The target DNA sequence for resolution of poxvirus replicative intermediates is an active late promoter.

0022-538X/91/010061-10$02.00/0

CopyrightX) 1991, American Society forMicrobiology

The

Target

DNA

Sequence

for Resolution of Poxvirus

Replicative

Intermediates

Is

an

Active

Late

Promoter

DAVID STUART, KATHRYN GRAHAM, MARTHASCHREIBER,

COLINMACAULAY, AND GRANTMcFADDEN*

Department of Biochemistry, Universityof Alberta, Edmonton, Alberta, Canada T6G 2H7

Received 6July1990/Accepted 2 October 1990

The linear double-stranded genomes of poxviruses such as Shope fibroma virus (SFV) replicate

autono-mouslywithinthe cytoplasm of infected cells, and it is believedthat allofthereplication functionsarevirally

encoded. During DNA replicationthe incompletely base-paired terminal hairpin loops of the viral genome

transientlyexistintheform ofinvertedrepeatreplicative intermediates. These invertedrepeat structuresform

thetargetfor telomereresolutioneventsthatincludesequence-specffic cleavage and directedstrand exchange toformthe hairpintermini ofprogenyvirusgenomes.Theterminalsequencedomain which formsthe telomere

resolution target (TRT) shares considerable sequence similarity with viral latepromoters. In this study we

demonstrate that theTRT of SFV is capable of functioning as astrongviral promoter late in infection. A

spectrumofTRTmutationsaffectstelomereresolutionand latetranscription inastrictly concordant fashion,

suggestingthat thetwoactivitiesmaybeinextricably linked. Furthersupportfor thisconceptcomesfrom the

demonstrationthatalate SFVpromotersequencedesignatedcrypticTRT, which differs substantially from the

nativeTRTintermsofsequence,cansupporttelomere resolution when placed in thecorrectspatialcontext.

The proposed model for telomere resolution invokes directed unwinding of the TRT double helix by a

transcription initiation complexandprocessing oftheresulting secondarystructurebyvirallate-geneproducts.

Linear DNAgenomes are a commonfeature of complex

eucaryotic organisms and many viruses (2, 25). The

com-plete and accurate replication of linear DNA molecules

requiressomespecial mechanism to account for the need of

allknownDNApolymerases toutilize a 3' hydroxyl to prime

synthesis (8, 50). Many eucaryotic organisms have

over-cometheproblem ofreplicating chromosome termini bythe

useofatelomereterminaltransferase (telomerase) activity,

which synthesizes terminalsequenceina

template-indepen-dentfashion (reviewed in references 4 and53). An

alterna-tivestrategyfor thereplicationandmaintenance of

chromo-some termini isthe possessionof covalentlylinkedterminal

hairpin loops. This typeofDNA structure has been

identi-fied in avariety ofeucaryotic organelle and plasmid

chro-mosomes (5, 18,42), parvoviruses (2), African swine fever

virus(22),and poxviruses(1,16). TheleporipoxvirusShope

fibroma virus (SFV)and orthopoxvirus vacciniavirus have

double-stranded linearDNA genomes with hairpin termini

which exist in"flip" and"flop"configurations(1,16).During

the viralreplicative cycle,DNAsynthesis throughthe

hair-pin loops transiently generates inverted repeat structures

(38)which fusenascent viral genomestogether in arrays of

linear concatemers (13, 35). Production ofmature progeny

viral DNA requires that the inverted repeat replicative

intermediates be resolvedto yield unit-lengthgenomes with

flip and flop hairpin termini. The cytoplasmic site of viral

replication and the ability of poxviruses to

replicate

in

enucleatedcells(37)suggestthatalloftheactivities

required

for telomere replication and resolution are virally encoded

(reviewed inreference15).

Investigations into the resolution process have been

greatly aidedbytheobservationthatcloned versions ofthe

telomere replicative intermediates are replicated and

re-solved into linear minichromosomes with viral hairpin

ter-*Corresponding author.

mini when transfected into virus-infected cells (16, 33). The

minimalviral DNA sequences requiredincisfor the

resolu-tion ofreplicative intermediates have been determined by

bothdeletionandpointmutationanalysis(14, 16, 34)tobea

stretch of about 20 nucleotides located near the hairpin

termini.This target sequenceforthe viralresolution

machin-eryhasbeendesignatedthetelomereresolutiontarget(TRT)

(15). Despitetheoverall lackofsequencehomologynearthe

terminibetweendifferentgeneraof poxviruses for which this

information is available, the deduced TRT among various

poxviruses

shows remarkable conservation(15),

suggesting

thatacommonresolution mechanism may beutilizedbyall

poxviruses. This is

underscored

by the fact that SFV and

vaccinia virus canresolveeach other's telomeres (16) andis

consistentwith theobservationthat theseviruses

recognize

eachother'spromoters (28)andearly

transcription

termina-tion signals (49, 52).

