Recombinant Origins of Pathogenic and Nonpathogenic Mouse Gammaretroviruses with Polytropic Host Range

Recombinant Origins of Pathogenic and

Nonpathogenic Mouse Gammaretroviruses

with Polytropic Host Range

Devinka Bamunusinghe,

*

Qingping Liu,

Ronald Plishka,

Michael A. Dolan,

Matthew Skorski,

Andrew J. Oler,

Venkat R. K. Yedavalli,

Alicia Buckler-White,

Janet W. Hartley,

Christine A. Kozak

Laboratory of Molecular Microbiology, National Institute of Allergy and Infectious Diseases, Bethesda, Maryland, USAa_{; Bioinformatics and Computational Biosciences Branch, National Institute of Allergy and}

Infectious Diseases, Bethesda, Maryland, USAb_{; Laboratory of Immunopathology, National Institute of Allergy}

and Infectious Diseases, Bethesda, Maryland, USAc

ABSTRACT

Ecotropic, xenotropic, and polytropic mouse leukemia viruses (E-, X-,

and P-MLVs) exist in mice as infectious viruses and endogenous retroviruses (ERVs)

inserted into mouse chromosomes. All three MLV subgroups are linked to

leukemo-genesis, which involves generation of recombinants with polytropic host range.

Al-though P-MLVs are deemed to be the proximal agents of disease induction, few

bio-logically characterized infectious P-MLVs have been sequenced for comparative

analysis. We analyzed the complete genomes of 16 naturally occurring infectious

P-MLVs, 12 of which were typed for pathogenic potential. We sought to identify ERV

progenitors, recombinational hot spots, and segments that are always replaced,

never replaced, or linked to pathogenesis or host range. Each P-MLV has an E-MLV

backbone with P- or X-ERV replacements that together cover 100% of the

recombi-nant genomes, with different substitution patterns for X- and P-ERVs. Two segments

are always replaced, both coding for envelope (Env) protein segments: the N

termi-nus of the surface subunit and the cytoplasmic tail R peptide. Viral

gag

gene

re-placements are influenced by host restriction genes

Fv1

and

Apobec3

. Pathogenic

potential maps to the

env

transmembrane subunit segment encoding the N-heptad

repeat (HR1). Molecular dynamics simulations identified three novel interdomain

salt bridges in the lymphomagenic virus HR1 that could affect structural stability,

entry or sensitivity to host immune responses. The long terminal repeats of

lym-phomagenic P-MLVs are differentially altered by recombinations, duplications, or

mutations. This analysis of the naturally occurring, sometimes pathogenic P-MLV

recombinants defines the limits and extent of intersubgroup recombination and

identifies specific sequence changes linked to pathogenesis and host

interac-tions.

IMPORTANCE

During virus-induced leukemogenesis, ecotropic mouse leukemia

vi-ruses (MLVs) recombine with nonecotropic endogenous retrovivi-ruses (ERVs) to

pro-duce polytropic MLVs (P-MLVs). Analysis of 16 P-MLV genomes identified two

seg-ments consistently replaced: one at the envelope N terminus that alters receptor

choice and one in the R peptide at the envelope C terminus, which is removed

dur-ing virus assembly. Genome-wide analysis shows that nonecotropic replacements in

the progenitor ecotropic MLV genome are more extensive than previously

appreci-ated, covering 100% of the genome; contributions from xenotropic and polytropic

ERVs differentially alter the regions responsible for receptor determination or subject

to APOBEC3 and Fv1 restriction. All pathogenic viruses had modifications in the

reg-ulatory elements in their long terminal repeats and differed in a helical segment of

envelope involved in entry and targeted by the host immune system. Virus-induced

Received30 May 2017Accepted26 July

2017

Accepted manuscript posted online9

August 2017

CitationBamunusinghe D, Liu Q, Plishka R,

Dolan MA, Skorski M, Oler AJ, Yedavalli VRK, Buckler-White A, Hartley JW, Kozak CA. 2017. Recombinant origins of pathogenic and nonpathogenic mouse gammaretroviruses with polytropic host range. J Virol 91:e00855-17.https://doi.org/10.1128/JVI .00855-17.

EditorSusan R. Ross, University of Illinois at

Chicago

Copyright© 2017 American Society for

Microbiology.All Rights Reserved.

Address correspondence to Christine A. Kozak, [email protected].

*Present address: Devinka Bamunusinghe, Qiagen, Germantown, Maryland, USA.

crossm

on November 7, 2019 by guest

http://jvi.asm.org/

leukemogenesis thus involves generation of complex recombinants, and specific

re-placements are linked to pathogenesis and host restrictions.

KEYWORDS

origins of infectious gammaretroviruses, pathogenic mouse

gammaretroviruses, polytropic mouse gammaretroviruses, recombinant retroviruses,

retroviral N-heptad repeat

I

nfectious mouse leukemia viruses of ecotropic, xenotropic and polytropic host range

(E-, X-, and P-MLVs) can be isolated from the various inbred strains of laboratory mice

(reviewed in reference 1). These three MLV host range groups are also carried by

laboratory mice as endogenous retroviruses (ERVs) (2, 3), which are viral DNA copies

integrated into host genomes during past infections. Many E-MLV and some X-MLV

ERVs are nondefective and are capable of producing infectious virus. Although there is

no evidence that individual P-MLV ERVs can also produce virus, infectious MLVs with a

polytropic host range can be isolated from mice. The initial biological characterization

of these P-MLVs for their host range, neutralization, and interference properties

sug-gested they are recombinants of ecotropic and nonecotropic MLVs (4–6).

Recombinant P-MLVs are routinely generated

de novo

in laboratory mouse strains

carrying replicating E-MLVs, and the appearance of these recombinants is linked to

virus-induced leukemia (7–9). High-virus, high-leukemic mouse strains, such as AKR,

HRS, and C58, carry E-MLV ERVs, termed

Emv

s (2), most of which can produce infectious

E-MLVs (1). Leukemogenesis begins when

Emv

-derived E-MLVs establish a chronic

infection and then recombine with endogenous nonecotropic ERVs to produce viruses

with increased virulence and altered host range (10, 11). These P-MLVs also have the

ability to induce unusual foci in mink lung cells, and are often termed mink cell

focus-inducing (MCF) viruses (5). MCF P-MLVs can be isolated from high virus strains like

AKR as early as 3 weeks after birth (12), and AKR mice develop leukemias by 6 to 9

months of age. P-MLV-induced disease has been attributed to insertional mutagenesis

in which novel somatic viral integrations either activate genes such as

Myc

that are

involved in growth regulation or inactivate tumor suppressor genes such as

Trp53

(13, 14).

Because P-MLVs show altered host range and increased pathogenic potential, the

initial characterization of novel proviral insertions in tumors or infectious P-MLVs

focused largely on the viral envelope gene (

env

) and on the regulatory elements in their

long terminal repeats (LTRs). Some P-MLV isolates were found to be capable of

accelerating the generation of T-cell lymphomas after neonatal inoculation into AKR

mice, and two classes of P-MLVs were defined on the basis of this differential ability to

induce disease (15, 16). Analyses of these infectious and proviral P-MLVs by restriction

mapping, peptide analysis, T1-oligonucleotide fingerprinting, heteroduplex mapping,

blot analysis, and partial sequencing (7, 17–22) supported the conclusion that these

viruses are recombinants with replacements in

env

and LTR. It was also determined that

the leukemogenic class I viruses have smaller P-MLV

env

replacements than

nonleuke-mogenic class II viruses (23, 24) and linked pathogenicity to LTR substitutions derived

from X-MLV ERVs (25, 26) and to duplications of the clustered transcription factor

binding sites in the enhancer regions of the U3 segment of LTR (27, 28).

Few phenotypically characterized P-MLVs have been fully sequenced. Therefore, to

provide a more complete picture of the differences between leukemogenic and

nonleukemogenic P-MLVs, and to describe the origins and recombinational structure of

these viruses, we analyzed the complete genomes of 16 infectious P-MLVs, all from

mice carrying active

Emv

s. Twelve of these isolates had been characterized for

patho-genic potential and typed as class I or class II viruses, but only one of these

pheno-typically characterized viruses, MCF1233, had been fully sequenced (29). We analyzed

these 16 genomes to identify ERV progenitors, recombinational hot spots, segments

that are always replaced, that are never replaced, or that are linked to pathogenesis,

host range, and susceptibility to host restriction factors. Recombinational substitutions

in these P-MLVs are more extensive than previously appreciated, covering the entire

on November 7, 2019 by guest

http://jvi.asm.org/

viral genome, but only two small segments, in the

env

receptor binding domain (RBD)

and cytoplasmic tail (CT), are replaced in all 16 viruses. Segments governing

interac-tions with host restriction factors are retained or replaced as necessary for efficient

replication, whereas pathogenic potential can be linked to different recombinations,

duplications, or mutations in the U3 LTR and to retention of the E-MLV haplotype of the

highly polymorphic N-heptad repeat encoded by the transmembrane domain of

env

(TM

env

).

RESULTS

Genome sequences of 16 P-MLV Isolates.

