infected MOLT4 cells were washed three

times with complete medium and placed in 3.5-cm-diameter

dishes (2

3

10

_{cells per dish). Into each dish was placed a}

transwell (3-

m

m pore size) containing either cord blood

lym-phocytes or PBMCs (2

3

10

_{cells) previously activated for 4}

days with phytohemagglutinin. An additional set of dishes that

contained uninfected MOLT4 cells as negative controls was

prepared. This cell culture method allows fluid exchange

with-out cell contact or mixing. Two days after initiation of the

transwell cocultures, cells were removed and RNAs were

ex-tracted, converted to cDNA, and then PCR amplified with

primers specific for either Tax/Rex or Env mRNA as described

above. Bands of the predicted size were observed with cDNAs

from both cord blood cells and PBMCs cultured in transwells

with the infected MOLT4 cells (Fig. 5). No HTLV-I-specific

PCR products were observed in cells cultured with uninfected

MOLT4 cells. Thus, the provirus encoded by pCS-HTLV is

infectious in secondary infections and therefore competent in

both afferent and efferent phases of the infectious cycle.

Cord blood cells from three independent donors were

ex-amined for their ability to be transformed with cell-free virus

produced from transiently transfected 293 cells. Although

in-fected, none of the cord blood cell cultures proliferated for

periods longer than 4 to 6 weeks in the presence of

interleu-kin-2. There are several interpretations of these preliminary

results. First, it is possible that the virus titer is simply too low

and too few cells were productively infected. It is important to

note that T-cell transformation mediated by cell-free

prepara-tions of HTLV-I is much less efficient than that mediated by

coculture with infected cells (3, 37). Second, it is possible that

pCS-HTLV is infectious but not transforming. We are

cur-rently trying several other approaches to infect and transform

T cells, including modification of the cell-free infection

proto-col and development of cells that persistently express

pCS-HTLV for transformation mediated by cell contact.

Although molecularly cloned HTLV-I proviruses have been

reported to express viral proteins and to release virus-like

particles after transfection into cells, their ability to produce

infectious virions has not been established. It was therefore the

primary objective of these studies to determine whether the

virus produced from cells transfected with pCS-HTLV was

infectious. The observation that both primary lymphocytes and

transformed T-cell lines expressed spliced viral mRNAs after

exposure to virus from transiently transfected cells indicated

that pCS-HTLV encodes an infectious provirus. Moreover, the

ability of infected MOLT4 cells to pass the virus to primary T

cells indicated that the virus had successfully completed all

steps of the infectious cycle. The cell preferences and kinetics

of infection observed here with virus from transfected cells are

consistent with results from cell-free infections using virus

from MT-2 cells (5). In that report, MOLT4 cells also gave a

greater signal (more HTLV-I DNA) than CEM cells after

cell-free infection and the signal deteriorated rapidly after

infection.

Many fundamental questions pertaining to the biology and

biochemistry of HTLV-I have not been addressed because of

the lack of an infectious molecular clone. pCS-HTLV now

provides a reagent to study the molecular genetics of HTLV-I

and to test the effects of mutations in structural and regulatory

genes and cis-acting elements on the various stages of the

infectious cycle. For example, it should now be possible to

directly examine determinants of HTLV-I infection, virion

as-sembly, replication, gene expression, and T-cell transformation.

Furthermore, this molecular clone provides a homogeneous

source of infectious virus, in contrast to many persistently

FIG. 5. RT-PCR analysis of RNA expressed after secondary infection of cord blood lymphocytes or PBMCs. RT-PCR analyses were performed essentially as described in the legend to Fig. 4B except that cDNA was prepared by using the superscript preamplification system (Life Technologies) with 5mg of total cel-lular RNA. PCR mixtures contained primers HT5050 and HT7356 for HTLV-I

tax/rex (lanes 1 to 5), primers HTex1-2 and HT5275 for HTLV-I env (lanes 6 to

10), and primers for cellular GAPDH (9) (lanes 11 to 15). Coculture of infected or uninfected MOLT4 cells with cord blood lymphocytes or PBMCs in transwell culture dishes is described in the text. cDNAs were prepared from cord blood cells from transwell cultures with HTLV-I-infected MOLT4 cells (lanes 1, 6, and 11), HTLV-I-infected MOLT4 cells from the bottom of transwell dishes (lanes 2, 7, and 12), cord blood cells from transwell cultures with uninfected MOLT4 cells (lanes 3, 8, and 13), PBMCs from transwell cultures with uninfected MOLT4 cells (lanes 4, 9, and 14), and PBMCs from transwell cultures with HTLV-I-infected MOLT4 cells (lanes 5, 10, and 15).