Inspection of the conserved minimal TRT sequence

re-veals that it is verysimilartotherecentlydefinedconsensus

sequence for poxvirus late promoters (12). This sequence

similarity and the recent report that the telomeres ofthe

orthopoxvirus vacciniavirusaretranscribedlate ininfection

(40) suggest the

possibility

that

transcriptional

events in

somewayinfluence DNA

replication

ortelomereresolution.

In order to study the possible role of

transcription

in

telomere resolution,we haveundertakenan

investigation

of

theabilityof the SFV TRTtofunctionas aviral promoter. In

this communication we report the existence ofan intrinsic

relationship between telomere resolution and

specific

late-promoteractivity. Potential mechanisms by which the viral

transcriptional machinerymightactivate telomere resolution

arediscussed.

MATERIALS ANDMETHODS

Cells and viruses. BGMK cells

(African

green

monkey)

obtained from the American Type Culture Collection were

61

on November 10, 2019 by guest

http://jvi.asm.org/

grown in monolayer culture in Dulbeco modified Eagle's

medium (DME; GIBCO Laboratories) supplemented with

10% newborn calf serum (GIBCO). Human thymidine

kinase-minus (TK-) H143 cells usedtoselectrecombinant vaccinia

viruses were obtainedfrom D. Panicaliandgrownin

mono-layerculture inDMEsupplementedwith5%fetal calfserum

and 20 ,ug of

5-bromo-2'-deoxyuridine

(Sigma)per ml.

Vaccinia virus (strain WR) obtained from the American

Type CultureCollection was propagatedby the infection of

suspensionculturesofHeLaS3cells, whichwere agenerous

gift from V. Paetkau. SFV (Kasza strain) was similarly

propagated by theinfectionofmonolayer culturesof BGMK

cells. Virus stocks were prepared from cells harvested by

centrifugation at 48 h postinfection. The cell pellet was

swelled andDouncehomogenized(11, 51).Virustiters were

determined by infecting monolayers of 1.6 x

106

BGMK

cells with 10-fold serial dilutions of the crude virus stocks.

After1 h ofadsorptionina200-,u volume, fresh mediumwas

added and the infections wereallowedtoproceed for 48h, at

whichtime thecells were fixed andstained with 0.1% crystal

violet.

The recombinant vaccinia virus vCST-2a was generated

by the standard mechanism ofhomologous recombination

between aplasmid containingafusion oftheSFV TRTand

a bacterial chloramphenicol acetyltransferase (CAT)

re-portercassette intothevaccinia virusthymidine kinase(TK)

gene (30). Theinsertion vector usedin this study, pVV5.1,

hasbeenpreviously described(20). Thisvectorwascleaved

at

unique

sites with restriction enzymes SalI and BamHI,

and the linearized vector, with the vaccinia virus 7.5-kDa

protein (7.5K protein) promoter removed, was purified and

blunt ended with T4 DNA polymerase in the presence of

equalconcentrations of thefour

deoxyribonucleotides.

This

vectorwasused astherecipientfor aDNAfragment which

had been excised from pCST-1

(described

below) with

BamHI and SstI and whose overhanging ends had been

blunted with T4 DNA polymerase. The resulting insertion

vector, pVCST-1, consisted of the CAT gene under the

regulation of theminimal TRT sequence of SFVflankedon

both sides by vaccinia virus TK sequences. Recombinant

TK-viruses were selected on H143 cells in thepresence of

5-bromo-2'-deoxyuridine

and screened for the presence of

theinsertby dotblothybridization withaCATgene-specific

probe. The insertion site of the TRT-CAT sequence was

confirmedby Southern blotting.

