Copyright © 2001, American Society for Microbiology. All Rights Reserved.
Role of the Proline-Rich Motif of Bovine Leukemia Virus
Transmembrane Protein gp30 in Viral Load
and Pathogenicity in Sheep
M. REICHERT,1* A. WINNICKA,2L. WILLEMS,3R. KETTMANN,3ANDG. H. CANTOR4
National Veterinary Research Institute, Pulawy,1and Department of Internal Diseases, Faculty of Veterinary Medicine, Agricultural University, Warsaw,2Poland; Department of Applied Biochemistry and Biology, Faculty of
Agronomy, B-5030 Gembloux, Belgium3; and Department of Veterinary Microbiology and Pathology, Washington State University, Pullman, Washington 99164-70404
Received 17 January 2001/Accepted 1 June 2001
The cytoplasmic tail of bovine leukemia virus (BLV) transmembrane protein gp30 has multiple amino acid motifs that mimic those present in signaling proteins associated with B-cell and T-cell receptors. The proline-rich motif of gp30, PX2PX4–5P, is analogous to the recognition site of Src homology 3 (SH3) domains of
signaling molecules. Using site-directed mutagenesis of an infectious molecular clone of BLV, point mutations were introduced which changed three of the prolines of the motif to alanines. The influence of these mutations on the pathogenicity of BLV was studied in sheep which received either (i) plasmid DNA with provirus containing proline-to-alanine mutations (pppBLV), (ii) plasmid DNA with wild-type provirus (wtBLV), or (iii) transfection reagent alone. Although all of the BLV-injected animals seroconverted at approximately the same time, viral loads at later time points were high in five of five of the wtBLV group and two of five of the pppBLV group but low in three of five of the pppBLV group, as determined by semiquantitative PCR. Viral expression was lower in the pppBLV-transfected sheep, as measured by p24 antigen enzyme-linked immunosorbent assay in cultured cells, and serologic titers were lower. Thirty-one months after transfection, four of four wtBLV-transfected sheep had died of leukemia and lymphoma, and all five of the pppBLV-wtBLV-transfected sheep were clinically healthy and had normal peripheral blood lymphocyte counts. These data indicate that the proline-rich motif of gp30 is not required for viral infectivity but is important for high viral load in vivo, suggesting that SH3-mediated gp30 interactions are critical for viral pathogenesis following infection. Absence of inter-actions with the proline-rich motif may prevent or delay tumorigenesis in sheep.
Infection of cattle with bovine leukemia virus (BLV), a member of the BLV-human T-cell leukemia virus (HTLV) group of retroviruses, results in persistent lifelong infection, the mechanism of which is still poorly understood. The main target of BLV infection is the B lymphocyte expressing surface immunoglobulin M (IgM) (7). The clinical manifestations of this persistent infection are polyclonal expansion of B cells in many of the infected animals and lymphosarcoma in a small percentage of infected animals (4, 17). Available data suggest two possible mechanisms for this expansion: (i) the activity of the BLV transactivating protein Tax, and (ii) interactions of other BLV proteins with cellular proteins. It is indeed well documented that although BLV does not possess a typical oncogene in its genome, BLV Tax can behave as such (30, 31). Transforming properties of Tax are better documented in HTLV biology where it has been shown to transactivate a variety of genes or long terminal repeat (LTR) sequences, transcriptional enhancers, oncogenes, and interleukins (3). Another possible mechanism is the direct interaction of viral proteins other than Tax with lymphocyte signaling pathways, resulting in an increased rate of proliferation and/or reduced
B-cell apoptosis. Both phenomena are documented, although detailed interactions and proteins involved at each step are still not known (8, 9, 13).
BLV gp30, the transmembrane component of envelope gly-coprotein, can participate in signaling interactions (1, 2, 6, 29). BLV gp30 has a long cytoplasmic tail with several motifs, including an immunoreceptor tyrosine-based activation motif (ITAM), an immunoreceptor tyrosine-based inhibition motif (ITIM), and an upstream proline-rich motif (Src homology [SH] 3 recognition site motif) (5, 25). SH2 and SH3 motifs are found in a diverse collection of cellular proteins and are in-volved in downstream signaling events of receptors for growth factors, cytokines, hormones, antigens, and extracellular ma-trices in the control of cell growth, differentiation, migration, and death (20). ITAMs and ITIMs are recognition sites for the SH2 motif and are shared among a number of signaling pro-teins associated with the B-cell and T-cell antigen receptors (25) and in several viruses that infect B cells (5). Proline-rich sequences, especially with the sequence PX2PX4–5P, where X represents any amino acid, are recognition sites for the SH3 motif (24). The proline-rich motif in proximity to an ITAM is found not only in BLV gp30 but also in proteins of other viruses that infect B cells, including the herpesviruses Epstein-Barr virus LMP2A and herpesvirus papio LMP2A and the orbiviruses African horsesickness virus VP7 and epizootic hemorrhagic disease virus VP7 (5). The presence of this motif in unrelated viral groups led us to hypothesize that the proline-* Corresponding author. Mailing address: National Veterinary
Re-search Institute, Al. Partyzantow 57, 24-100 Pulawy, Poland. Phone: 48-81-8863051. Fax: 48-81-8862595. E-mail: reichert@piwet.pulawy.pl.
8082
on November 9, 2019 by guest
http://jvi.asm.org/
rich motif is essential for viral survival and replication in B cells.
To test the significance of the proline-rich PX2PX4–5P motif in BLV gp30, we changed three of the prolines to alanines in an infectious molecular clone of BLV. The influence of the proline-rich motif on viral load and pathogenicity was studied in sheep.