VOL. 69, 1995 NOTES 1911

on November 9, 2019 by guest

http://jvi.asm.org/

infected cell lines that produce defective viruses that often

interfere with subsequent analyses.

We thank Anne Meyers for expert technical assistance and Matthew Gonda and Kunio Nagashima for electron microscopy.

This project was sponsored in part by funds from the Department of Health and Human Services, NCI, under contracts N01-C0-74102 with PRI/DynCorp and N01-C0-74101 with ABL.

REFERENCES

1. Ciminale, V., G. N. Pavlakis, D. Derse, C. P. Cunningham, and B. Felber. 1992. Complex splicing in the human T-cell leukemia virus (HTLV) family of retroviruses: novel mRNAs and proteins produced by HTLV type I. J. Virol.

66:1737–1745.

2. Clapham, P., K. Nagy, R. Cheingsong-Popov, M. Exley, and R. A. Weiss. 1983. Productive infection and cell-free transmission of human T-cell leu-kemia virus in a nonlymphoid cell line. Science 222:1125–1127.

3. DeRossi, A., A. Aldovini, G. Franchini, D. Mann, R. C. Gallo, and F.

Wong-Staal.1985. Clonal selection of T lymphocytes infected by cell-free human T-cell leukemia/lymphoma virus type I: parameters of virus integration and expression. Virology 143:640–645.

4. Ehrlich, G. D., F. Davey, J. Kirshner, J. Sninsky, S. Kwok, D. Slamon, R.

Kalish, and B. J. Poiesz.1989. A polyclonal CD41and CD81lymphocytosis in a patient doubly infected with HTLV-I and HIV-1: a clinical and molec-ular analysis. Am. J. Hematol. 30:128–139.

5. Fan, N., J. Gavalchin, B. Paul, K. Wells, M. J. Lane, and B. J. Poiesz. 1992. Infection of peripheral blood mononuclear cells and cell lines by cell-free human T-cell lymphoma/leukemia virus type I. J. Clin. Microbiol. 30:905– 910.

6. Felber, B., D. Derse, A. Athanassopoulos, M. Campbell, and G. N. Pavlakis. 1989. Cross-activation of the Rex proteins of HTLV-1 and BLV and of the REV protein of HIV-1 and nonreciprocal interactions with their RNA re-sponsive elements. New Biol. 1:318–330.

7. Felber, B., H. Paskalis, C. Kleinman-Ewing, F. Wong-Staal, and G. N.

Pavlakis.1985. The pX protein of HTLV-1 is a transcriptional activator of its long terminal repeats. Science 229:675–679.

8. Fujisawa, J., M. Seiki, T. Kiyokawa, and M. Yoshida. 1985. Functional activation of the long terminal repeat of human T-cell leukemia virus type I by a trans-acting factor. Proc. Natl. Acad. Sci. USA 82:2277–2281. 9. Gendelman, H., R. Friedman, S. Joe, L. Baca, J. Turpin, G. Dveksler, M.

Meltzer, and C. Dieffenbach.1990. A selective defect of interferon-alpha production in human immunodeficiency virus-infected monocytes. J. Exp. Med. 172:1433–1438.

10. Gessain, A., F. Barin, J. C. Vernant, O. Gout, L. Maurs, A. Calender, and G.

De The.1985. Antibodies to human T-lymphotrophic virus type I in patients with tropical spastic paraparesis. Lancet ii:407–410.

11. Gessain, A., F. Saal, M. Giron, J. Lasneret, S. Lagaye, O. Gout, G. De The,

F. Sigaux, and J. Peries.1990. Cell surface phenotype and human T lym-photropic virus type I antigen expression in 12 T-cell lines derived from peripheral blood and cerebrospinal fluid of West Indian, Guianese, and African patients with tropical spastic paraparesis. J. Gen. Virol. 71:333–341. 12. Hattori, T., T. Uchiyama, T. Toibana, K. Takatsuki, and H. Uchino. 1981. Surface phenotype of Japanese adult T-cell leukemia cells characterized by monoclonal antibodies. Blood 58:645–647.