Plasmids and strains. All bacterial plasmids which

con-tainedinverted repeats of viralsequence were maintainedin

Escherichia coli DB1256 (16), and all other plasmids were

propagated in E. coli HB101. The construction of all

plas-mids which contained inverted repeats of wild-type SFV

sequence and the deletion derivatives ofthis sequence has

been described previously (14, 16). Plasmids which

con-tained large inverted repeats of SFV telomere sequence

(pSAB-67,

pSXB-102,

and

pSCB-la)

were all derived by

removing theappropriateAccI,

XhoI,

orClaIfragment from

the plasmid pYSF1-30 described previously (16) and

sub-cloning the fragment into the SmaI site of pUC19. The

plasmid pSCX-1 was derived from pSCB-la by cleavage

with XhoI to delete the central-axis 0.7-kb fragment and

self-ligation ofthe vector to generate a palindromic insert

with acentral-axis XhoI site (see Fig. 6a).

Plasmids containingthe SFV TRTsequences upstream of

a promoterless CAT gene were generated by excising one

half of the inverted repeatofpSD-19 (14) ordeletion

deriv-atives of this construct as a

HindIII-AflIl

fragment. The

overhanging 5' ends ofthese fragments were filled withT4

DNA

polymerase,

and the blunted

fragments

were

ligated

intotheSmaIsiteofthevector

pMTL-24 (9).

Thetelomere

deletions of interest were then isolated from the

pMTL

constructsas

KpnI

fragments

andcloned into the

KpnI

site of

pUC19-CAT 4,

whichcontains theCATgeneclonedinto

the SmaI site of

pUC19

oriented such that CAT can be

placed

under thecontrolof viral sequences introducedinto the

KpnI,

SstI,

orEcoRI sites

(28).

The prototypemember of

this series ofvectors,

pCST-1,

contains the entire

wild-type

TRTsequence ofSFVobtainedfromthevector

pSAD-2

(14)

and

directing

expression

ofthe CAT gene.

Point mutations were

generated

inthe TRT

by

blunt-end

ligating

an

EcoRI-AflII fragment

from

pSAD-2

intotheSmaI

site of

M13mpl9.

This

ligation destroys

the EcoRI site but

regenerates the central-axis

AflIl

site.

Oligonucleotide-di-rected

site-specific

mutagenesis

was

performed

(26),

and the

appropriate

mutationswereidentified

by

dot blot

hybridiza-tion and then confirmed

by sequencing.

Themutated

EcoRI-AflIl fragments

were isolated and

self-ligated

or

ligated

to a

fragment

of

wild-type

sequencetogenerateinverted

repeats

whichwere subclonedinto the SstI site of

pUC19

and used

forassaysof telomere resolution. Forpromoter assays, the

mutated

fragments

were

ligated

into thevector

pUC19-CAT-4 so that the sequences could be tested fortheir

ability

to

direct CAT

expression.

Analysis of telomere resolution in transfected cells. The

ability

of the

wild-type

or mutated TRT inverted

repeat

sequences toberesolvedinto linearminichromosomeswith

hairpin

termini was assayed as

previously

described

(16).

Plasmid DNA

containing

inverted repeat telomere

se-quences was transfected into

previously

infected

monolay-ers of1.6 x 106 BGMK

cells,

and totalDNA washarvested

24 h after transfection. This DNA was treated with

restric-tion enzyme

DpnI

to cleave the

input unreplicated

DNA,

electrophoresed through

0.7% agarose gels, transfered to

nitrocellulosepaper,

hybridized

withnick-translated

plasmid

DNAprobes, and visualizedby autoradiography.

Promoter andtranscript analyses. BGMKcells which had

been infected with virus andtransfected with plasmidDNA

wereharvested20 hpostinfection, and thelysateswereused

for CATassaysasmodified forSFV-infected cells(28). RNA

synthesis driven from the TRT promoter in vaccinia virus

recombinantswasanalyzed by primer extension asfollows.

Monolayers

of BGMK cellsin 100-mmdishes were infected

withtherecombinant vaccinia virus vCST-2a at a

multiplic-ity

of 10 PFU percell;at2and 16 h postinfection, RNAwas

harvestedfromtheinfected monolayersby scrapingthecells

into

guanidinium isothiocyanate

(Sigma) and pelleting the

RNAthrough cesium chloride (10). Ofthis RNA, 40,ugwas

hybridized with 200 ng ofa 5'-end-labeled 17-mer

oligonu-cleotide

primer

whichwascomplementarytothe CAT gene.

This primer was extended with avian myeloblastosis virus

reversetranscriptase (Life Sciences Inc.) in the presence or

absence ofdideoxynucleotides as described previously (3).

The extended products of these reactions were

electro-phoresed through 8% polyacrylamide sequencing gels

con-taining8M ureaand visualizedvia autoradiography. Unless

otherwise specified, all of the restriction and modification

enzymes used in this study were obtained from Bethesda

Research Laboratories and used under the conditions

rec-ommendedbythe manufacturer.