Table 1 lists the 16 sequenced MCF

P-MLVs that were isolated from inbred strains or from congenic or partially congenic

mice. Twelve P-MLVs were isolated from tumor tissue, and the rest were from spleen or

thymus. One virus, MCF1233, had been sequenced previously (29); two viruses, PTV-1

and AKR13, had been sequenced for LTR; and one virus, MCF247, had been sequenced

for

env

and LTR (22, 30, 31). All 16 viruses are

de novo

recombinants derived from ERVs

carried in their source strains. Inbred mouse strains typically carry ERVs of E-MLVs (

Emv

s)

(2), X-MLVs (

Xmv

s), and two subtypes of P-MLVs termed

Pmv

s and

Mpmv

s (modified

polytropic viruses) (32, 33). In order to identify the individual MLV ERVs that are likely

progenitors of these 16 infectious P-MLVs, we typed the mouse strains that produced

the sequenced viruses for known MLV ERVs (Table 2).

Sequence alignments of the 16 P-MLV genomes with MLV ERVs showed that these

P-MLVs represent unique intersubgroup recombinants involving two to eight ERVs. All

16 genomes have E-MLV backbones derived from the different but closely related

Emv

s

carried by their source strains (Tables 2 and 3 and Fig. 1). These alignments identified

segments along the lengths of each viral genome with close correspondence (most

with

⬎

99.5% identity) to nonecotropic ERVs found in the source strains or in the donor

strains of the partial congenics (Table 3, Fig. 1 and 2).

The nonecotropic replacements in these 16 P-MLVs are derived from

Pmv

or

Xmv

ERVs, and none from

Mpmv

s. The compiled set of nonecotropic replacements covers

the entire viral genome, with individual viruses showing replacements over 23.0 to

72.3% of their genomes (Fig. 1, Table 3). The set of

Pmv

-related replacements covers a

total of 5,186 bp, most of which map to the 3=

pol

and

env

(Fig. 1). The

Xmv

-related

substitutions cover more of the P-MLV genome (7,461 bp) and include all domains of

the genome except for segments of

env

.

All 16 viruses acquired

Pmv

-related substitutions, most of which showed the closest

homology to

Pmv13

, with some replacements showing closer identity to other

Pmv

s

(34, 35), to ERVs cloned from NFS or HRS mice (36–38), or to a sequence identified in

Virus Mouse strain (age [mo]) Tissue Lymphomagenic Previous characterizationa Reference(s)

AKR13 AKR/J (3) Thymus Yes S (LTR), R, T, P 16–18, 23, 31

MCF247 AKR/J (6) Thymus Yes S (env, LTR), R, T, P 16–18, 23

AKR-L3 AKR/J Thymoma Yes R 16, 23

AKR-L4 AKR/J (9) Thymoma Yes R 16, 23

PTV-1 HRS/J Thymoma Yes S (U3LTR), T, P 30

MCF1233 C57BL/10.A (H-2a_{) Lymphoma Yes S (genome) 29}

Akv2-M66 NFS.Akv2(10) Lymphoma No R 17, 23

Akv2-C78 NFS.Akv2(10) Leukemic cervical lymph node No T 16, 23

Akv2-C25 NFS.Akv2(17) Splenic reticulum cell sarcoma No T 16, 23

C58v1-C77 NFS.C58v1(17) Splenic reticulum cell sarcoma No R, T 16, 17, 23

Fgv1-C647 NFS.Fgv1(10) Leukemic lymph nodes No T 16, 23 CB208 BALB/c Pristane-induced transplanted

plasmacytoma

No 16

C58v2MCF NFS.C58v2 Splenic lymphoma NTb

M965Akv1-MCF NFS.Akv1 Spleen NT

Akv1-C44-1 NFS.Akv1(18.5) Splenic lymphoma NT T 23

C58/J#1thyMCF C58/J (9) Thymus NT

a_{Method: S, sequence; R, restriction map; T, T1-oligonucleotide map ofenv; P, peptide map of Env.} b_{NT, not tested.}

on November 7, 2019 by guest

http://jvi.asm.org/

the AKR genome (Table 3). A few replacements were more divergent, with 81.6 to 96%

identity to known ERVs (Fig. 2). All four divergent segments were found in P-MLVs

isolated from congenics, suggesting that these viruses were either derived from

uncharacterized ERV variants in the donor strains or else acquired mutational changes

ERV subtype ERV

Inbred strain/ERV presence (ⴙ), absence (ⴚ), or strain specifica

AKR C58/J BALB/c HRS C57BL NFS/N

Emvs Emv1 ⫺ ⫺ ⫹ ⫹ ⫺ ⫺

Emv2 ⫺ ⫺ ⫺ ⫺ ⫹ ⫺

Emv3 ⫺ ⫺ ⫺ ⫹ ⫺ ⫺

Emv11 ⫹ ⫺ ⫺ ⫺ ⫺ ⫺

Emv12 ⫹(AKR/N) ⫺ ⫺ ⫺ ⫺ ⫺

Emv13 ⫹ ⫺ ⫺ ⫺ ⫺ ⫺

Emv14 ⫹(AKR/J) ⫺ ⫺ ⫺ ⫺ ⫺

Other 5 or 6 unnamedEmvs

Pmvs Pmv1 ⫺ ⫹ ⫹ ⫹ ⫹ ⫹

Pmv5 ⫺ ⫹ ⫺ ⫺ ⫹ ⫺

Pmv7 ⫺ ⫺ ⫹ ⫹ ⫹ ⫺

Pmv8 ⫹ ⫹ ⫹ ⫺ ⫹ ⫹

Pmv9 ⫺ ⫺ ⫺ ⫺ ⫹ ⫺

Pmv10 ⫹ ⫹ ⫹ ⫹ ⫹ ⫹

Pmv11 ⫺ ⫹ ⫹ ⫹ ⫹ ⫹

Pmv12 ⫺ ⫹ ⫺ ⫹ ⫹ ⫺

Pmv13 ⫹ ⫹ ⫹ ⫹ ⫹ ⫹

Pmv14 ⫹ ⫺ ⫹ ⫹ ⫹ ⫹

Pmv15 ⫺ ⫺ ⫺ ⫹ ⫹ ⫺

Pmv16 ⫺ ⫺ ⫺ ⫹ ⫹ ⫺

Pmv18 ⫺ ⫹ ⫺ ⫹ ⫹ ⫺

Pmv19 ⫺ ⫺ ⫺ ⫹ ⫹ ⫺

Pmv20 ⫹ ⫹ ⫹ ⫹ ⫹ ⫹

Pmv21 ⫺ ⫺ ⫺ ⫹ ⫹ ⫺

Pmv22 ⫺ ⫺ ⫺ ⫺ ⫹ ⫺

Pmv23 ⫺ ⫺ ⫺ ⫺ ⫹ ⫹

Pmv24 ⫺ ⫺ ⫹ ⫹ ⫹ ⫺

Otherb _{NB1, clone 51}

Mpmvs Mpmv1 ⫺ ⫹ ⫺ ⫺ ⫹ ⫹

Mpmv2 ⫺ ⫺ ⫺ ⫺ ⫹ ⫺

Mpmv4 ⫺ ⫺ ⫹ ⫹ ⫹ ⫺

Mpmv5 ⫺ ⫹ ⫺ ⫺ ⫹ ⫺

Mpmv6 ⫺ ⫹ ⫺ ⫹ ⫹ ⫺

Mpmv7 ⫹ ⫹ ⫺ ⫺ ⫹ ⫺

Mpmv8 ⫺ ⫹ ⫺ ⫺ ⫹ ⫺

Mpmv9 ⫹ ⫹ ⫺ ⫺ ⫹ ⫹

Mpmv10 ⫹ ⫹ ⫹ ⫹ ⫹ ⫹

Mpmv11 ⫺ ⫹ ⫺ ⫹ ⫹ ⫺

Mpmv12 ⫺ ⫹ ⫺ ⫺ ⫹ ⫺

Mpmv13 ⫺ ⫹ ⫹ ⫹ ⫹ ⫹

Xmvs Xmv8 ⫺ ⫺ ⫹ ⫺ ⫹ ⫺

Xmv9 ⫺ ⫺ ⫹ ⫺ ⫹ ⫺

Xmv10 ⫹ ⫹ ⫺ ⫺ ⫹ ⫺

Xmv12 ⫺ ⫹ ⫺ ⫺ ⫹ ⫺

Xmv13 ⫺ ⫺ ⫺ ⫹ ⫹ ⫺

Xmv15 ⫹ ⫹ ⫹ ⫺ ⫹ ⫺

Xmv17 ⫺ ⫺ ⫺ ⫺ ⫹ ⫺

Xmv18 ⫺ ⫹ ⫺ ⫹ ⫹ ⫺

Xmv19 ⫺ ⫹ ⫺ ⫺ ⫹ ⫺

Xmv41 ⫺ ⫹ ⫺ ⫹ ⫹ ⫺

Xmv42 ⫺ ⫹ ⫺ ⫺ ⫹ ⫺

Bxv1/Xmv43 ⫹ ⫹ ⫹ ⫹ ⫹ ⫺

XmvIV1/Xmv45 ⫺ ⫺ ⫺ ⫺ ⫹ ⫺

Otherb _{Akctg HLTR(hr)}

a_{MLV ERVs are identified byenvsubtype and insertion sites and can be shared by related mouse strains. AKR substrains N and J carry differentEmvs. C57BL and NFS}

are background strains for congenics that produced 9 P-MLVs. ERV presence or absence was determined by PCR (35) and published Southern blotting data (2, 33).

b_{NB1 and clone 51 are mobilized ERVs found in NFS (36, 37) HLTR(hr) was identified in HRS mice (38), and Akctg was found in the AKR genome.}

on November 7, 2019 by guest

http://jvi.asm.org/

during their passage history. Nine of the 16 P-MLVs also acquired

Xmv

-related

se-quences, most of which are related to the expressed

Bxv1 Xmv

(39, 40), which is shared

by many inbred mouse strains (Table 3) (41).