MATERIALS AND METHODS
Provirus mutants.The source of BLV provirus was the infectious molecular clone pBLV344H, as previously described (32). In this clone, the proline-rich motif has the sequence PHFPEISFPPK. In other isolates of BLV, there is an L instead of F, or a T or A instead of the third P (18). Mutations were performed using PCR and resulted in changing three prolines (positions 471, 474, and 479 according to Rice et al. [26]) to alanines. Briefly, two pairs of oligonucleotides were used in mutagenesis: flanking primers OL and OR, and internal primers OC1 and OC2 that contained altered bases encoding the P3A mutations. The first round of amplification consisted of two separate reactions, using two primer sets. The first primer pair consisted of upstream OL (5⬘-ATC AAC AAT GGA TGA CAA CAT-3⬘) and downstream OC1 (5⬘-CGA AGG AGA TTT CAG CGA AGT GGG CAG CCT GC-3⬘). The second pair was upstream OC2 (5⬘-GCC CAC TTC GCT GAA ATC TCC TTC GCC CCT AAA C-3⬘) and downstream OR (5⬘-GAG GGT GGA ATA AAA AGA AAG-3⬘). Underlined bases designate those changed to cause the P3A mutations. After the first round of amplification using two sets of primers (OL plus OC1 and OR plus OC2), the products of each reaction were mixed and used as template in a second round of amplification with only the flanking primers OL and OR. This resulted in a 2-kb amplicon that contained the desired P3A mutations. The new amino acid sequence, starting with amino acid 471 (26) is AHFAEISFAPK. We took advantage of the presence ofNcoI andXbaI restriction sites in the amplicon, and after cutting of theNcoI-XbaI fragment from the whole amplicon we cloned it into the original pBLV344H. The resultant construct is designated pppBLV344H. Correctness of the construct was verified by sequencing. For the transfection experiments, plasmids were purified using the Qiagen Plasmid Mega kit.
In vitro activity.To determine if the mutated virus was functional in vitro, approximately 2⫻105canine osteosarcoma cells (D17) were transfected by
calcium phosphate-precipitated plasmid DNA (ProFection Mammalian Trans-fection System; Promega). Cells were cotransfected with pBLVLTR-CAT and either pBLV344H or pppBLV344H. The cells were then washed and cultivated
in minimal essential medium (Gibco) supplemented with 10% heat-inactivated fetal calf serum. After 48 h the cells were harvested and washed with phosphate-buffered saline (PBS) and one-half of the cells were lysed by three cycles of freeze-thaw. After centrifugation, chloramphenicol acetyltransferase (CAT) ac-tivity was determined from the supernatants (as described in reference 32). The other half of the transfected cells were lysed by one cycle of freeze-thaw and used for p24 antigen titration by an enzyme-linked immunosorbent assay (ELISA) procedure as described previously (21, 22). Briefly, 96-well microtiter plates were precoated with the anti-p24 monoclonal antibody (MAb) 4⬘G9. The antigen mixtures to be tested were then added to the wells. After washing of the plates, the p24 antigen was revealed by colorimetric assay using two antibodies (2⬘C1 and 4⬘F5) conjugated with peroxidase.
In vivo transfection of sheep.Before starting the experiments, the animals were adapted to the housing and feeding conditions in the experimental herd in Pulawy, Poland. During this period, sheep were treated with parasiticides, and absence of parasites was confirmed.
Fifteen sheep of the Polish long-woolly breed were used. Sheep numbers 1, 2, and 3 were females and the others were males. Sheep were divided into three groups (A, B, and C) of five animals each. Sheep were injected intradermally with 100 g of plasmid mixed with 1,2-dioleoyl-3-trimethylammonium propane (DOTAP) (Boehringer Mannheim) in 1 ml of HEPES-buffered saline (pH 7.4). Sheep in group A (numbers 4, 6, 11, 32, and 33) were each injected intradermally in three different locations with a total dose of 100g of unmutated, wild-type provirus DNA (pBLV344H). Group B (numbers 5, 7, 8, 9, and 10) received the same dose of proline-mutated provirus (plasmid pppBLV344H), and group C (numbers 1, 2, 3, 31, and 32) received only DOTAP transfection reagent as a negative control. Blood samples were collected at one-week intervals for 10 weeks and then at monthly intervals.
Serological examination.Serologic response to BLV proteins was evaluated by agar gel immunodiffusion (AGID) assay, which detects both gp51 and p24 anti-bodies (Dr. Bommeli AG, Liebefeld Switzerland). Antianti-bodies to p24 were de-termined by ELISA (ELISA BLV kit; Bioveta, Ivanovice na Hane, Czech Re-public). Additionally, serial dilutions were prepared to measure the p24 antibody titer using the same ELISA kit. Sera from pppBLV-injected sheep with no detectable p24 antibodies were tested again to confirm results by using a second ELISA kit that also detects p24 antibodies (Institut Pourquier, Montpellier, France).
BLV p24 titration in PBMC cultures.Peripheral blood mononuclear cells (PBMCs) were isolated from the blood samples using Histopaque (Sigma) den-sity gradient centrifugation and cultured for 48 h at a concentration of 3⫻106/ml
of Eagle medium supplemented with 10% heat-inactivated calf serum,L
[image:2.612.104.498.76.303.2]-glu-tamine, gentamicin, and amphotericin B. Cell-free supernatants were prepared
FIG. 1. Proline mutations. Location of proline-rich motifs (PX2PX4P) inside of BLV envelope protein. The diagram presents the external (gp51) and transmembrane (gp30) glycoproteins anchored in the cell membrane. Proline-rich motifs are located in the cytoplasmic portion of gp30.
on November 9, 2019 by guest
http://jvi.asm.org/
by centrifugation for 10 min at 900⫻g. The p24 major Gag antigen was then titrated from the culture supernatants by ELISA (21, 22).