RESULTS

Similarity between consensus TRT and late-promoter

se-quences. During the productive replication cycle of

on November 10, 2019 by guest

http://jvi.asm.org/

I IA

a

replication t resolution

I IA

Hairpin terminus

Transient inverted repeat

IA I

b

Box I Box IA

SFV TTTTTTTCTAG GGTTA TAAATTA VAC TTTTTTTCTAG ACAC- TAAATAA CPV TTTTTTTCTAG ACAC- TAAATAA RCN TTTTTTTCTAG ACAT- TAAATAA

FIG. 1. (a) The poxviral telomere in thematurehairpin form and in theinvertedrepeatconfigurationwhich exists transiently during

DNA replication. The inverted repeat structure is resolved by

trans-acting viral factors to yield two daughter hairpin telomere structures.Therelative positions of boxesIandIAoftheminimal TRTsequences areindicated, but extrahelicalbases on thehairpin andnonpalindromic sitesonthe invertedrepeat are not shown. (b) One copy of the TRT sequence of SFV, vaccinia virus (VAC), cowpoxvirus(CPV), andracoonpoxvirus (RCN).

ruses, the hairpin termini aretransiently convertedinto the

inverted repeat replicative intermediate which is the

sub-stratefortrans-actingviralfactorsthatcatalyzethe

isomer-izationof these sequences into two daughter hairpin termini

(15). As shown in Fig. 1, the minimal sequence domain

required for resolution consists oftwo blocks of sequence,

designated boxesIand IA, that arehighlyconservedamong

poxviruses and are separatedbya spacerof4 or 5

nucleo-tides that has diverged. Inspection of the conserved

se-quences which constitute boxes I and IA reveals a strong

similarity to the consensus structure ofvaccinia virus late

promoters (12). As can be seen in Fig. 2, the pll late

promoterdiffers by onlyonenucleotide from theconsensus

TRTwithinthealigned boxIand IAdomains,andmany of

the other characterized late promoters have a conserved

TAAAT motif which corresponds exactly to the TRT box

IA.

Transcription directed by the TRT sequences of SFV. To

investigate

thepossibilitythat theTRT sequenceofSFV is

capable

of

directing

orientation-specific transcription, we

constructedaseries ofplasmidvectorsinwhichthebacterial

CAT gene was placedunder the regulation of

well-charac-terized poxviral promoters or a single copy of the TRT

sequence and a series of mutated versions of the TRT that

had been created for resolution assays. CAT activity

as-sayedfromcellsharvestedatlatetimes showed that the TRT

was capableof directing gene expression in an

orientation-specificmanner(Fig. 3, lanes5 and6). Theeffectivenessof

the TRT as a promoter can be inferred by comparing the

amount of CAT activity directed from the TRT with the

levels from the SFV Ti early promoter (Fig. 3, lane 2) and

the vaccinia virus 7.5Kearly-late promoter(Fig. 3, lane 1).

A series of deletions of the SFV telomere sequence

indicate thatthe minimal TRT sequence in boxes I and IA

includes the essential sequence elements for promoter

activ-ity. 5' deletions which remove nucleotides from the

se-quence TT TTTT of box I (Fig. 4, lane 7) or 3' deletions

from the TAAAT of box IA(lane 8)eliminate the promoter

activity of the TRT. It has been observed that mutations

within the conserved TAAAT sequence of vaccinia virus

promoters will abrogate promoter function (12). When the

sequence TAAAT in box IA of the TRT is mutated to

TAACT, the ability of the TRT todirectgeneexpressionis

lost (Fig. 4, lane 10).

The mutatedversions of the TRT have been tested in an in

vivo resolution assay for their ability to support the

resolu-tion of inverted repeats into hairpin structures (14, 16).

Deletions from the 5' side which remove sequence from box

I orfromthe 3' side which remove box IA of the TRT onone

or both sides of the inverted repeat fail to support in vivo

hairpin resolution. Infact, thesamedeletionconstructs that

define the 5' and 3' boundriesof the TRT inresolution assays

also define the domain of the promoter function of the SFV

TRT. Thesame result has beenobserved forpointmutations

which alter the highly conserved TAAAT of box IA in terms

ofpromoteractivity (Fig. 4, lane 10) and resolution (seeFig.

7c). Thus a clearcorrelation canbe demonstratedbetween

theability of the TRT to direct transcription and the ability

to support theresolution of inverted repeats in vivo.