13. Hinuma, Y., K. Nagata, M. Hanaoka, M. Nakai, T. Matsumoto, K.

Ki-noshita, S. Shirakawa, and I. Miyoshi.1981. Adult T-cell leukemia: antigen in an ATL cell line and detection of antibodies to the antigen in human sera. Proc. Natl. Acad. Sci. USA 78:6476–6480.

14. Hiramatsu, K., M. Masuda, and H. Yoshikura. 1986. Mode of transmission of human T cell leukemia virus type I (HTLV-I) in a human promyelocytic leukemia HL60 cell. Int. J. Cancer 37:601–606.

15. Ho, D., T. R. Rota, and M. S. Hirsh. 1984. Infection of human endothelial cells by human T-lymphotropic virus type I. Proc. Natl. Acad. Sci. USA

81:7588–7590.

16. Hoffman, P. M., S. Dhib-Jalbut, J. A. Mikovits, D. S. Robbins, A. L. Wolf,

G. K. Bergey, N. C. Lohrey, O. S. Weislow, and F. W. Ruscetti.1992. Human T-cell leukemia virus type I infection of monocytes and microglial cells in primary human cultures. Proc. Natl. Acad. Sci. USA 89:11784–11788. 17. Hoxie, J. A., D. M. Matthews, and D. B. Cines. 1984. Infection of human

endothelial cells by human T-cell leukemia virus type I. Proc. Natl. Acad. Sci. USA 81:7591–7595.

18. Inoue, J., M. Seiki, and M. Yoshida. 1986. The second pX product p27X-III of HTLV-1 is required for gag gene expression. FEBS Lett. 209:187–190. 19. Inoue, J., M. Yoshida, and M. Seiki. 1987. Transcriptional (p40X) and

post-transcriptional (p27X-III) regulators are required for the expression and replication of human T-cell leukemia virus type I genes. Proc. Natl.

Acad. Sci. USA 84:3653–3657.

20. Longo, D. I., E. P. Gelmann, J. Cossman, R. A. Young, R. C. Gallo, S. J.

O’Brien, and L. A. Matis. 1984. Isolation of an HTLV-transformed B-lymphocyte clone from a patient with HTLV-associated adult T-cell leuke-mia. Nature (London) 310:505–506.

21. Mann, D. L., J. Clark, M. Clarke, M. Reitz, M. Popovic, G. Franchini, C. D.

Trainor, D. M. Strong, W. A. Blattner, and R. C. Gallo.1984. Identification of the human T cell lymphoma virus in B cell lines established from patients with adult T cell leukemia. J. Clin. Invest. 74:56–62.

22. Martarano, L., R. Stephens, N. Rice, and D. Derse. 1994. Equine infectious anemia virus trans-regulatory protein Rev controls mRNA stability, accumu-lation, and alternative splicing. J. Virol. 68:3102–3111.

23. Mori, K., H. Sabe, H. Siomi, T. Iino, A. Tanaka, K. Takeuchi, K. Hirayoshi,

and M. Hatanaka.1987. Expression of a provirus of human T cell leukaemia virus type I by DNA transfection. J. Gen. Virol. 68:499–506.

24. Nicot, C., T. Astier-Gin, E. Edouard, E. Legrand, D. Moynet, A. Vital, D.

Londos-Gagliardi, J. P. Moreau, and B. Guillemain.1993. Establishment of HTLV-I-infected cell lines from French, Guianese and West Indian patients and isolation of a proviral clone producing viral particles. Virus Res. 30:317– 334.

25. Okada, M., Y. Koyanagi, N. Kobayashi, Y. Tanaka, M. Nakai, K. Sano, K.

Takeuchi, Y. Hinuma, M. Hatanaka, and N. Yamamoto.1984. In vitro infection of human B lymphocytes with adult T-cell leukemia virus. Cancer Lett. 22:11–21.

26. Osame, M., K. Usuku, S. Izumo, N. Ijichi, H. Amitani, M. Matsumoto, and

M. Tara.1986. HTLV-I associated myelopathy, a new clinical entity. Lancet

i:1031–1032.