Template switching and recombination hot spots.

Retroviral recombinants result

from template switching events between copackaged viral genomes. MLVs commonly

show four such events per replication cycle (42). The number of intersubgroup

switch-ing events in our P-MLV panel varied from 2 (M66, C78, and C77) to 18 for MCF1233

(Table 3).

Recombination events occur in short identical stretches shared by the recombining

virus pair. Such recombination events are scattered over these genomes, but all 16

P-MLVs have breakpoint sites within or flanking

env

that are responsible for a common

env

substitution. At the 5=

end of this common substitution, breakpoints found in 12

P-MLVs between the E-MLV genome and various

Pmv

s cluster in a 493-bp segment of

integrase (Fig. 3, segment A). At the 3=

end of this substitution there are two clusters

of breakpoints: one just 3=

of the proline rich region (Fig. 3, segment B) and another at

the end of TM

env

(Fig. 3, segment C). Within these clusters, crossover sites were

occasionally shared by different P-MLVs, with two sites used by three and four viruses,

respectively (Fig. 3). There are no template switch sites in the rest of the viral genome

that are shared by three or more of these viruses (not shown). Previous analysis of the

env

genes of P-MLVs derived from the Moloney E-MLV (36, 43, 44) identified breakpoint

clusters in regions defined by stretches of homology between Moloney and

Pmv

s that

overlap segment B of Fig. 3.

Receptor choice and two

env

segments replaced in all P-MLVs.

MLV host range

is primarily controlled by the first 236 residues of

env

(45, 46), termed the receptor

binding domain (RBD). E-MLV RBDs use the CAT-1 receptor for entry (47), whereas

X-and P-MLVs both use the XPR1 receptor (48–50). All 16 P-MLVs have RBD

env

substitu-tions that introduce host-range-altering sequences that derive from different but

closely related

Pmv

s and, in some cases, also incorporate

Xmv

sequences (Fig. 1 and

Table 3). These RBD substitutions differ in size but contain a common replacement

region of 350 bp (116 residues), which begins in the

env

signal sequence and includes

the VRA variable region of SU that governs receptor choice (46) (Fig. 4A and B). This

common replacement does not include the VRB region of RBD, which is polymorphic

Virus (disease)a

No. of template switches

% replacement

by X/P-ERVs ERV progenitorsb

AKR13 (L) 10 60.3 AKV,Bxv1,Pmv13,Akctg

MCF247 (L) 10 35.9 AKV,Bxv1,Pmv13

AKR-L3 (L) 10 63.7 AKV,Bxv1,Pmv13

AKR-L4 (L) 11 41.4 AKV,Bxv1,Pmv13

PTV-1 (L) 5 40.8 Emv1,Xmv13, HLTR(hr),Pmv15

MCF1233 (L) 18 62.1 Emv2,Bxv1,XmvIV1,Pmv20,XPmv1and

XPmv2c

Akv2-M66 (NL) 2 23.0 AKV,Pmv13 Akv2-C78 (NL) 2 28.2 AKV,Pmv11 Akv2-C25 (NL) 4 36.9 AKV,Pmv13

C58v1-C77 (NL) 2 51.8 Emv2,Pmv13

Fgv1-C647 (NL) 4 32.1 Emv1,Pmv13

CB208 (NL) 4 36.8 Emv1,Pmv11

C58/J#1thyMCF 9 37.5 Emv2,Bxv1,Pmv20

M965Akv1-MCF 12 28.7 AKV,Bxv1,Xmv10,Pmv13,Xmv11, NB1,

Xmv13

Akv1-C44-1 4 27.4 AKV,Pmv13, clone51

C58v2MCF 15 72.3 Emv2,Xmv11,Bxv1,XmvIV1,Pmv1,

NB51,XPmv3, andXPmv4c

a_{L, lymphomagenic; NL, nonlymphomagenic.}

b_{AKR mice carry unsequenced ERVsEmv11,Emv12,Emv13, andEmv14; AKV is the infectious E-MLV produced}

by these mice.Xmv11is a Y-linkedXmvIVERV not typeable by PCR.

c_{XPmvdesignates four replacement segments with⬍96% identity to known ERVs.}

on November 7, 2019 by guest

http://jvi.asm.org/

among the 16 P-MLVs and derives from

Xmv

s in many cases. The region encoded by

this common

env

substitution replaces a substantial portion of the exposed surface at

the RBD apex, changing the residues involved in receptor choice and altering the

surface architecture that forms the interface between Env and the receptor (Fig. 4C).

A second substitution common to all 16 P-MLVs replaces the 3=

end of TM

env

. The

common replacement in these overlapping substitutions is a 78-bp segment that

encodes the R region of the TM CT (Fig. 4D), which is cleaved off during virion

maturation. All amino acid replacements are clustered in the C-terminal 11 residues.

This P-MLV substitution can be derived from

Pmv

s or

Xmv

s, which encode similar R

peptides. This substitution includes the YXXHy endocytosis motif (Y

⫽

tyrosine, X

⫽

any

FIG 1Alignments of 16 P-MLVs showing segments of homology to E-, P-, and X-MLV ERVs. The diagram at the top indicates the positions of LTRs and coding regions. Individual isolates are identified on the left. E-MLV-related segments are indicated in black,Pmvs are indicated in red/pink, andXmvare indicated in greens, and boxes indicate segments where the identity to known ERVs is⬍96%. Numbers at the junction sites are the last matching nucleotide in that segment. At the bottom are shown the total genome replacements byPmvandXmvERVs, and the total combined nonecotropic replacements.

on November 7, 2019 by guest

http://jvi.asm.org/

amino acid, Hy

⫽

any hydrophobic acid), which influences cell fusion (51), but this

sequence is invariant in all of these MLVs and ERVs. The R peptide has been implicated

in the regulation of Env function (52, 53), and the observed paired replacements in RBD

and CT in this set of P-MLVs suggests sequence-dependent interactions that are subject

to coordinated selective pressures. That these two

env

segments in RBD and the CT R

peptide are the only segments of the viral genome replaced in all 16 P-MLVs also

implicates both segments in their shared P-MLV-specific phenotypes, namely,

poly-tropic host range and cytopathic MCF activity.

Replacements in

gag

linked to virus restriction factors.

P-MLV

gag

genes largely

lack P-ERV substitutions (Fig. 1), and this has two likely explanations. First,

Pmv

s, unlike

Emv

s and many

Xmv

s, lack Glycogag (54), an upstream extension of

gag

that functions

as an antagonist to the antiviral host restriction factor APOBEC3 (55). Although most

P-MLVs retain the Glycogag-encoding E-MLV sequences in this region, three P-MLVs—

MCF247, AKR-L3 and AKR13— have Glycogag region substitutions (Fig. 1), but all three

substitutions are derived from

Bxv1

, one of the

Xmv

s that encodes Glycogag (54).

FIG 2Alignments of 16 P-MLVs showing segments of homology with E-, P-, and X-MLV ERVs. A diagram at the top indicates positions of LTRs and coding regions. Individual isolates are named on the left. Segmental subgroup relationships are color coded. Numbers below the line drawing of each P-MLV represent the percent identity to theEmvprogenitor, and numbers above are the percent identities to X- or P-ERVs of segments replaced by recombination.

on November 7, 2019 by guest

http://jvi.asm.org/

A second factor that contributes to the absence of

Pmv

sequences in

gag

is the fact

that the

gag

capsid contains the target for the mouse

Fv1

restriction gene. There are

two major

Fv1

alleles in inbred strains:

Fv1

inhibits replication of B-tropic MLVs,

whereas

Fv1

inhibits N-tropic MLVs (56). The

Emv

s in the mice used for P-MLV isolation

all carry the N-tropic

Fv1

target site in capsid, residue R110, whereas

Pmv

s and some

Xmv

s carry the residue linked to B-tropism, E110 (57) (Fig. 5). A total of 13 of the 16

P-MLVs were generated in

Fv1

mice (AKR, HRS, C58, and the NFS congenics) (Table 1

and Fig. 5), and all 13 retained R110, which is needed for efficient replication in these

mice. Three P-MLVs have

gag

substitutions that introduce E110. Two of these three

viruses (MCF1233 and CB208) were isolated from

Fv1

mice, whereas the third virus,

C58v2, from an

Fv1

mouse, is likely a newly generated recombinant that was captured

by isolation on an

Fv1

mouse cell line. Thus, limits on the acquisition of

Pmv

or

Xmv

segments in the P-MLV

gag

can be associated with two host restriction factors that

target

gag

. Recombinant viruses tend to retain or acquire sequences needed to evade

restriction by APOBEC3 or Fv1.

Viral segments linked to pathogenicity: HR1 of TM

env

.