SFV TRT functions as a late promoter in a

transient-expression assay. Previouslyithas beenshown thatanearly

SFV promoter, Ti, will functioncorrectlyin a transfection

assay in cells infected with SFV or vacciniavirus (28). CAT

assays on lysates from infected/transfected cells indicate

that the TRTsequence of SFV can also direct the expression

of CATactivity in cells which had beeninfected with either

SFV orvaccinia virus(Fig. 5,lanes 1 and2). Thus the TRT

isrecognized bybothleporipoxvirusesandorthopoxviruses

as apromoter whenfusedas asinglecopy to the CAT gene

Box I -(spacer)- Sos IA

T T T T T T T C s a 0(4 or 5)- T A A A T TRT consensus.

T T T T T T T C T A T-( 4 ) T A A A T pll late promoter.

T T T T T T T A T A A-( 0 ) T A A A T ATI late promoter.

T T T T T T T T T 0 ( 4 ) T A A A T Synthetic MJ480 promoter. T T T T T A ! A 0 T A-( 13 ) T A A A T 7.5 k late promoter.

FIG. 2. The TRTisverysimilartopoxviruslatepromoters. The TRT sequence which is conserved among all of thepoxvirusesforwhich thesequenceis available (TRTconsensus)is shown alignedwith thesequences of the vaccinia virus 11-kDa gene late promoter(plllate promoter), cowpox A-type inclusion body promoter (ATI late promoter), an artificial strong late promoter synthesized to match the determinedconsensussequencefor vaccinia virus latepromoters(12)(SyntheticMJ480promoter),and thevacciniavirus 7.5-kDa genelate promoter(7.5klatepromoter).

on November 10, 2019 by guest

http://jvi.asm.org/

[image:3.612.58.296.73.292.2] [image:3.612.150.459.610.680.2]

Construct

L:*"

1

CAT

-r

I

^C A T _ st'-7t i

CAT

Act

ivity

.4,,

4.

_t,1v r C!

.

S s...

S.,

FIG. 3. Promoterproperties of the SFVTRT sequence. Plasmid constructscontainingtheCATgenedownstream ofthevacciniavirus 7.5-kDa early-late promoter(pV7.5-CAT), the twoorientations of the SFV Ti early promoter(pTlD3A2-111-CAT andpTldB-CAT), no promoter(pUC-CAT),orthetwoorientations of the SFVTRT(pCST-1 andpCST-3)weretested fortheirabilitytoexpressCATactivityin transientassays whentransfected into SFV-infected cells. Theshadings of boxIandIAarethesame asin Fig.1.

and as a resolution signal when in an inverted repeat

configuration. When the DNAreplication inhibitorcytosine

arabinofuranoside (araC)is usedto treatcellsduring

poxvi-rusinfection, late-gene expressionand DNAreplication are

prevented while early-geneexpression continues(37). In the

presence ofaraC, SFV-infected cellscontinue todirect the

expression of CAT activity from theSFVTiearlypromoter;

however, verylittle CATactivity is observedtobedirected

fromthe TRT (Fig. 5, lanes 3 and 4),suggestingthat the TRT

functionsas apromoterprimarilylate in infection.

SFV TRT functions as a late promoter in a recombinant

vaccinia virus. The ability of vaccinia virus trans-acting

factors to recognize and utilize the TRT of SFV as a late

promoterprompted us to test theability of the TRT to act as

apromoterfrom within the context ofthe viral genome. A

recombinant vaccinia virus, vCST-2a, in which the

TRT-directed CAT genewasinserted into the vaccinia virus TK

gene, was generated (Fig. 6). The 5' start site of RNA

collected at 16 h postinfection was mapped by primer

extension with a CAT-specific oligonucleotide probe. The

extended products from this primer display a number of

characteristics that are common to vaccinia virus late tran-scripts (Fig. 6b). As can be seen from the population of sizes whose diversity appears to begin within the TAAAT motif of

box IA (lanes 2 through 5), the 5' end is heterogeneous in

lengthandis likely to be polyadenylated in a fashion similar

tothat of late orthopoxvirus genes (3, 45). The length of the

apparent 5' poly(A) head of the TRT-CAT RNA is about 20

nucleotides, again consistent with other late poxviral

tran-scripts.The last5' sequence of the TRT-driven RNA which

is complementary to the DNA sequence is within the

TAAATcorrespondingtoTRTbox IA.Thus, in thiscontext

within the TK gene, the SFV TRT behaves as a rather

typical strong latepromoter.