PCR analysis of proviral sequences in blood samples.DNA for PCR was isolated from Histopaque-purified sheep PBMCs using the Genomic DNA Prep Plus kit (DNA-Gdansk II s.c., Gdan´sk, Poland). The composition of the reaction mixture at a volume of 50l was PrimeZyme polymerase buffer (Biometra Ltd, Goettingen, Germany), 1.5 mM Mg2⫹, 0.5M concentrations of each primer, 1
mM deoxynucleoside triphosphates, and 2 U of PrimeZyme polymerase (Biome-tra). DNA (0.5g) was added to the reaction mixture and the total volume was covered with 2 drops of mineral oil. The amplification process was performed in a programmed thermal cycler (UnoII; Biometra Ltd). To examine proviral load, semiquantitative PCR was performed on the PBMCs. The number of PCR cycles was restricted to 25 in order to eliminate the “plateau effect” and to allow comparison between amplification of abundant and scarce BLV sequences. The reaction was started with denaturation at 94°C for 4 min followed by 25 cycles of 40-s denaturation at 94°C, 40-s primer hybridization at 65°C, and 1-min elonga-tion at 72°C. The amplificaelonga-tion was finished with a 5-min elongaelonga-tion. Two oligonucleotides were used: MCF-1 (5⬘-GCGAGAAACCATTCATTCTG-3⬘) and MCR-2 (5⬘-CAAGAAGAGGCTTGTGATGG-3⬘). Amplification products of the BLV DNA were detected electrophoretically in a 2% agarose gel. The specificity of the PCR was confirmed by Southern blot hybridization of amplified DNA using a molecular probe (SacI insert of previously cloned provirus DNA) (23) followed by autoradiography. DNA samples from an FLK cell line infected persistently with BLV and from a persistently lymphocytotic, ELISA-positive cow were the positive controls. To more sensitively test for the presence of proviral DNA, a nested PCR was used. Initial template DNA (0.5g), approx-imately 5,000 cell-equivalents, was initially amplified with upstream primer 5⬘-A TCAACAATGGATGACAACAT and downstream primer 5⬘-GAGGGTGGA ATAAAAAGAAAG. Denaturation was at 94°C for 4 min, followed by 30 cycles of 1-min denaturation at 94°C, 30-s primer hybridization at 57°C, and 1-min elongation at 72°C and concluding with a 7-min elongation. One-tenth of the initial amplification was used as a template for the second PCR, using primers MCF-1 and MCR-2 as described above. In the second reaction, 30 cycles were performed as above, except with a 40-s denaturation at 94°C and 40-s primer hybridization at 65°C. Amplification products were detected electrophoretically in a 2% agarose gel. As a control of sensitivity, known dilutions of plasmid DNA (pBLV344H) were prepared in water.
Flow cytometry.Cytometric analysis was performed using a FACStrak flow cytometer (Becton Dickinson Immunocytometry Systems), and the percentages of B-cell and T-cell subpopulations were recorded using Simulset and PC Lysis programs. Leukocytes were gated with MAbs directed against ovine antigens CD2 (MUC2A), CD4 (GC50A1), CD8 (CACT80C), B-B2 (BAQ44A), and WC1-N2 (BAQ4A) (VMRD Inc., Pullman, Wash.). WC1-N2 is a determinant on WC1⫹␥␦T cells, the predominant population of peripheral blood␥␦T cells in
sheep. Debris was excluded from the analysis by the conventional scatter gating method.
Peripheral blood from the jugular vein was collected by venipuncture into tubes with 5 mM EDTA as anticoagulant. Leukocytes were enumerated using a hemocytometer (Auto Counter AC920; Swelab Instruments) and expressed as cell number⫻109per liter. Fifty microliters of blood was used for each staining
with MAbs. The MAbs were then added to appropriate tubes containing cells, followed by washing with PBS with 5% gamma globulin-free horse serum (Sig-ma), 10% acid citrate dextrose, and 10 mM EDTA. Samples for fluorescence-activated cell sorter analysis were diluted with 2% formaldehyde in PBS.
B cells were defined as those cells expressing B-B2 antigen, and T cells were defined as those expressing CD2 antigen. Helper cells were identified as the CD4-expressing subset of T cells, and cytotoxic-suppressor cells were identified as the CD8-expressing T cells. The remaining subpopulation of lymphocytes (non-B, non-T) was defined on the basis of WC1-N2 expression. The MAbs directed against CD antigens were detected using goat anti-mouse immunoglob-ulin G conjugated either to fluorescein isothiocyanate or phycoerythrin (Medac GmbH, Hamburg, Germany).
Statistical analysis.Analysis of variance was conducted by using the Stat-graphics Plus statistical analysis package, version 2.0. The results are presented as the mean⫾1 standard deviation of the absolute number and percentage of each lymphocyte subpopulation. The statistical significance of the observed dif-ferences in the numbers and percentages of lymphocyte subsets between three experimental groups as well as between estimated time points within each group was evaluated by Student’st-test. APvalue of⬍0.05 was considered statistically significant.
RESULTS
[image:3.612.53.552.82.294.2]Construction of mutated provirus.We constructed a mutant of bovine leukemia provirus by introducing three P3A point mutations within the proline-rich motif upstream of the gp30 ITAM. The location of the mutations in the BLV gp30 and the mutated sequence are presented in Fig. 1. Before in vivo in-jection, wtBLV was compared with pppBLV in vitro by tran-sient cotransfection of either wtBLV or pppBLV, together with pLTRCAT in the canine D17 osteosarcoma cell line. Expres-sion of the transactivator Tax, as determined by activation of BLV LTR-CAT, and expression of the capsid p24 protein, as determined by ELISA, did not reveal significant differences TABLE 1. Results of gp51/p24 AGID and p24 ELISA
Transfection agent and sheep no.
Resultsaat week:
1 2 3 4 5 6 7 8 9 10
wt BLV
4 ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫹,⫾(0) ⫹,⫹(200) ⫹,⫹(400) ⫹,⫹(800) ⫹,⫹(800) ⫹,⫹(800) ⫹,⫹(800) 6 ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫺,⫺(0) ⫹,⫹(100) ⫹,⫹(200) ⫹,⫹(200) ⫹,⫹(200) ⫹,⫹(400) ⫹,⫹(200) 11 ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫺,⫹(100) ⫹,⫹(200) ⫹,⫾(NS) ⫹,⫹(200) ⫹,⫹(400) 32 ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫺,⫹(100) ⫹,⫹(100) ⫹,⫹(200) ⫹,⫹(400) ⫹,⫹(800) ⫹,⫹(3,200) 33b ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫺,⫹(200) ⫺,⫹(800) ⫹,⫹(1,600) ⫹,⫹(1,600) ⫹,⫹(1,600) ⫹,⫹(3,200) ⫹,⫹(6,400) pppBLVtr
5 ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫹,⫾(0) ⫾,⫺(200) ⫹,⫹(200) ⫹,⫹(800) 7 ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫹,⫾(100) ⫹,⫾(200) ⫹,⫹(200) ⫹,⫹(400) ⫹,⫹(800) ⫹,⫹(0) pppBLVlr
8 ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫹,⫹(100) ⫹,⫹(200) ⫹,⫹(400) ⫹,⫹(800) ⫹,⫹(800) 9 ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫹,⫺(0) ⫹,⫾(0) ⫹,⫾(0) ⫹,⫾(0) 10 ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫹,⫾(0) ⫹,⫹(100) ⫹,⫹(200) ⫹,⫹(200) ⫹,⫹(200) ⫹,⫹(200) ⫹,⫹(200) Negative control
1 ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫺,⫺ 2 ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫺,⫺ 3 ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫺,⫺ 30 ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫺,⫺ 31 ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫺,⫺ ⫺,⫺ aAGID result, ELISA result (titer).⫹, positive;⫾, weak positive;⫺, negative; NS, not studied.
bSheep number 33 died of an unrelated cause at 10 months after transfection.
on November 9, 2019 by guest
http://jvi.asm.org/
(p⬎0.2) between the proline-mutated and wild-type provirus (data not shown).