We next searched for a

common replacement segment that distinguishes the six pathogenic viruses from the

six nonpathogenic recombinants (Fig. 1). Only one viral segment is consistently linked

to pathogenesis. All pathogenic viruses retain a segment of the

Emv

genome in TM

env

,

whereas all nonpathogenic viruses are

Pmv

-like in this region. The minimum shared

replacement in this region tightly encompasses the N-terminal heptad repeat (HR1 or

NHR) (Fig. 6A). HR1 is part of the TM ectodomain, a domain that extends from the fusion

peptide at the TM N terminus and ends at the transmembrane sequence at the C

terminus. HR1, together with the C-terminal heptad repeat (HR2 or CHR), forms a

postfusion six-helix coiled coil (Fig. 6B). The HR1 domains of three Envs form a core

trimer. At the C-terminal end of each HR1 helix is a chain reversal region with the CX6CC

disulfide bridge motif and the immunosuppressive domain (ISD); this is followed by the

FIG 3Three clusters of recombination breakpoints in and aroundenv. Red boxes identify segments of template switching between the E-MLV andPmv

genomes. Twelve of the sixteen viruses have breakpoints in segment A, and segments B and C contain breakpoints for four and eight viruses, respectively. Viruses using breakpoint regions are named above the boxes. Segments with crossover sites for two or more viruses are highlighted in yellow.

on November 7, 2019 by guest

http://jvi.asm.org/

FIG 4TwoPmv envsubstitutions in all 16 P-MLVs. (A) Diagram of the MLV Env showing the surface (SU) and transmembrane (TM) subunits, leader region (pink), the three variable domains (VRA, VRB, and VRC), the RBD, the proline-rich region (PRR), and the cytoplasmic tail (CT). Two red bars indicate the minimum commonPmvreplacement in all 16 viruses. (B) Protein sequences of the Env leader and SU N terminus for six P-MLVs with recombination breakpoints in this region are compared with thePmv13ERV. The minimum shared P-MLV replacement sequence is shown in red. Gray highlights identify homologous regions involved in recombination that are within the displayed sequence. (C) ThePmvEnv replacement covers much of the RBD apex as shown in surface and ribbon representations of the RBD structure based on (45). (D) Protein sequences of the CT of 7 P-MLVs with CT recombination breakpoints compared to parental MLV ERVs. Gray highlights identify regions of recombination that lie within the indicated sequence, the blue arrow marks the R-peptide cleavage site, and a red box identifies the common replacement.

on November 7, 2019 by guest

http://jvi.asm.org/

shorter HR2 that loops back and fits into the grooves formed by three HR1 helices to

form the six-helix bundle.

The segment of TM that encodes HR1 shows substantial and consistent sequence

differences between the six lymphomagenic and six nonlymphomagenic viruses

(Fig. 6A), while the rest of the MLV TM is highly conserved except for the C terminus

of the CT R peptide as noted above. There are 10 replacement mutations in the HR1

region that distinguish pathogenic and nonpathogenic viruses, 9 of which are within

the N-terminal end of HR1. The HR1 helix has a repeating pattern of seven residues

(designated a to g) with hydrophilic residues at the a and d positions. Three of the

observed substitutions are at these a or d positions, but all involve allowable I, L or V

residues. Five of the other seven substitutions add or subtract charged residues

(Fig. 6A).

HR1 residues present an anionic surface complementary to the cationic HR2, so

these five charge-changing substitutions likely have structural consequences. To

ex-amine the possibility that the removal or addition of charged residues could affect

electrostatic interactions that maintain the shape or stability of this six-helix bundle, we

modeled the coiled-coil structures of one lymphomagenic virus, AKR-L4, and one

nonlymphomagenic virus,

Akv2

-M66, based on the structure of the Mason-Pfizer

mon-key virus (MPMV; PDB

4JF3

) (Fig. 6B and C). We then performed a molecular dynamics

(MD) analysis to evaluate residue substitutions for their predicted impact on structural

integrity and stability (see Movie S1 in the supplemental material). At the beginning of

the simulation, three of the chloride ions added to the free ends of the structures

diffused away, but the coiled-coil structures remain intact throughout the course of the

MD simulation and the fourth chloride ion embedded at the other end of the structure

remained in place (Fig. 6B). Overall, the structures remain the same for the two viruses.

Although there are no substitutions that alter the three residues involved in previously

described salt bridges in gammaretroviruses (58), the introduction of ionizable residues

in AKR-L4 likely leads to the formation of novel salt bridges, as well as increases the

frequency of formation of an existing salt bridge, increasing interdomain stability

relative to

Akv2

-M66 (Fig. 6B, C, and D). Salt bridges (depending on where they reside,

either at the solvent interface or buried) can contribute anywhere from 0 to

⫺

5

kcal/mol stability to a protein. Specifically, the MD simulations suggest that novel

FIG 5P-MLV substitutions that alter the target of the Fv1 restriction factor. Three P-MLVs haveXmv(green) orPmv(red) substitutions in the Fv1 target region in capsid. P-MLV sequences are compared to prototype MLVs with Fv1 N-tropism (AKV) and B-tropism (WN1802B) and with their likely ERV progenitors. Numbers identify residues that affect sensitivity to Fv1; residue 110 is the major determinant of N- or B-tropism.

on November 7, 2019 by guest

http://jvi.asm.org/

FIG 6Substitution of the HR1 of TMenvis linked to pathogenesis. (A) Sequence variation in 12 P-MLVs within the minimum Env segment that distinguishes all lymphomagenic from all nonlymphomagenic viruses. At the top is shown the domain structure of the TM Env. Sequences are compared to AKV E-MLV andPmv13. Marked are eight substitutions that alter charge or that change the key a or d heptad repeat sites. Blue arrows mark residues involved in altered salt bridge formation. (B) Predicted structures of the six-helix bundles of the lymphomagenic virus AKR-L4, and the nonlymphomagenic virusAkv2-M66 based on the structure of MPMV (PDB 4JF3), models used for molecular dynamics simulations (see Movie S1 in the supplemental material). Key residues are labeled, and the chloride ion that stabilizes the structure is represented by a green ball. An enlargement of the predicted HR1-HR2 interfaces shows key residues that are likely to form salt bridges. (C) Models of the two predicted trimers of heterodimers. Residues that distinguish the two are labeled, and the chloride ion is shown as a green ball. (D) Predicted frequency of formation of five HR1-HR2 interdomain salt bridges in the lymphomagenic and nonlymphomagenic P-MLVs.

on November 7, 2019 by guest

http://jvi.asm.org/

interdomain salt-bridges are formed in AKR-L4 between the side chain of HR2 residue

R113 (common to both

Akv2

-M66 and AKR-L4) and the side chains of HR1 residues D45

and E49, both of which are found only in AKR-L4 (Fig. 6B, C, and D). In addition, the

predicted frequency of an existing, interdomain, neighboring salt-bridge forming

be-tween the side chains of R113 and D46 common to both viruses increases in AKR-L4

compared to

Akv2

-M66 (Fig. 6D). In AKR-L4, a third predicted interdomain and novel

salt bridge forms between E49 and K109, and E49 is also involved in an H-bond with

S106.

Viral segments linked to pathogenicity: LTR.

Previous studies had variously

associated the oncogenic potential of MLVs with three different types of LTR variations:

replacement of the

Emv

LTR with the

Bxv1

LTR (25, 26), duplication of the U3 LTR

enhancer (11, 59, 60), and specific mutations in the transcription factor binding sites in

the enhancer (61–64). These changes are all found in our six lymphomagenic P-MLVs,

and none are in the six nonlymphomagenic P-MLVs, but no single change characterizes

all six pathogenic viruses (Table 4).

Five of the six pathogenic viruses have enhancer duplications; these involve

differ-ent but overlapping U3 sequences, four of which have

Bxv1

-like LTRs (Table 4). In

contrast, all six of the nonpathogenic P-MLVs retain

Emv

-like sequences in the U3

region of the LTR, and none of these viruses have enhancer repeats.

The MLV enhancer contains multiple binding sites for nuclear factors affecting

transcription. Alterations in one or both of two of these binding sites, NF1 and core, are

found in the lymphomagenic viruses and in none of the nonlymphomagenic viruses.

Emv

s differ from

Bxv1

at both of these sites, and four lymphomagenic P-MLVs have

Bxv1

U3 sequences with the

Bxv1

variants of NF1 and core (Table 4). Two viruses, PTV-1 and

MCF1233, have largely

Emv

-like LTRs but differ from

Emv

s at either core (PTV-1) or NF1

(MCF1233), and these differences are generated by different mechanisms. The

MCF1233 U3 is a complicated recombinant of

Emv2

and

Bxv1

(Fig. 1) (29). PTV-1 has an

Emv

-like LTR with an

Emv

-like NF1 sequence but carries two copies of a mutated core

sequence not found in

Bxv1

or

Emv

(Table 4); this variant core sequence is also found

in the E-MLV variant SL3-3 and is responsible for the pathogenic phenotype of this virus

(64).

P-MLVs not typed for pathogenesis.