27. Poiesz, B. J., F. W. Ruscetti, A. F. Gazdar, P. A. Bunn, J. D. Minna, and R. C.

Gallo.1980. Detection and isolation of type C retrovirus particles from fresh and cultured lymphocytes of a patient with cutaneous T-cell lymphoma. Proc. Natl. Acad. Sci. USA 77:7415–7419.

28. Poiesz, B. J., F. W. Ruscetti, M. S. Reitz, V. S. Kalyanaraman, and R. C.

Gallo.1981. Isolation of a new type-C retrovirus (HTLV) in primary uncul-tured cells of a patient with Sezary T-cell leukemia and evidence for virus nucleic acids and antigens in fresh leukemic cells. Nature (London) 294:268– 271.

29. Richardson, J. H., A. J. Edwards, J. K. Cruickshank, P. Rudge, and A. G.

Dalgleish.1990. In vivo cellular tropism of human T-cell leukemia virus type I. J. Virol. 64:5682–5687.

30. Ruscetti, F. W., V. S. Kalyanaraman, R. Overton, J. Mikovits, H. Stevenson,

K. Stromberg, R. B. Herberman, W. L. Farrar, and J. R. Ortaldo.1986. Analysis of effector mechanisms against HTLV-I and HTLV-III/LAV in-fected lymphoid cells. J. Immunol. 136:3619–3625.

31. Ruscetti, F. W., M. Robert-Guroff, L. Ceccherini-Nelli, J. Minowada, M.

Popovic, and R. C. Gallo.1983. Persistent in vitro infection by human T-cell leukemia-lymphoma virus (HTLV) of normal human T-lymphocytes from blood relatives of patients with HTLV-associated mature T-cell neoplasms. Int. J. Cancer 31:171–180.

32. Saida, T., K. Saida, M. Funauchi, E. Nishiguchi, M. Nakajima, S. Matsuda,

M. Ohta, K. Ohta, H. Nishitani, and M. Hatanaka.1988. HTLV-I myelitis: isolation of virus, genomic analysis, and infection in neural cell cultures. Ann. N. Y. Acad. Sci. 540:636–638.

33. Saksela, K., E. Muchmore, M. Girard, P. Fultz, and D. Baltimore. 1993. High viral load in lymph nodes and latent human immunodeficiency virus (HIV) in peripheral blood cells of HIV-1-infected chimpanzees. J. Virol.

67:7423–7427.

34. Seiki, M., J. Inoue, T. Takeda, and M. Yoshida. 1986. Direct evidence that p40x of human T-cell leukemia virus type I is a trans-acting transcriptional activator. EMBO J. 5:561–565.

35. Sodroski, J. 1992. The human T-cell leukemia virus (HTLV) transactivator (Tax) protein. Biochim. Biophys. Acta 1114:19–29.

36. Sodroski, J. G., C. A. Rosen, and W. A. Haseltine. 1984. Trans-acting tran-scriptional activation of the long terminal repeat of human T lymphotropic viruses in infected cells. Science 225:381–385.

37. Sugamura, K., M. Sakitani, and Y. Hinuma. 1984. Microplate method for retrovirus-induced transformation of normal human T-cells. J. Immunol. Methods 73:379–385.

38. Yamamoto, N., T. Matsumoto, Y. Koyanagi, Y. Tanaka, and Y. Hinuma. 1982. Unique cell lines harboring both Epstein-Barr virus and adult T-cell leukemia virus established from leukemia patients. Nature (London) 299: 367–369.

39. Yoshida, M., I. Miyoshi, and Y. Hinuma. 1982. Isolation and characterization of retrovirus from cell lines of human adult T-cell leukemia and its implica-tion in the disease. Proc. Natl. Acad. Sci. USA 79:2031–2035.

40. Zhao, L. J., and C. Z. Giam. 1991. Interaction of the human T-cell lympho-tropic virus type I (HTLV-I) transcriptional activator Tax with cellular fac-tors that bind specifically to the 21-base-pair repeats in the HTLV-I en-hancer. Proc. Natl. Acad. Sci. USA 88:11445–11449.

1912 NOTES J. VIROL.

on November 9, 2019 by guest

http://jvi.asm.org/