Initial infectivity. Seroconversion as measured by AGID assay and ELISA occurred in all of the animals transfected with wild-type or proline-mutated provirus 4 to 7 weeks after plasmid injection (Table 1). Negative control animals injected only with DOTAP remained seronegative. The five sheep transfected with wild-type provirus (wtBLV) seroconverted at a mean of 5.6⫾1.1 and 4.8⫾0.8 weeks, as measured by AGID and ELISA, respectively, while the five sheep transfected with the proline-mutated provirus (pppBLV) seroconverted at a mean of 5.8⫾1.3 and 6.0⫾1.6 weeks, as similarly measured. The differences between the time of seroconversion of sheep transfected with wtBLV versus pppBLV were not significant, regardless of the type of assay used. Similarly, there were no
significant differences in the time to onset of p24 antigen ex-pression between wtBLV- and pppBLV-infected sheep (5.4⫾
3.3 and 7.7 ⫾2.3 weeks, respectively) as measured in super-natant of cultured PBMCs. In the wtBLV-transfected group of sheep, the shortest period to onset of p24 antigen expression was 3 months, while in the pppBLV-transfected group of ani-mals it was 5 months.
[image:4.612.54.553.82.292.2]Long-term serologic response.Despite an initial similarity in infectivity, as determined by the time of seroconversion, the dynamics of serum titers varied considerably after infection (Fig. 2, Table 1). Two of the five pppBLV-transfected sheep (animals 5 and 7) were serologically positive by AGID and ELISA for 4 and 2 months, respectively, but then became seronegative again. The other three pppBLV-transfected sheep (animals 8, 9, and 10) remained seropositive for the TABLE 1—Continued
Resultsaat week:
14 18 22 26 30 34 38 42 46 50
⫹,⫹(1,600) ⫹,⫹ (1,600) ⫹,⫹(12,800) ⫹,⫹(12,800) ⫹,⫹(12,800) ⫹,⫹(12,800) ⫹,⫹(12,800) ⫹,⫹ (12,800) ⫹,⫹ (51,200) ⫹,⫹(204,800) ⫹,⫹(1,600) ⫹,⫹(12,800) ⫹,⫹(12,800) ⫹,⫹(12,800) ⫹,⫹(12,800) ⫹,⫹(12,800) ⫹,⫹(12,800) ⫹,⫹ (12,800) ⫹,⫹(204,800) ⫹,⫹(204,800) ⫹,⫹(800) ⫹,⫹ (3,200) ⫹,⫹ (6,400) ⫹,⫹(12,800) ⫹,⫹(12,800) ⫹,⫹(12,800) ⫹,⫹(12,800) ⫹,⫹(204,800) ⫹,⫹(409,600) ⫹,⫹(409,600) ⫹,⫹(6,400) ⫹,⫹(12,800) ⫹,⫹(12,800) ⫹,⫹(12,800) ⫹,⫹(12,800) ⫹,⫹(12,800) ⫹,⫹(12,800) ⫹,⫹ (51,200) ⫹,⫹ (25,600) ⫹,⫹ NS ⫹,⫹(6,400) ⫹,⫹(12,800) ⫹,⫹(12,800) ⫹,⫹ NS ⫹,⫹(12,800) NS, NS NS, NS NS, NS NS, NS NS, NS
⫹,⫹(0) ⫹,⫺ (0) ⫹,⫺ (0) ⫺,⫺ (0) ⫺,⫺ (0) ⫺,⫺ (0) ⫺,⫺ (0) ⫺,⫺ (0) ⫺,⫺ (0) ⫺,⫺ (0) ⫹,⫹(0) ⫺,⫺ (0) ⫺,⫺ (0) ⫺,⫺ (0) ⫺,⫺ (0) ⫺,⫺ (0) ⫺,⫺ (0) ⫺,⫺, (0) ⫺,⫺ (0) ⫺,⫺ (0)
⫹,⫹(1,600) ⫹,⫹ (6,400) ⫹,⫹ (6,400) ⫹,⫹ (6,400) ⫹,⫹(12,800) ⫹,⫹(12,800) ⫹,⫹(12,800) ⫹,⫹ (12,800) ⫹,⫹ (25,600) ⫹,⫹ (51,200) ⫹,⫾(0) ⫹,⫹ (800) ⫹,⫹ (1,600) ⫹,⫹(12,800) ⫹,⫹(12,800) ⫹,⫹(12,800) ⫹,⫹(12,800) ⫹,⫹ (12,800) ⫹,⫹(102,400) ⫹,⫹(102,400) ⫹,⫹(100) ⫹,⫹ (400) ⫹,⫹ (400) ⫹,⫹ (1,600) ⫹,⫹ (1,600) ⫹,⫹ (3,200) ⫹,⫹ (6,400) ⫹,⫹ (12,800) ⫹,⫹ (12,800) ⫹,⫹ (51,200)
⫺,⫺ ⫺, ⫺ ⫺, ⫺ ⫺, ⫺ ⫺, ⫺ ⫺, ⫺ ⫺, ⫺ ⫺, ⫺ ⫺, ⫺ ⫺, ⫺
⫺,⫺ ⫺, ⫺ ⫺, ⫺ ⫺, ⫺ ⫺, ⫺ ⫺, ⫺ ⫺, ⫺ ⫺, ⫺ ⫺, ⫺ ⫺, ⫺
⫺,⫺ ⫺, ⫺ ⫺, ⫺ ⫺, ⫺ ⫺, ⫺ ⫺, ⫺ ⫺, ⫺ ⫺, ⫺ ⫺, ⫺ ⫺, ⫺
⫺,⫺ ⫺, ⫺ ⫺, ⫺ ⫺, ⫺ ⫺, ⫺ ⫺, ⫺ ⫺, ⫺ ⫺, ⫺ ⫺, ⫺ ⫺, ⫺
⫺,⫺ ⫺, ⫺ ⫺, ⫺ ⫺, ⫺ ⫺, ⫺ ⫺, ⫺ ⫺, ⫺ ⫺, ⫺ ⫺, ⫺ ⫺, ⫺
FIG. 2. Comparison of mean p24 antibody titers in sera of four groups of sheep: animals transfected with wtBLV, the three animals transfected with pppBLV that were long-term antibody responders (numbers 8, 9, and 10) (pppBLV lr), the animals transfected with pppBLV that were only transient antibody responders (numbers 5 and 7) (pppBLV tr), and the negative control animals. Titers were determined by ELISA (ELISA BLV kit, Bioveta).