We sequenced four P-MLVs not formally

evaluated for pathogenic potential (Table 1). Based on their LTR and HR1

env

sequences,

Virus/ERV

U3 type

Duplication size (bp)a

Core and NF1 sequence

Emv Bxv1 Core NF1

Progenitors

Emv2 X TGTGGTCAA CGGCCCAGGGCCAA

Bxv1 X TGTGGTCGA CGGCTCAGGGCCAA

Recombinantsb

AKR13 (L) X 70 Bxv1 Bxv1

MCF247 (L) X 109 Bxv1 Bxv1

AKR-L3 (L) X 98 Bxv1 Bxv1

AKR-L4 (L) X 69 Bxv1 Bxv1

PTV-1 (L) X 98 TGTGGTTGG Emv

MCF1233 (L) X X Emv Bxv1

Akv2-M66 (NL) X Emv Emv

Akv2-C78 (NL) X Emv Emv

Akv2-C25 (NL) X Emv Emv

C58v1-C77 (NL) X Emv Emv

Fgv1-C647 (NL) X Emv Emv

CB208 (NL) X Emv Emv

C58v2MCF X Emv Emv

M965Akv1-MCF X Emv Emv

Akv1-C44-1 X Emv Emv

C58/J#1thyMCF X Bxv1 Bxv1

a_{LVb, core, and NF1 are included in all duplications. GRE is included in MCF247, AKR-L3, and PTV-1.} b_{L, lymphomagenic; NL, nonlymphomagenic.}

on November 7, 2019 by guest

http://jvi.asm.org/

we can make predictions about their pathogenic potential. Three of these viruses

resemble the nonlymphomagenic viruses in that they have an

Emv

-like LTR with

Emv

-like NF1 and core sites, and no enhancer duplications; all three have

env

substi-tutions with

Pmv

-like HR1 sequences. The fourth virus, C58thy#1, has a

Bxv1

-like LTR

and an E-MLV-like HR1. C58thy#1 thus shares several features with the six pathogenic

viruses and is thus likely to be the only one of these untested four P-MLVs that may be

oncogenic.

DISCUSSION

It has long been recognized that retroviral recombination is a common occurrence

that generates ERV diversity in many species (65, 66) and is associated with

virus-induced disease in mice, as well as in other species (67). Early efforts to characterize

recombinant P-MLVs focused on host range and regulatory changes and therefore

concentrated on the substitutions and mutations in

env

and the LTR. These studies

produced an incomplete description of these recombinant viruses and therefore, to

provide a more complete picture of their generation and the genetic basis for their

pathogenic potential, we carried out a comprehensive analysis of biologically cloned

and phenotypically characterized infectious P-MLVs.

This analysis shows that replacement of the progenitor E-MLV genome with

non-ecotropic sequences by recombination is more extensive than previously appreciated,

as replacements in this panel of 16 viruses cover the entire viral genome. The

contri-butions from X-ERVs and P-ERVs to the recombinant genomes were extensive (7.4

versus 5.2 kb, respectively), but their genomic coverage is quite different due to some

obvious functional constraints imposed by the receptor determining region of Env and

by the Gag regions subject to restriction by APOBEC3 and Fv1.

It is not surprising to find that so much of these recombinant genomes is derived

from

Xmv

s, since the major contributor, the

Bxv1 Xmv

, is a functional provirus capable

of producing infectious virus.

Bxv1

is also easily activated by immune stimulation (68);

and

Bxv1

-like viruses have been found in mice with human xenografts, and in leukemic

or preleukemic tissues (69–71).

Xmv

-derived replacement sequences were, however,

specifically excluded from the P-MLV RBD

env

because such substitutions would

pro-duce viruses incapable of infecting their mouse hosts which lack a functional XPR1

X-MLV receptor (48–50). While 9 of the 16 P-MLVs have

Xmv

substitutions in LTR or

coding regions, there was no consistent

Xmv

replacement.

The fact that

Pmv

sequences replaced 5.2 kb of the viral genome indicates that at

least this much of the consensus

Pmv

genome is functional, although no replicating

viruses derived from individual P-ERVs have been identified. All P-MLVs shared

Pmv

-derived replacements in one 350-bp segment of the viral genome which encodes the

N terminus of RBD, a region responsible for receptor choice (46).

Pmv

sequences were largely excluded from four segments of the genome:

gag

,

pro

,

RT

pol

, and LTR. The absence of

Pmv

sequences from

gag

is likely due to the fact that

such substitutions would have made these viruses vulnerable to

Apobec3

and

Fv1

host

restrictions. This restriction may also account for the general absence of

Pmv

sequences

in the adjacent 5=

pol

, since examination of this segment in likely

Pmv

progenitors

identified no novel replacement mutations that distinguish these ERVs from functional

X- or E-MLVs. The exclusion of P-ERV LTR sequences from the replicating P-MLVs likely

results from the fact that all P-MLV ERV LTRs contain a negative regulatory element (72)

and a 190-bp (bp) LTR insertion (73) that disrupts the U3 enhancer region. Although

there is evidence that these LTRs have some transcriptional activity (74), no infectious

viruses carry this 190-bp insertion.

The consistent replacement of the N terminus of the RBD makes sense because this

segment controls receptor choice (46), and all of the analyzed P-MLVs were isolated for

their ability to infect both mink and mouse cells. Surprisingly, this replacement was

consistently paired with replacement of the CT R peptide in all 16 P-MLVs. It has long

been known that the 16 to 20 residues at the MLV C terminus are removed by cleavage

in the virion (75), although such cleavage does not occur in other retroviruses, like

on November 7, 2019 by guest

http://jvi.asm.org/

HIV-1. The presence of the uncleaved MLV R peptide in cell-associated Env

glycopro-teins suppresses the fusogenicity of Env (52, 53), and this is the case for both xenotropic

and ecotropic MLVs (76). The full-length R peptide thus limits the expression of a

cytotoxic molecule on the cell surface. Studies with other retroviruses have shown that

modifications of the CT, including truncation, can alter the conformation, stability, and

fusogenicity of the Env ectodomains of HIV-1, SIV, and HTLV-1 (77–80); such

modifica-tions can also regulate viral Env incorporation and cell surface expression, cause a

switch from CD4 to CD8 receptor use by HIV-1 (81), and alter the infectivity of other

retroviruses (82). All of this suggests that CT regulates the conformation and receptor

interactions of the external portions of Env, and our results suggest that the efficiency

of these inter-Env regulatory interactions in MLVs may be sequence subtype specific.

All six pathogenic viruses differed from all six nonpathogenic viruses in two regions:

the LTR and

env

. There was no single, consistent change in the LTR associated with

pathogenesis, although all six pathogenic viral LTRs were modified by recombination,

duplication, or mutation, changes found in none of the nonlymphomagenic viruses.

The six pathogenic viruses were isolated from three different inbred strains, but the

four viruses from AKR mice all had LTRs derived from the

Bxv1 Xmv

, as well as enhancer

duplications, suggesting that the inbred strain background may influence the

gener-ation of MLV recombinants (83, 84).

A set of transcription factor binding sites—LVb, core, NF1, and GRE—are common

to gammaretroviral enhancers and are described as the enhancer framework (85).

Mutations at these sites are linked to enhanced transcription in lymphoid cells (62,

86–88) and to disease phenotypes (61–64), and the U3 duplications in highly

leuke-mogenic viruses generally include these binding sites (62), although the enhancer

duplications in our panel all include LVb, core, and NF1, but not GRE. Our panel of

viruses show mutational differences in two of these sites, NF1 and core, differences that

are not found in any of our nonpathogenic viruses. The mutation found in the PTV-1

core has been linked to increased pathogenicity of the SL3-3 E-MLV (64).

P-ERV replacements in

env

are found in all P-MLVs. Comparison of these

replace-ments in our lymphomagenic and nonlymphomagenic viruses failed to identify

distin-guishing sequence differences in the RBD

env

but established that the size difference of

the

env

replacement (17) specifically implicates the HR1 segment of the viral TM

env

in

leukemogenesis. This region is highly polymorphic between these two different P-MLV

subsets, although most of the rest of their TM

env

ectodomain is highly conserved,

including the adjacent ISD, which has been linked to immune tolerance in various

viruses (89). There are several possible explanations for a role of HR1 in disease. First,

the trimeric structure generated by the HR1 and HR2 regions functions in cell fusion

and virus entry, and the stability of this structure could be compromised by

replace-ments involving charged residues that alter electrostatic interactions as suggested by

molecular dynamics (90). The added salt bridges likely generated by the substitutions

in the pathogenic viruses could affect the energy of folding/unfolding the structure

upon membrane fusion. The importance of these salt bridges is supported by analysis

of a structurally important mutation in the comparable region of the HIV-1 Env that is

associated with resistance to HR1 and HR2 binding peptides (90). However, although

mutations in the HIV-1 HR1 can produce Envs that are infection and fusion defective

(91), all 16 P-MLVs grow to equivalent high titers in mouse cells, although there may be

subtle effects on entry as previous studies have reported some differences in the

relative infectivity of some lymphomagenic and nonlymphomagenic isolates on cells

carrying variants of the XPR1 receptor (92).

A second possible explanation for the HR1 link to pathogenesis is based on the

location of the HR1 in the TM ectodomain making it a potential target for restriction by

host-generated antibodies that could interfere with virus (93, 94). Inhibitors targeting

HR1 salt bridges have shown antiviral activity affecting HIV-1 membrane fusion (95, 96),

and other changes in the gp41 ectodomain can influence HIV-1 sensitivity to inhibition

by gp120 inhibitors or to anti-Env antibodies (91). The predicted additional salt bridges

in the lymphomagenic P-MLVs could also make this structure less accessible to antiviral

on November 7, 2019 by guest

http://jvi.asm.org/

antibodies. Alternatively, high leukemic mouse strains such as AKR produce infectious

E-MLVs from birth, and the susceptibility of AKR mice to disease by P-MLVs with an

Emv

-like HR1 may result from their development of tolerance to E-MLVs. Evaluation of

some of the class I and II P-MLVs for their ability to establish infection (16) found that

lymphomagenic but not nonlymphomagenic viruses could be recovered from

inocu-lated AKR mice, suggesting that viruses that retain the

Emv

HR1 may not be subject to

elimination in mice expressing high levels of E-MLV.