Another late-promoter sequence can function to resolve

replicative intermediates. The observation that the minimal

TRT sequencecan act as alate promoterledus to

investigate

the possibilitythat other late promoters could, if

presented

in an inverted repeat configuration, function as a viral

telomere to be resolved into hairpins. To test this, we first

constructeda series oflarge inverted repeatsofSFV

telom-ere sequence (Fig. 7a). Plasmids pSAB-67, pSXB-102, and

pSCB-la all contain the native TRT within progressively

larger inverted repeats and can be efficiently resolved into

linearminichromosomes in vivo(Fig. 7b,lanes 1, 2,and3).

However, intheconstruct shown in lane4, thecentral-axis

XhoI fragment of pSCB-la was removed to generate

pSCX-1,whichcontainsa0.9-kbperfect palindromeof viral

DNAthat lacks the native central axis, includingthe entire

TRT sequences. Despite the removal of the SFV TRT

domain, pSCX-1canbereplicatedandresolved in vivo into

monomer and multimer linear minichromosomes (Fig. 7b,

lane4). Although the resolution of pSCX-1 is less efficient

than for constructs which possess the wild-type TRT, this

resultremainsparticularlystriking whenoneconsiders that

all of the palindromes of nonviral origin which have been

tested in theresolution assay havealwaysbeen inactive(31).

Compare, for example, the ability of this "cryptic" TRT

(cTRT)tocatalyzeresolutiontominichromosomes with the

completeablation of resolutionbyasingle pointmutation in

- ,-i; ,t,

on November 10, 2019 by guest

http://jvi.asm.org/

[image:4.612.135.486.75.365.2]

CAT

FY7Y~I NW

I i20 I

---XI.

VAR= :Ii Elt I

(AT AC'lVITY

---N.

3*

4. pSD77-CAT (A49) .L. . ---L-L-- f n-5. pSD)48-CAT (ASI)

6. pSD53-CAT (A91)

7. pSD56-CAT (Al12) -__I

8. pSD5-10-CATr (A57)

9. pCST-1 (CR) v----..Z JI r ==I S.

[image:5.612.109.514.81.368.2]

10. pCST-l/A-{1Cl--- -X-- 8

FIG. 4. CATassaydemonstrating the minimal TRTsequencesresponsible forpromoteractivity. CATassaysin infected/transfected cells

wereperformedasforFig. 3. pSD19-CAT (lane3)contains all of thesequencesin pCST-1 (lane 2) but also includes46bpof 3'sequencewhich

extendstothe axis ofsymmetryof thereplicative intermediate invertedrepeat.This 3'sequencecontains severalstartandstopcodons which result inadecreased expression of CAT activity in relationtopCST-1. Theconstructs in lanes4through7are 5' deletionsoftheparent pSD19-CAT.pSD5-10-CAT (lane 8) isa3' deletion of pSD19-CAT which completelyremovesTRTbox IA. Thenumber of nucleotides deleted ineachcaseisindicated in brackets. The cloning of pCST-1 resulted in the deletion of nucleotide A16,whichwas restored bysite-specific

mutagenesistowild-type in pCST-1 (CR) (lane 9). In

pCST-1/A2,-.C,

the TAAATsequenceof boxIAwasmutatedtoTAACT. Fortelomere resolution, + indicates that the plasmid containing this inverted repeat was resolved in vivo into monomer and multimer linear minichromosomesand-indicates that the plasmidwasreplicated butnotresolved. Theresolution data shown in lanes1through 9 havebeen

presentedpreviously (14, 16), and resolution data for

pCST-1/A26--a'C

areshown inFig. 7c.

the TRT box IA (Fig. 7c, lane 3) which had been shown

previously to destroy promoteractivity ofthe TRT(Fig. 3,

lane10).Apositive control for efficientinvivo resolution of

inverted repeats is provided by pSD-19, which possesses twoinvertedcopies of the SFV TRT (Fig. 7c, lane 1). The

replicated andresolved forms ofpSD-19maybe compared

Promoter Virus

( I) pCST-I TRT SFV

(2) pCST-1 tlRT Vaccinia

(3) pTI-CAT Iearly

CAT

D)rug Activity

* s

SFV araC

(4) pCST-I T,RT SFV araC'