on November 9, 2019 by guest
http://jvi.asm.org/
[image:4.612.140.491.540.684.2]duration of the study. Twelve months from the time of trans-fection, the mean titer in the wtBLV-transfected group was four times higher than the mean titer for the three seropositive animals in the pppBLV-transfected group (273,060 versus 68,260). The difference between the group of animals (sheep 5 and 7) producing the low p24 antibody titers and the remaining pppBLV-infected sheep (numbers 8, 9, and 10) was also evi-dent when the lymphocyte phenotype was compared (see be-low).
p24 expression in cultured PBMCs. Comparison of BLV p24 expression in supernatant from cultured PBMCs from the wtBLV and pppBLV groups revealed similar tendencies. There was a much higher mean p24 expression level from the wtBLV-transfected animals compared to the three long-term-seropositive, pppBLV-transfected animals (Fig. 3). Signifi-cantly, the two sheep that became seronegative also failed to express p24 protein after culture of PBMCs.
Semiquantitative PCR to compare viral loads.To examine proviral load, semiquantitative PCR was performed on PB-MCs. The number of PCR cycles was restricted to 25, and dilutions of infected bovine PBMCs were used as a positive control. A 337-bp fragment from theenvgene that is present in both the wild-type and proline-mutated proviral BLV was am-plified. To increase sensitivity of detection, the PCR products were analyzed by Southern blotting using a BLV-specific probe (23), followed by nonradioactive detection using the ECL sys-tem (Amersham Pharmacia Biotech). As expected, the 337-bp fragment was present in the PCR of all wtBLV-transfected sheep throughout the whole experiment. At the same time, however, the proviral sequence was weakly and inconsistently detected in three of the five pppBLV-transfected sheep (num-bers 5, 7, and 8) (Fig. 4). However, pppBLV-transfected sheep numbers 9 and 10 had proviral loads equivalent to those of the wtBLV-transfected animals. After initial infection, confirmed both by the presence of specific antibodies and proviral se-quences in PBMCs, we were unable to detect BLV DNA in pppBLV-transfected sheep number 5 and 7 after 6 months posttransfection (Fig. 5). These results correlate well with the
serological results for these two sheep (Table 1). The sheep were serologically positive for 4 and 2 months, respectively, but then became seronegative. The five negative control (unin-fected) sheep had no detectable BLV DNA, confirming that there was no transmission among the groups of sheep.
[image:5.612.56.293.70.221.2]Leukocyte phenotype.The wtBLV group had a statistically significant increase in total numbers of lymphocytes and num-bers of B cells compared with both the pppBLV and unin-fected control groups. No significant differences were found between the pppBLV group and the uninfected negative con-trol group. In the wtBLV-transfected group, the mean total lymphocyte count was (5.5⫾0.3)⫻109/liter, whereas in the pppBLV-transfected group, the mean total lymphocyte count was (4.1⫾0.3)⫻109/liter [(4.4⫾0.5)⫻109/liter and (3.8⫾ 0.4) ⫻ 109/liter for pppBLVtr and pppBLVlr, respectively], and the negative control group had a mean total lymphocyte count of (4.1 ⫾0.3) ⫻ 109/liter (Table 2). The mean B-cell count was particularly increased in the wtBLV animals and was (2.4⫾ 0.2)⫻109/liter (46% of the total lymphocytes), while the mean B-cell count of the pppBLV-transfected animals was FIG. 3. Titers of BLVp24 antigen in 2-day PBMCs cultures from
[image:5.612.308.552.75.405.2]four groups of sheep. The designations of the experimental groups are as for Fig. 2. PBMCs were collected at 3-month intervals, purified on a Histopaque gradient (Sigma), and cultured for 48 h in RPMI 1640 (Gibco BRL), and the supernatant was used for p24 ELISA titer determinations (optical density [O.D.]).
FIG. 4. Semiquantitative PCR analysis of proviral loads. PBMCs were collected and purified at 3-month intervals, starting 3 months after transfection. DNA was consistently extracted from constant amounts of 3⫻ 106PBMCs, and 0.5 g was amplified by 25 PCR cycles. Amplicons were electrophoresed and analyzed by Southern blot hybridization with a BLV probe. The semiquantitative analysis was supported by amplification of serial dilutions (1:10 and 1:1,000) of DNA from a naturally BLV-infected cow.