Our data, together with previous studies on P-MLVs, identify several genetic links

between specific viral motifs and P-MLV phenotypes. First, all P-MLVs are marked by

Pmv

substitutions in RBD and CT, suggesting that these polymorphic segments act in

concert to produce the P-MLV host range. Second, pathogenic potential is linked to two

distinct segments of the host genome. Substitutions in core or NP-1 mark all six

leukemogenic viruses and have also been observed in other leukemogenic MLVs,

including E-MLVs where mutagenesis has confirmed their association with

pathogen-esis. The second segment common to leukemogenic but not nonleukemogenic viruses

is retention of the E-MLV HR1. While it is possible that small decreases in the efficiency

of cell fusion could amplify during a spreading infection, we see, at best, minor effects

on infection. Instead, it is more likely that the E-MLV HR1 is more tolerated in the AKR

mouse, which carries high titers of circulating E-MLVs from birth and may become

sensitized to this segment of the TM

env

.

MATERIALS AND METHODS

Viruses.Fifteen P-MLVs were previously isolated from neoplasms or from lymphoid tissues from highly leukemic mice (AKR, C58, and HRS) or from congenic strains (Table 1) in which specificEmvloci from mice with high incidence of early leukemia (AKR, C58, and C3H/Fg) had been transferred onto the E-MLV-free Swiss-derived NFS/N mouse strain by serial backcrossing, as described previously (97). PTV-1 was originally isolated by Green and coworkers (30). One previously sequenced pathogenic P-MLV was included in this analysis, MCF1233 (GenBank accession no.U13766), and partial LTR andenvsequences are available for PTV-1 (S71537); AKR13, also termed MCF13 (X05667); and MCF247 (K02727,K00526, J02248,J02249, andAH002376). Eleven of these viruses were tested for their ability to accelerate disease in AKR/J mice, and the B-tropic CB208 was also tested inFv1b_{BALB/c mice (16); MCF1233 was tested for}

pathogenicity in C57BL (29).

MLV ERV identification in mouse strains.Primer sets developed to identify diagnostic virus-cell junction fragments for 43Pmvs,Mpmvs, andXmvs found in the sequenced C57BL genome (34, 35) were used to screen for the presence or absence of these individual ERVs in DNAs of the mouse strains that produced the 16 sequenced viruses. Mouse DNAs were obtained from The Jackson Laboratory (Bar Harbor, ME) or were isolated prior to 1985 from mice maintained in our laboratory.

P-MLV sequencing and analysis.The P-MLV genomes were sequenced from genomic DNAs of newly infected mink lung cells (ATCC CCL64), MA139 ferret cells (Microbiological Associates, Bethesda, MD), or M. dunni cells (98). Most of the primers used to amplify overlapping viral segments for sequencing had been previously described (41). Additional oligonucleotides used as forward and reverse primers were as follows: DG75gag, 5=-GGACATTATTTTACAGGTTAAA; MLVpol2, 5=-GACGGCAGGCTTCTG TCGCCTCTGGATCC; and Xtm, 5=-TCAGGACAAGGGTGGTTTGAG. TheEmv3genome found in HRS mice was amplified from DBA/2 mouse DNA using theEmv-specific primers Emv1470 (CTTACCGGGGAGGAG AAGCAG), Emv2130 (CTTGACAAGGATCAATGTGCC), Emv4580 (CCATAAAGACGCCTCCAGATAC), Emv4820 (CCTCGGCTACCAGAAAATG), Eco150 (CGAGAAACGGTGTGGGCAATAAC), Emv7480 (CACACAGGATTGGTA CGG), and AKP30 (GCTTTCCCACTCCGTTTGG). PCR products were cloned into pCR2.1-TOPO and then sequenced.

The sequenced P-MLVs were initially compared to three sequenced Emvs:Emv2 (C57BL) (Chr8: 123425507-123434150, GRCm38/mm10),Emv30(NOD) (99) (KJ668271), andEmv3, and were also com-pared to twoEmv-derived infectious E-MLVs: theEmv1-derived virus isolated from A/J mice (GenBank accession no.DQ366147) (100) and AKV MLV produced by the AKR strain E-ERVs (J01998) (101, 102). Homologies for segments notEmv-related were initially defined by BLAST or by BLAT searches (103) using the UCSC genome browser (http://genome.ucsc.edu/) and in nearly all cases mapped to specific previously identified nonecotropic ERVs (34, 35). Recombinant structures were further defined in se-quence alignments generated by Clustal Omega (104) or BioEdit (105) (http://www.mbio.ncsu.edu/ bioedit/bioedit.html) and in Hypermut plots generated using online tools (www.hiv.lanl.gov/content/ sequence/HYPERMUT/hypermut.html) (106).

Reconstruction of an AKR mouse endogenous retrovirus sequence.The scaffolds from thede novoassembly for AKR mouse (assembly release REL-1302-Assembly) were provided by the Mouse Genomes group at the Wellcome Trust Sanger Institute and can be obtained from their FTP site (ftp://ftp-mouse.sanger.ac.uk/) (107). We searched for the endogenous retrovirus sequence in the scaffold sequences using BLAST⫹(version 2.2.26⫹[blast.ncbi.nlm.nih.gov]) (108) using as query a 793-bp seed sequence from the AKR13 P-MLV genome at positions 6140 to 6932. We found one of these segments,

Akctg, spanning positions 6183 to 6933 of AKR13, in the partially sequenced AKR genome.

on November 7, 2019 by guest

http://jvi.asm.org/

We found high-identity hits spanning the entire query sequence on scaffold-484889 (query bases 38 to 770; 99.9% identity), scaffold-502095 (query bases 1 to 90, 100% identity), and scaffold-510061 (query bases 712 to 793; 100% identity), which we merged into a single scaffold. The full merged sequence is 1723 bp. BLAST searches of this sequence showed closest homology (98% coverage, 98% identify) to the small subset ofXmvs termedXmvIV(41).

Homology modeling.Sequences comprising the N-terminal heptad repeat (HR1), linker, and the C-terminal heptad repeat (HR2) for the transmembrane domains of the viral envelope proteins of MLVs

Akv2-M66 and AKR-L4 strains were submitted to the Phyre2 homology modeling program (109). Top scoring homology models for AKV2-M66 and AKR-L4 were retained for further study and were generated by using the fusion core from the Mason-Pfizer monkey virus (MPMV) as a template (PDB 4JF3). Coiled-coil models were constructed using the SYBYL program (Certara) by superimposing three copies of the Phyre2-generated models onto a crystal structure of the MPMV fusion core.

Molecular dynamics simulation.Coiled-coil models for MLV AKV2-M66 and AKR-L4 were subjected to an all atom, isobaric-isothermal (1 atm, 310 K) MD simulation performed using AceMD (110) on the Locus Linux cluster at the National Institute of Allergy and Infectious Diseases (NIAID), Bethesda, MD. The complex was explicitly solvated with TIP3P water and neutralized through the addition of counterions (Na⫹_{and Cl}⫺_{to 0.15 M). Periodic boundary conditions were applied. Electrostatic interactions were} calculated using the Particle-Mesh Ewald summation with grid spacing of 1 Å, along with a 9-Å nonbonded cutoff and a 7.5-Å switching distance. A CHARMM27 force field, including CMAP correction, was used (111). The system was energy minimized using a conjugate gradient method to a gradient of 5 kcal/mol·Å (total of 2,000 steps), followed by 25,000 steps of simulation using a canonical ensemble, followed by 100,000 steps of isobaric-isothermal simulation. For the energy minimization and canonical ensemble simulation, Langevin dynamics was used employing a damping constant gamma of 1/ps and a Berendsen barostat with a Berendsen pressure target of 1 atm (1.01325⫻105_{Pa), a relaxation time of}

800 fs and a compressibility factor of 4.57 Pa. For the canonical ensemble, an initial Langevin temperature of 0 K was used, along with a set point of 310 K. For the isobaric-isothermal portion of the simulation, no barostat was applied, and the Langevin damping constant gamma of 0.1/ps was used. A 4-fs integration time step was applied by making use of a hydrogen mass repartitioning scheme (112), resulting in a total run time for the isobaric-isothermal simulation of 400 ns. Four chloride ions were added to the coiled-coil models based on their analogous positions in the MPMV crystal structure prior to starting the simulations.

Accession number(s).Sequences of the 15 P-MLV genomes were deposited in GenBank under accession numbersKY574504toKY574518, and that of theEmv3E-ERV was deposited under accession numberKY574519.

SUPPLEMENTAL MATERIAL

Supplemental material for this article may be found at

https://doi.org/10.1128/JVI

.00855-17

.

SUPPLEMENTAL FILE 1,

MP4 file, 6.8 MB.

SUPPLEMENTAL FILE 2,

PDF file, 0.1 MB.