0 to

0

FIG. 5. The TRTsequencefunctionsas apromoteronlylatein infection. Lanes 1and 2 illustrate thepromoterfunction of theSFV TRT when it istransfected into cellsinfected with either SFV or

vaccinia virus. Atransfected CATgeneunder theregulation ofan

earlypromoter(SFV T1) isexpressedwhenviral DNAreplication andlate-geneexpressionareblockedwitharaC (40 ,ug/ml).

with pUC19, which is replicated butnot resolved by

virus-infected cells (Fig. 7c, lane 2). Since the remaining SFV

sequence in pSCX-1 had not been assayed for promoter

activity,wefusedonehalf ofthepSCX-1inverted repeatto

a CAT reporter gene in both orientations, as was done

previously with the native SFV TRT, and used this as a

vectorfor transientassayinSFV-infectedcells.ThepSCX-1

fragment was also found to be capable of directing CAT

expression inan orientation-specific manner (Fig. 7d).

Ex-amination of the SFV sequence in pSCX-1 yielded no

regionswhichexactly fitthe TRTconsensus sequence, but

5' deletionanalysisidentified the sequenceTACGTTTACA CCTATATAAAT as a strong late-promoter elementin the transientexpressionassay(datanotshown).The 3'Tof the TAAAT of this sequence maps 96 nucleotides upstream of the XhoI site which forms the symmetry axis ofpSCX-1,and

sothepositionandorientation of this cTRTarevery similar

to those of the native TRT in the viral replicative interme-diate. Notice that since thetwostrandsatthesymmetryaxis of the resolution target segregate intothedaughter hairpins

(16, 34), the minichromosome generatedfrompSCX-1 will

represent viral telomeres with theXhoI sequences now at

the hairpin turnaround. Furthermore, since pSCX-1 is a

perfect palindrome,therecanbenoflipandflopisomersand

CON STRUC-JT 1. pUC-CAT 2. pCST-1 3. pSD19-CAT

Tis I DM FER E.

RESQLUTI1N ND

+

.4.

is.

I rda B., I I==kb-. i

on November 10, 2019 by guest

http://jvi.asm.org/

[image:5.612.56.296.570.673.2]

a

TTTTTTTCTAGGG TTATAAATTA

fVV

S TK

- ,primer 4

.-~

I-I

CAT

O. TK

4

b

Heterogeneous 5' polyadenylation

.;i

7l.

I_i

9

., v

3' IA

T A T T A A T A. T T 5

FIG. 6. Arecombinant vaccinia virus (VV)containingthe TRT sequenceof SFVdirects theexpression ofaCATreporter gene. (a)The plasmid pVCST-1wasused to constructtherecombinant vaccinia virus vCST-2awith theTRT-regulated CATgeneinsertedintothevaccinia virusTKgene. The relative position and orientation of the primer used for the RNAanalysisareindicated, and the apparent RNA start sites aremarked withasterisks. (b) Primer extension analysis oftheTRT-specificRNAsproduced late in infection with vCST-2a. End-labeled primerswereextended in thepresenceofdeoxynucleotideordideoxynucleotide ddCTP(lane 1),ddATP (lane2),ddTTP (lane 3), orddGTP (lane4) or inthe absence ofdideoxynucleotides(lane 5). Thenucleotide sequence of the DNA template is shown, with + 1indicatingthefirst nucleotide complementarytothe RNA. Lane 4 wasunderloaded,butthe sequenceofinterest isstillvisible.

all ofthe termini of pSCX-1 minichromosomes would be

identicalin sequence.

The relative positions of the TRT and the cTRT in the

matureandreplicative intermediate forms of the SFV telom-ere areillustrated inFig. 8. To date, we have been unable to

observe RNAtranscripts initiating at the TRT or the cTRT

sites when these sequences are at their normal telomeric

locations. It remains to be determined whethertranscription

and resolution are interdependent or possibly mutually

ex-clusive activities of the same sequence.

DISCUSSION

We have undertaken an investigation of the relationship

between viral transcription, which synthesizes RNA, and the resolution of poxvirus replicative intermediates, which is

asite-specific DNArecombination event. The involvement

oftranscriptionaleventsin theprocess of DNAreplicationis

well known from work on the mammalian papovaviruses

such as simian virus 40 and polyomavirus, in which

tran-scriptionalelementsareknown to berequiredfor the

initia-tionofDNAreplication(17, 23). Similarly,transcription has

been shown to "silence" replication origins (41) and in

eucaryoticcells may be involved in the selectionof

replica-tionorigins (24) and the termination or blocking of

replica-tion forks (7). To aid our investigation, we have taken

advantage of the previous observationthat clonedinverted

repeat versions of poxvirus telomeres are replicated and

resolved into linearhairpin molecules when transfected into

virus-infected cells (16, 33). Similarly, the regulation of viral promoters can be studied by transient assays in infected cells

and in recombinantpoxviruses. Both transcriptionand

res-olution are uniqueto infected cells, and it is believed that

virus-encoded factors areresponsible for bothactivities.