on November 9, 2019 by guest
http://jvi.asm.org/
(1.1⫾0.2)⫻109/liter (27% of the total lymphocytes) [(1.0⫾ 0.7)⫻109/liter and (1.2⫾0.6)⫻109/liter for pppBLVtr and pppBLVlr, respectively], and the mean B-cell count in the negative control group was (1.2⫾0.2)⫻109/liter (28% of the total lymphocytes). Simultaneous lack of significant differences in absolute T-cell numbers among groups and decreased T-cell percentage in the wtBLV group confirmed that the elevation in total numbers of PBMCs in the wtBLV group was due to increased numbers of B cells. No significant differences were found in the absolute numbers of CD4⫹T cells, CD8⫹T cells,
or WC1-N2⫹cells. Therefore, the mean percentage of T cells,
CD4⫹T cells, and CD8⫹T cells decreased (34 versus 48%, 20
versus 26%, and 11 versus 18%, respectively) in the wtBLV-transfected group compared with the pppBLV-wtBLV-transfected
group. In contrast to the wtBLV-infected group of sheep, no differences between any lymphocyte subpopulations in the overall pppBLV group and the negative control group were evidenced (Table 2). Phenotyping of cells within the pppBLV-infected group of sheep revealed differences between the low-titer-producing group (sheep numbers 5 and 7) and high-titer group (numbers 8, 9, and 10). In particular, significant differ-ences were observed between percentage of B-B2 and WC1-N2 antigen-bearing cells. The percentage of B-B2 B cells was lower (mean, 22 versus 30%) in the low-titer-producing group (sheep 5 and 7) than in the high-titer group (sheep numbers 8, 9, and 10). Simultaneously, the low-titer-producing group of sheep showed an increase in percentage of WC1-N2 lympho-cytes compared with that of the high-titer group (15 versus 11%) (data not shown).
Lack of reversions and/or transmission of pppBLV mutant. The sequence of the viral proline-rich motif was examined 7 months after transfection to verify that in vivo reversions or sheep-to-sheep transmission had not occurred (Fig. 6). DNA from PBMCs was extracted, amplified by PCR, and sequenced. The sequence of gp30 in the five pppBLV-transfected animals was consistent with the original mutated and transfected se-quence. At the mutated sites, peaks were homogeneous, con-sistent with a pure population of mutated virus. To verify that there were no reversions at later times after transfection, the proviral gp30 sequence of sheep 9 and 10 was determined at 12 and 24 months posttransfection. The sequences were identical with that of the original mutant pppBLV used for transfection. Progression to neoplasia. One wtBLV-transfected sheep (number 33) died of unrelated causes at 10 months posttrans-fection. This animal became listless and recumbent and was euthanatized, but a specific cause of death could not be deter-mined. All four of the remaining wtBLV-transfected sheep died of leukemia and lymphoma within 31 months posttrans-fection. Sheep numbers 4 and 11 at the time of death showed marked lymphocytosis (⬃5⫻1011to 7⫻1011/liter) as well as solid lymphomas in many organs, including lymph nodes, heart, kidney, and peritoneum. A third sheep (number 6) had a single spike of leukocytosis of up to 1012/liter that later subsided, and this sheep later developed solid lymphomas. The fourth sheep (number 32) also developed solid lymphomas and died. None of the pppBLV-transfected sheep or negative con-FIG. 5. (a) Nested PCR of DNA from two pppBLV-transfected
[image:6.612.66.285.71.317.2]seronegative sheep (animals 5 and 7) obtained 38, 54, and 62 weeks after transfection. As a control of the sensitivity of the test, the results of nested PCR of serial dilutions of the parental plasmid DNA (pBLV344H) used to transfect the sheep as well as of BLV-positive bovine DNA are included. (b) The results of PCR of samples from the same sheep using primers for the goat-actin gene as a control for the integrity of the DNA samples. The primers do not amplify bovine -actin. Lanes 1 to 8 are as in panel a. C, PCR of sample with goat -actin plasmid, used as a positive control.
TABLE 2. Lymphocyte counts of the wtBLV, pppBLVtr, pppBLVlr, and negative control groups
Transfection group No. of lymphocytes (10
9)/liter
Total B cells T cells WC1-N2⫹cells
wtBLV 5.5⫾0.3*b 2.4⫾0.2* 1.8⫾0.2 0.5⫾0.07 pppBLVtr 4.4⫾0.5 1.0⫾0.7 2.2⫾0.2 0.6⫾0.09 pppBLVlr 3.8⫾0.4 1.2⫾0.6 1.8⫾0.2 0.4⫾0.08 Neg. control 4.1⫾0.3 1.2⫾0.2 2.0⫾0.2 0.5⫾0.06
[image:6.612.310.552.74.212.2]aAll values are means⫾standard deviations of six monthly measurements. bAsterisks indicate statistically significant counts.
FIG. 6. Sequence of provirus DNA amplified from samples col-lected 7 months after transfection of experimental sheep
on November 9, 2019 by guest
http://jvi.asm.org/
[image:6.612.55.293.638.709.2]trol sheep had developed leukemia or lymphoma 34 months after transfection.
DISCUSSION
In the cytoplasmic tail of the BLV transmembrane protein, gp30, a proline-rich motif is located 12 amino acids upstream of the ITAM. Because of the observation that proline-rich motifs with nearly identical spacing of three prolines (PX(2)PX(4–5)P) are found in close proximity to ITAMs in five other viruses, including four that infect lymphocytes (5), we hypothesized that the proline-rich motif is necessary for a key step in the viral life cycle. To test this hypothesis in vivo, we mutated the first two conserved prolines and a third proline of an infectious molecular clone and transfected the plasmid into sheep.
Initial serologic responses of the pppBLV- and wtBLV-transfected animals were similar, suggesting that the mutation did not cause such dramatic changes in the virus that infectivity was significantly inhibited. Following initial infection, however, sheep transfected with pppBLV failed to maintain high levels of virus. In three of five sheep, semiquantitative PCR showed little or no proviral load in PBMCs, as compared with the wtBLV-transfected animals. In two pppBLV-transfected ani-mals, proviral load in PBMCs was similar to that in the wtBLV-transfected animals. However, p24 expression in cultured PB-MCs was less than in the wtBLV-transfected animals, and the serologic titers were lower as well in all of the pppBLV-trans-fected animals. Consistent with the reduction in proviral load and viral expression, the B-cell population in the pppBLV-transfected animals was similar to the uninfected control ani-mals, unlike the expanded B-cell population of the wtBLV-transfected animals. One wtBLV-wtBLV-transfected animal died of unrelated causes, and all four of the remaining wtBLV-trans-fected animals developed leukemia and lymphoma. The ppp-BLV-transfected animals have not developed disease.