ACKNOWLEDGMENTS

We thank Malcolm Martin and Guney Boso for helpful discussions.

This study was supported by the Intramural Research Program of the National

Institute of Allergy and Infectious Diseases, Bethesda, MD.

REFERENCES

1. Kozak CA. 2015. Origins of the endogenous and infectious laboratory mouse gammaretroviruses. Viruses 7:1–26. doi:https://doi.org/10.3390/ v7010001.

2. Jenkins NA, Copeland NG, Taylor BA, Lee BK. 1982. Organization, dis-tribution, and stability of endogenous ecotropic murine leukemia virus DNA sequences in chromosomes ofMus musculus. J Virol 43:26 –36. 3. O’Neill RR, Khan AS, Hoggan MD, Hartley JW, Martin MA, Repaske R.

1986. Specific hybridization probes demonstrate fewer xenotropic than mink cell focus-forming murine leukemia virusenv-related sequences in DNAs from inbred laboratory mice. J Virol 58:359 –366.

4. Fischinger PJ, Nomura S, Bolognesi DP. 1975. A novel murine oncor-navirus with dual eco- and xenotropic properties. Proc Natl Acad Sci U S A 72:5150 –5155.https://doi.org/10.1073/pnas.72.12.5150. 5. Hartley JW, Wolford NK, Old LJ, Rowe WP. 1977. New class of murine

leukemia-virus associated with development of spontaneous lympho-mas. Proc Natl Acad Sci U S A 74:789 –792.https://doi.org/10.1073/pnas .74.2.789.

6. Cloyd MW, Hartley JW, Rowe WP. 1979. Cell-surface antigens associated with recombinant mink cell focus-inducing murine leukemia viruses. J Exp Med 149:702–712.https://doi.org/10.1084/jem.149.3.702.

7. Herr W, Gilbert W. 1983. Somatically acquired recombinant murine leukemia proviruses in thymic leukemias of AKR/J mice. J Virol 46: 70 – 82.

8. Buller RS, Sitbon M, Portis JL. 1988. The endogenous mink cell focus-forming (MCF) gp70 linked to theRmcfgene restricts MCF virus repli-cation in vivo and provides partial resistance to erythroleukemia in-duced by Friend murine leukemia virus. J Exp Med 167:1535–1546. https://doi.org/10.1084/jem.167.5.1535.

9. Brightman BK, Rein A, Trepp DJ, Fan H. 1991. An enhancer variant of Moloney murine leukemia virus defective in leukemogenesis does not generate detectable mink cell focus-inducing virusin vivo. Proc Natl Acad Sci U S A 88:2264 –2268.https://doi.org/10.1073/pnas.88.6.2264. 10. Fan H. 1997. Leukemogenesis by Moloney murine leukemia virus: a multistep process. Trends Microbiol 5:74 – 82.https://doi.org/10.1016/ S0966-842X(96)10076-7.

11. Stoye JP, Moroni C, Coffin JM. 1991. Virological events leading to spontaneous AKR thymomas. J Virol 65:1273–1285.

12. Evans LH. 1986. Characterization of polytropic MuLVs from three-week-old AKR/J mice. Virology 153:122–136. https://doi.org/10.1016/0042 -6822(86)90013-9.

on November 7, 2019 by guest

http://jvi.asm.org/

13. Rosenberg N, Jolicoeur P. 1997. Retroviral pathogenesis, p 475–586.In

Coffin JM, Hughes SH, Varmus HE (ed), Retroviruses. Cold Spring Harbor Laboratory Press, Woodbury, NY.

14. Suzuki T, Shen H, Akagi K, Morse HC, Malley JD, Naiman DQ, Jenkins NA, Copeland NG. 2002. New genes involved in cancer identified by retro-viral tagging. Nat Genet 32:166 –174.https://doi.org/10.1038/ng949. 15. Rudali G, Duplan JF, Latarjet R. 1956. Latency of leukosis in Ak mice

injected with leukemic alpha-cellular Ak extract. C R Hebd Seances Acad Sci D 242:837– 839. (In French.)

16. Cloyd MW, Hartley JW, Rowe WP. 1980. Lymphomagenicity of recom-binant mink cell focus-inducing murine leukemia viruses. J Exp Med 151:542–552.https://doi.org/10.1084/jem.151.3.542.

17. Chattopadhyay SK, Cloyd MW, Linemeyer DL, Lander MR, Rands E, Lowy DR. 1982. Cellular origin and role of mink cell focus-forming viruses in murine thymic lymphomas. Nature 295:25–31.https://doi.org/10.1038/ 295025a0.

18. Elder JH, Gautsch JW, Jensen FC, Lerner RA, Hartley JW, Rowe WP. 1977. Biochemical evidence that MCF murine leukemia viruses are envelope (env) gene recombinants. Proc Natl Acad Sci U S A 74:4676 – 4680. https://doi.org/10.1073/pnas.74.10.4676.

19. Rommelaere J, Faller DV, Hopkins N. 1978. Characterization and map-ping of RNase T1-resistant oligonucleotides derived from the genomes of Akv and MCF murine leukemia viruses. Proc Natl Acad Sci U S A 75:495– 499.https://doi.org/10.1073/pnas.75.1.495.

20. Chien YH, Verma IM, Shih TY, Scolnick EM, Davidson N. 1978. Hetero-duplex analysis of the sequence relations between the RNAs of mink cell focus-inducing and murine leukemia viruses. J Virol 28:352–360. 21. Khan AS, Rowe WP, Martin MA. 1982. Cloning of endogenous murine

leukemia virus-related sequences from chromosomal DNA of BALB/c and AKR/J mice: identification of an env progenitor of AKR-247 mink cell focus-forming proviral DNA. J Virol 44:625– 636.

22. Holland CA, Wozney J, Hopkins N. 1983. Nucleotide sequence of the gp70 gene of murine retrovirus MCF 247. J Virol 47:413– 420. 23. Lung ML, Hartley JW, Rowe WP, Hopkins NH. 1983. Large RNase

T1-resistant oligonucleotides encoding p15E and the U3 region of the long terminal repeat distinguish two biological classes of mink cell focus-forming type C viruses of inbred mice. J Virol 45:275–290. 24. Thomas CY, Coffin JM. 1982. Genetic alterations of RNA leukemia

viruses associated with the development of spontaneous thymic leu-kemia in AKR/J mice. J Virol 43:416 – 426.

25. Quint W, Boelens W, van Wezenbeek P, Cuypers T, Maandag ER, Selten G, Berns A. 1984. Generation of AKR mink cell focus-forming viruses: a conserved single-copy xenotrope-like provirus provides recombinant long terminal repeat sequences. J Virol 50:432– 438.

26. Hoggan MD, O’Neill RR, Kozak CA. 1986. Nonecotropic murine leukemia viruses in BALB/c and NFS/N mice: characterization of the BALB/cBxv-1

provirus and the single NFS endogenous xenotrope. J Virol 60:980 –986. 27. Kelly M, Holland CA, Lung ML, Chattopadhyay SK, Lowy DR, Hopkins NH. 1983. Nucleotide sequence of the 3=end of MCF 247 murine leukemia virus. J Virol 45:291–298.

28. Holland CA, Thomas CY, Chattopadhyay SK, Koehne C, O’Donnell PV. 1989. Influence of enhancer sequences on thymotropism and leuke-mogenicity of mink cell focus-forming viruses. J Virol 63:1284 –1292. 29. Sijts EJ, Leupers CJ, Mengede EA, Loenen WA, van den Elsen PJ, Melief

CJ. 1994. Cloning of the MCF1233 murine leukemia virus and identifi-cation of sequences involved in viral tropism, oncogenicity and T cell epitope formation. Virus research 34:339 –349.https://doi.org/10.1016/ 0168-1702(94)90133-3.

30. Green N, Hiai H, Elder JH, Schwartz RS, Khiroya RH, Thomas CY, Tsichlis PN, Coffin JM. 1980. Expression of leukemogenic recombinant viruses associated with a recessive gene in HRS/J mice. J Exp Med 152: 249 –264.https://doi.org/10.1084/jem.152.2.249.

31. Theodore TS, Khan AS. 1987. Nucleotide sequence analysis of long terminal repeats of leukemogenic and nonleukemogenic MCF MuLVs. Nucleic Acids Res 15:5898.https://doi.org/10.1093/nar/15.14.5898. 32. Stoye JP, Coffin JM. 1988. Polymorphism of murine endogenous

pro-viruses revealed by using virus class-specific oligonucleotide probes. J Virol 62:168 –175.

33. Frankel WN, Stoye JP, Taylor BA, Coffin JM. 1990. A linkage map of endogenous murine leukemia proviruses. Genetics 124:221–236. 34. Jern P, Stoye JP, Coffin JM. 2007. Role of APOBEC3 in genetic diversity

among endogenous murine leukemia viruses. PLoS Genet 3:e183. https://doi.org/10.1371/journal.pgen.0030183.

35. Bamunusinghe D, Liu Q, Lu X, Oler A, Kozak CA. 2013. Endogenous

gammaretrovirus acquisition inMus musculussubspecies carrying func-tional variants of the XPR1 virus receptor. J Virol 87:9845–9855.https:// doi.org/10.1128/JVI.01264-13.