It is of interest that sheep transfected with pppBLV reacted differently. Two of the pppBLV-transfected animals were ini-tially infected, seroconverted, and had PBMCs with detectable provirus by PCR. However, after 26 weeks these animals re-verted to seronegativity, and no provirus could be detected in the PBMCs by semiquantitative PCR or by nested PCR. A third pppBLV-transfected animal remained seropositive and proviral load was low, as determined by semiquantitative PCR. In contrast, the fourth and fifth animals in this group had semiquantitative PCR levels similar to the wtBLV-transfected animals. Various mechanisms might explain these findings. Although the gp30 sequence in the pppBLV-transfected ani-mals was identical to the original plasmid, indicating lack of reversion, it is possible that there was a compensatory muta-tion elsewhere in the viral genome that permitted increased viral growth. It is also possible that the host sheep differed genetically, thus facilitating viral growth in some of the ani-mals. Alternatively, it may be that stochastic events in some mutant-transfected animals shortly after initial transfection lead to greater infection. Regardless of the mechanism, the pppBLV-transfected animals with higher proviral loads, as de-termined by semiquantitative PCR, did have lower serologic titers than the wtBLV-transfected animals. Moreover, p24 pro-tein expression in the supernatant of cultured cells was lower
and the animals were free of tumor development, compared with the wtBLV-transfected animals.
Previously, it has been shown that the ITAM of gp30 is essential for in vivo viral infectivity and maintenance of viral load (29). This study shows, in addition, that the PX2PX4–5P proline-rich motif is also important for maintenance of proviral load in vivo. It is intriguing that in viruses with both proline-rich motifs and ITAMs, the two motifs are in close proximity. It is not known what role the relative positions of these two motifs plays, but it is possible that BLV gp30 and the other viral proteins with both motifs act as a signaling scaffold by bringing signaling molecules with SH3 motifs together with molecules with SH2 motifs (12, 16).
Although this in vivo study demonstrates the importance of the proline-rich motif, the mechanisms of action of this motif have not been determined. There is considerable evidence that proline-rich motifs with PX2PX4–5P spacing are involved in signal transduction and are recognition sites of the SH3 motifs, which are common in a wide variety of intracellular signaling molecules, including the Src family of tyrosine kinases, Fyn, Lyn, and Hck, Vav, and others (11, 16, 24, 27). A variant of the proline-rich motif contains PY sequences and interacts with WW domains on signaling molecules (16). The PY motif is found in proximity to many of the viruses with ITAMs, but it is not present in BLV gp30 (5).
Functions of the proline-rich motif other than interactions with SH3 domains of signaling molecules also may be utilized in retroviruses. In human immunodeficiency virus type 1 (HIV-1) and other retroviruses, proline-rich motifs are essen-tial in a variety of late processes in the viral life cycle, including efficient release of particles from the cell surface (14), viral maturation (10), and incorporation of the Pol proteins, reverse transcriptase (RT) and integrase, into the virion (10). In HIV-2, a proline-rich motif of the Vpx protein is necessary for nuclear localization of the preintegration complex (19). In other viruses, the P protein of Borna disease virus has two nuclear localization signals consisting of proline-rich motifs (28), and a proline-rich PPPY motif of vesicular stomatitis virus is necessary for a late step of virus release (15). Further studies will be needed to investigate if there are specific sig-naling defects in SH3-mediated sigsig-naling pathways or in other aspects of the viral life cycle in pppBLV-infected lymphocytes. BLV is evolutionarily and biologically similar to HTLV-1 and -2. The value of the BLV model system is that viral mu-tations can be generated and tested in experimental animals. This approach can examine the in vivo significance of different putative viral signaling motifs and their interactions with host signal pathways. Identification of motifs that cause expansion of B-cell populations can lead to understanding of specific host signaling pathways that are altered and may be significant for cancer research and targeted drug development.
ACKNOWLEDGMENTS
Funding was provided by the USDA Foreign Agricultural Service, Research and Scientific Exchanges Division; Maria Sklodowska-Curie Joint Fund II (PL-AES-284); and the Commissariat ge´ne´ral aux rela-tions internationales de la Communaute´ Wallonie-Bruxelles.
We thank Daniel Portetelle for providing the p24BLV MAbs. We also thank Malgorzata Zaborna and Sue Pritchard for excellent tech-nical assistance and Arse`ne Burny and Diana Stone for critical reviews of the manuscript.
on November 9, 2019 by guest
http://jvi.asm.org/
REFERENCES
1.Alber, G., K.-W. Kim, P. Weiser, C. Riesterer, R. Carsetti, and M. Reth. 1993. Molecular mimicry of the antigen receptor signalling motif by trans-membrane proteins of the Epstein-Barr virus and the bovine leukaemia virus. Curr. Biol.3:333–339.
2.Beaufils, P., D. Choquet, R. Z. Mamoun, and B. Malissen.1993. The (YXXL/I)2 signaling motif found in the cytoplasmic segments of the bovine leukaemia virus envelope protein and Epstein-Barr virus latent membrane protein 2A can elicit early and late lymphocyte activation events. EMBO J. 12:5105–5112.
3.Bex, F., and R. B. Gaynor.1998. Regulation of gene expression by HTLV-I Tax protein. Methods16:83–94.
4.Burny, A., Y. Cleuter, R. Kettmann, M. Mammerickx, G. Marbaix, D. Por-tetelle, A. Van Den Broeke, L. Willems, and R. Thomas.1988. Bovine leu-kemia: facts and hypotheses derived from the study of an infectious cancer. Adv. Vet. Sci. Comp. Med.32:149–170.
5.Cantor, G. H.1996. A potential proline-rich motif upstream of the immu-noreceptor tyrosine-based activation motif in bovine leukemia virus gp30, Epstein-Barr virus LMP2A, herpesvirus papio LMP2A, and African horse-sickness virus. Virology220:265–266.
6.Cantor, G. H., S. M. Pritchard, O. Orlik, G. A. Splitter, W. C. Davis, and R. Reeves.1999. Bovine leukemia virus transmembrane protein gp30 physically associates with the down-regulatory phosphatase SHP-1. Cell. Immunol. 193:117–124.