36. Alamgir AS, Owens N, Lavignon M, Malik F, Evans LH. 2005. Precise identification of endogenous proviruses of NFS/N mice participating in recombination with Moloney ecotropic murine leukemia virus (MuLV) to generate polytropic MuLVs. J Virol 79:4664 – 4671.https://doi.org/10 .1128/JVI.79.8.4664-4671.2005.

37. Evans LH, Alamgir AS, Owens N, Weber N, Virtaneva K, Barbian K, Babar A, Malik F, Rosenke K. 2009. Mobilization of endogenous retroviruses in mice after infection with an exogenous retrovirus. J Virol 83: 2429 –2435.https://doi.org/10.1128/JVI.01926-08.

38. Stoye JP, Fenner S, Greenoak GE, Moran C, Coffin JM. 1988. Role of endogenous retroviruses as mutagens: the hairless mutation of mice. Cell 54:383–391.https://doi.org/10.1016/0092-8674(88)90201-2. 39. Kozak CA, Rowe WP. 1980. Genetic mapping of xenotropic murine

leukemia virus-inducing loci in five mouse strains. J Exp Med 152: 219 –228.https://doi.org/10.1084/jem.152.1.219.

40. Frankel WN, Stoye JP, Taylor BA, Coffin JM. 1989. Genetic analysis of endogenous xenotropic murine leukemia viruses: association with two common mouse mutations and the viral restriction locus Fv-1. J Virol 63:1763–1774.

41. Bamunusinghe D, Naghashfar Z, Buckler-White A, Plishka R, Baliji S, Liu Q, Kassner J, Oler A, Hartley J, Kozak CA. 2016. Sequence diversity, intersubgroup relationships, and origins of the mouse leukemia gam-maretroviruses of laboratory and wild mice. J Virol 90:4186 – 4198. https://doi.org/10.1128/JVI.03186-15.

42. Zhuang J, Mukherjee S, Ron Y, Dougherty JP. 2006. High rate of genetic recombination in murine leukemia virus: implications for influencing pro-viral ploidy. J Virol 80:6706 – 6711.https://doi.org/10.1128/JVI.00273-06. 43. Jahid S, Bundy LM, Granger SW, Fan H. 2006. Chimeras between SRS

and Moloney murine leukemia viruses reveal novel determinants in disease specificity and MCF recombinant formation. Virology 351:7–17. https://doi.org/10.1016/j.virol.2006.03.010.

44. Jung YT, Wu T, Kozak CA. 2003. Characterization of recombinant non-ecotropic murine leukemia viruses from the wild mouse speciesMus spretus. J Virol 77:12773–12781.https://doi.org/10.1128/JVI.77.23.12773 -12781.2003.

45. Fass D, Davey RA, Hamson CA, Kim PS, Cunningham JM, Berger JM. 1997. Structure of a murine leukemia virus receptor-binding glycopro-tein at 2.0 angstrom resolution. Science 277:1662–1666. https://doi .org/10.1126/science.277.5332.1662.

46. Battini JL, Heard JM, Danos O. 1992. Receptor choice determinants in the envelope glycoproteins of amphotropic, xenotropic, and polytropic murine leukemia viruses. J Virol 66:1468 –1475.

47. Albritton LM, Tseng L, Scadden D, Cunningham JM. 1989. A putative murine ecotropic retrovirus receptor gene encodes a multiple membrane-spanning protein and confers susceptibility to virus infec-tion. Cell 57:659 – 666.https://doi.org/10.1016/0092-8674(89)90134-7. 48. Tailor CS, Nouri A, Lee CG, Kozak C, Kabat D. 1999. Cloning and

characterization of a cell surface receptor for xenotropic and polytropic murine leukemia viruses. Proc Natl Acad Sci U S A 96:927–932.https:// doi.org/10.1073/pnas.96.3.927.

49. Battini JL, Rasko JE, Miller AD. 1999. A human cell-surface receptor for xenotropic and polytropic murine leukemia viruses: possible role in G protein-coupled signal transduction. Proc Natl Acad Sci U S A 96: 1385–1390.https://doi.org/10.1073/pnas.96.4.1385.

50. Yang Y-L, Guo L, Xu S, Holland CA, Kitamura T, Hunter K, Cunningham JM. 1999. Receptors for polytropic and xenotropic mouse leukaemia viruses encoded by a single gene at Rmc1. Nat Genet 21:216 –219. https://doi.org/10.1038/6005.

51. Lodge R, Lalonde JP, Lemay G, Cohen EA. 1997. The membrane-proximal intracytoplasmic tyrosine residue of HIV-1 envelope glycopro-tein is critical for basolateral targeting of viral budding in MDCK cells. EMBO J 16:695–705.https://doi.org/10.1093/emboj/16.4.695. 52. Ragheb JA, Anderson WF. 1994. pH-independent murine leukemia virus

ecotropic envelope-mediated cell fusion: implications for the role of the R peptide and p12E TM in viral entry. J Virol 68:3220 –3231. 53. Rein A, Mirro J, Haynes JG, Ernst SM, Nagashima K. 1994. Function of

the cytoplasmic domain of a retroviral transmembrane protein: p15E-p2E cleavage activates the membrane fusion capability of the murine leukemia virus Env protein. J Virol 68:1773–1781.

54. Nitta T, Lee S, Ha D, Arias M, Kozak CA, Fan H. 2012. Moloney murine leukemia virus glyco-gag facilitates xenotropic murine leukemia

on November 7, 2019 by guest

http://jvi.asm.org/

related virus replication through human APOBEC3-independent mech-anisms. Retrovirology 9:58.https://doi.org/10.1186/1742-4690-9-58. 55. Stavrou S, Nitta T, Kotla S, Ha D, Nagashima K, Rein AR, Fan H, Ross SR.

2013. Murine leukemia virus glycosylated Gag blocks apolipoprotein B editing complex 3 and cytosolic sensor access to the reverse transcrip-tion complex. Proc Natl Acad Sci U S A 110:9078 –9083.https://doi.org/ 10.1073/pnas.1217399110.

56. Hartley JW, Rowe WP, Huebner RJ. 1970. Host-range restrictions of murine leukemia viruses in mouse embryo cell cultures. J Virol 5:221–225.

57. Kozak CA, Chakraborti A. 1996. Single amino acid changes in the murine leukemia virus capsid protein gene define the target ofFv1

resistance. Virology 225:300 –305. https://doi.org/10.1006/viro.1996 .0604.

58. Aydin H, Cook JD, Lee JE. 2014. Crystal structures of beta- and gam-maretrovirus fusion proteins reveal a role for electrostatic stapling in viral entry. J Virol 88:143–153.https://doi.org/10.1128/JVI.02023-13. 59. Li Y, Golemis E, Hartley JW, Hopkins N. 1987. Disease specificity of

nondefective Friend and Moloney murine leukemia viruses is con-trolled by a small number of nucleotides. J Virol 61:693–700. 60. DiFronzo NL, Frieder M, Loiler SA, Pham QN, Holland CA. 2003.

Dupli-cation of U3 sequences in the long terminal repeat of mink cell focus-inducing viruses generates redundancies of transcription factor binding sites important for the induction of thymomas. J Virol 77: 3326 –3333.https://doi.org/10.1128/JVI.77.5.3326-3333.2003. 61. Yuen PH, Szurek PF. 1989. The reduced virulence of the thymotropic

Moloney murine leukemia virus derivative MoMuLV-TB is mapped to 11 mutations within the U3 region of the long terminal repeat. J Virol 63:471– 480.

62. Speck NA, Renjifo B, Golemis E, Fredrickson TN, Hartley JW, Hopkins N. 1990. Mutation of the core or adjacent LVb elements of the Moloney murine leukemia virus enhancer alters disease specificity. Genes Dev 4:233–242.https://doi.org/10.1101/gad.4.2.233.

63. Hallberg B, Schmidt J, Luz A, Pedersen FS, Grundstrom T. 1991. SL3-3 enhancer factor 1 transcriptional activators are required for tumor formation by SL3-3 murine leukemia virus. J Virol 65:4177– 4181. 64. Morrison HL, Soni B, Lenz J. 1995. Long terminal repeat enhancer core

sequences in proviruses adjacent to c-myc in T-cell lymphomas in-duced by a murine retrovirus. J Virol 69:446 – 455.

65. Tomonaga K, Coffin JM. 1998. Structure and distribution of endoge-nous nonecotropic murine leukemia viruses in wild mice. J Virol 72: 8289 – 8300.

66. Vargiu L, Rodriguez-Tome P, Sperber GO, Cadeddu M, Grandi N, Blik-stad V, Tramontano E, Blomberg J. 2016. Classification and character-ization of human endogenous retroviruses; mosaic forms are common. Retrovirology 13:7.https://doi.org/10.1186/s12977-015-0232-y. 67. Stewart MA, Warnock M, Wheeler A, Wilkie N, Mullins JI, Onions DE, Neil

JC. 1986. Nucleotide sequences of a feline leukemia virus subgroup A envelope gene and long terminal repeat and evidence for the recom-binational origin of subgroup B viruses. J Virol 58:825– 834. 68. Sherr CJ, Lieber MM, Todaro GJ. 1974. Mixed splenocyte cultures and

graft versus host reactions selectively induce an S-tropic murine type C virus. Cell 1:55–58.https://doi.org/10.1016/0092-8674(74)90155-X. 69. Chattopadhyay SK, Lander MR, Gupta S, Rands E, Lo