7.Depelchin, A., J. J. Letesson, N. Lostrie-Trussart, M. Mammerickx, D. Portetelle, and A. Burny.1989. Bovine leukemia virus (BLV)-infected B-cells express a marker similar to the CD5 T-cell marker. Immunol. Lett.20:69–76. 8.Dequiedt, F., G. H. Cantor, V. T. Hamilton, S. M. Pritchard, W. C. Davis, P. Kerkhofs, A. Burny, R. Kettmann, and L. Willems.1999. Bovine leukemia virus-induced persistent lymphocytosis in cattle does not correlate with in-creased ex vivo survival of B lymphocytes. J. Virol.73:1127–1137. 9.Dequiedt, F., E. Hanon, P. Kerkhofs, P.-P. Pastoret, D. Portetelle, A. Burny,
R. Kettmann, and L. Willems.1997. Both wild-type and strongly attenuated bovine leukemia viruses protect peripheral blood mononuclear cells from apoptosis. J. Virol.71:630–639.
10. Dettenhofer, M., and X. F. Yu.1999. Proline residues in human immunode-ficiency virus type 1 p6(Gag) exert a cell type-dependent effect on viral replication and virion incorporation of Pol proteins. J. Virol.73:4696–4704. 11. Fackler, O. T., W. Luo, M. Geyer, A. S. Alberts, and B. M. Peterlin.1999. Activation of Vav by Nef induces cytoskeletal rearrangements and down-stream effector functions. Mol. Cell3:729–739.
12. Faux, M. C., and J. D. Scott.1996. Molecular glue: kinase anchoring and scaffold proteins. Cell85:9–12.
13. Hailata, N., R. Johnson, F. Al-Bagdadi, and S. Hanash.1995. Proliferating cell nuclear antigen expression in sheep infected with bovine leukemia virus. Vet. Immunol. Immunopath.44:211–222.
14. Huang, M., J. M. Orenstein, M. A. Martin, and E. O. Freed.1995. p6Gag is required for particle production from full-length human immunodeficiency virus type 1 molecular clones expressing protease. J. Virol.69:6810–6818. 15. Jayakar, H. R., K. Gopal Murti, and M. A. Whitt.2000. Mutations in the
PPPY motif of vesicular stomatitis virus matrix protein reduce virus budding by inhibiting a late step in virion release. J. Virol.74:9818–9827. 16. Kay, B. K., M. P. Williamson, and M. Sudol.2000. The importance of being
proline: the interaction of proline-rich motifs in signaling proteins with their
cognate domains. FASEB J.14:231–241.
17. Kenyon, S. J., and C. E. Piper.1977. Cellular basis of persistent lymphocy-tosis in cattle infected with bovine leukemia virus. Infect. Immun.16:891– 897.
18. Mamoun, R. Z., M. Morisson, N. Rebeyrotte, B. Busetta, D. Couez, R. Kettmann, M. Hospital, B. Guillemain.1990. Sequence variability of bovine leukemia virusenvgene and its relevance to the structure and antigenicity of the glycoproteins. J. Virol.64:4180–4188.
19. Pancio, H. A., N. Vander Heyden, and L. Ratner.2000. The C-terminal proline-rich tail of human immunodeficiency virus type 2vpxis necessary for nuclear localization of the viral preintegration complex in nondividing cells. J. Virol.74:6162–6167.
20. Pawson, T.1995. Protein modules and signalling networks. Nature373:573– 580.
21. Portetelle, D., K. Limbach, A. Burny, M. Mammerickx, P. Desmettre, M. Riviere, J. Zavada, and E. Paoletti.1991. Recombinant vaccinia virus ex-pression of the bovine leukaemia virus envelope gene and protection of immunized sheep against infection. Vaccine9:194–200.
22. Portetelle, D., M. Mammerickx, and A. Burny.1989. Use of two monoclonal antibodies in an ELISA test for the detection of antibodies to bovine leu-kaemia virus envelope protein gp51. J. Virol. Methods23:211–222. 23. Reichert, M., and J. Grundboeck-Jusko.1991. Molecular cloning of provirus
DNA from bovine leukaemia lymphocytes and its application as a probe for diagnostic purpose. Acta Biochim. Pol.38:111–114.
24. Ren, R., B. J. Mayer, P. Cicchetti, and D. Baltimore.1993. Identification of a ten-amino acid proline-rich SH3 binding site. Science259:1157–1161. 25. Reth, M.1989. Antigen receptor tail clue. Nature338:383–384.
26. Rice, N. R., R. M. Stephens, D. Couez, J. Deschamps, R. Kettmann, A. Burny, and R. V. Gilden.1984. The nucleotide sequence of theenvgene and post-envregion of bovine leukemia virus. Virology138:82–93.
27. Saksela, K., G. Cheng, and D. Baltimore.1995. Proline-rich (PxxP) motifs in HIV-1 Nef bind to SH3 domains of a subset of Src kinases and are required for the enhanced growth of Nef⫹viruses but not for down-regulation of
CD4. EMBO J.14:484–491.
28.Shoya, Y., T. Kobayashi, T. Koda, K. Ikuta, M. Kakinuma, and M. Kishi. 1998. Two proline-rich nuclear localization signals in the amino- and car-boxyl-terminal regions of the Borna disease virus phosphoprotein. J. Virol. 72:9755–9762.
29.Willems, L., J. S. Gatot, M. Mammerickx, D. Portetelle, A. Burny, P. Kerk-hofs, and R. Kettmann.1995. The YXXL signalling motifs of the bovine leukemia virus transmembrane protein are required for in vivo infection and maintenance of high viral load. J. Virol.69:4137–4141.
30.Willems, L., C. Grimonpont, H. Heremans, N. Rebeyrotte, G. Chen, D. Portetelle, A. Burny, and R. Kettmann.1992. Mutations in the bovine leu-kemia virus tax protein can abrogate the long terminal repeat-directed trans-activating activity without concomitant loss of transforming potential. Proc. Natl. Acad. Sci. USA89:3957–3961.
31.Willems, L., H. Heremans, G. Chen, D. Portetelle, A. Billiau, A. Burny, and R. Kettmann.1990. Cooperation between bovine leukaemia virus transacti-vator protein and Ha-ras oncogene product in cellular transformation. EMBO J.9:1577–1581.
32. Willems, L., D. Portetelle, P. Kerkhofs, G. Chen, A. Burny, M. Mammerickx, and R. Kettmann.1992.In vivotransfection of bovine leukemia provirus into sheep. Virology189:775–777.