on November 10, 2019 by guest

http://jvi.asm.org/

[image:6.612.160.475.74.472.2]

Symmetry

Axis

Acc TRT TRT Acc

I. .m..I _ l

1.pSAB-67

2.pSXB-102

Cia

(ho I Xn0

. .=

Cryptic

TRT Xho

m-l

CryofIc

Xho TRT I X

0 8Kb

3.PSCB-Ia

Cia N I l "la

4.PSCX-I0l45K

b

2 3 4

-T

,V.'w-~~~~40

_- 40 -D

0

C

CA"'ac:I----, cTRT rAT

__

S

_ -M

wt A--C

20

FIG. 7. Identification ofacTRT sequence in SFV which is capableof acting as a late promoter and a resolution target. (a) Plasmids in which the SFV termini have been cloned in an inverted repeat configuration to mimic the replicative form of the virus. pSAB-67,pSXB-102, andpSCB-la consist of various lengths of viral telomere sequence, and all include the conserved TRT near the axis of symmetry of the inverted repeat. pSCX-1 was generated by the removal of a 0.7-kbXhoIfragment from the central axis of plasmid pSCB-la. Ligation of the resultingClaI-XhoIfragments produced a 0.9-kb perfect palindrome of viral DNA with a new central-axisXhoIsite andlacking the native

TRT.(b)Southernblot ofDpnI-resistantDNAharvested from SFV-infected cells which were transfected with pSAB-67 (lane 1), pSXB-102

(lane 2), pSCB-la (lane 3),orpSCX-1 (lane 4). The blot was hybridized with nick-translated pUC1932P-labeledDNA sothat the monomer andmultimer forms of only the plasmid DNA constructs are visualized. (c)Southernblot illustratingthe lethal effect of a point mutation within the criticalTRTboxIAsequence.DNAwasharvested from infected cells which had been transfected with pSD-19 (wild-type TRT [wt];lane 1), pUC-19 (no TRT) (lane 2), orpCST-1/A207*C (lane 3). (d) CATassay demonstrating the ability of a single copy of cTRT to act as a promoter. Lane1,ClaI-XhoIfragment of pSCX-1 fused to CAT such that theClaIsite forms the 5'end of the insert; lane 2, same vector with thepSCX-1 fragment intheopposite orientation.

A significant relationship between late transcription and

telomere resolution can be drawn from a number of

obser-vations. In this work we show that the TRT sequence

responsible fortelomere resolution in SFV is alsocapableof

acting as a promoter at late times during infection. This

capacity to drive transcription has been observed both in

transient assays and when the sequenceisintegratedwithin

the TK gene ofa recombinant viral genome. All mutated

versions of the TRT thus far investigated (point mutations

and 3' and 5' deletions) showa direct correlation between

the ability of a single copy of the TRT to function as a

promoter and theabilityof the inverted repeatconfiguration

to supporttelomere resolution intohairpin termini. Domain

analysis indicatesthatthe conserved regions of the known

TRTsequencesfrom SFV and severalorthopoxviruses(Fig.

lb) arevery similartothe consensus sequenceof viral late

promoters (Fig. 2). The overall variation in the catalog of

sequences of characterized late promoters may indicatethe

needfor the genes which they regulate to be expressed at

different levels (12). On the other hand, the apparent

on November 10, 2019 by guest

http://jvi.asm.org/

[image:7.612.138.470.69.493.2]

Cryptic

I TRT IA

roT

TTTTTCTACGTTTACACCTATATAAAT

TRT

TTTTTTTCTAGGGTTATAAAT

450 50 1

b

Cryptic TRT TRT Cryptic

TRT r ~ r~ I TRT

_I

II~p

450 50 1

Axlsotsymmetry

FIG. 8. Organization of the TRT and cTRT within the telomere of SFV in the mature hairpin form as packaged in the virion (a) and in the inverted repeat replicative intermediate configuration (b). Thearrows indicate the RNA start sites which have been determinedby primer extension (TRT) from constructs containing fusions to the reporter CAT gene. Whether these RNAs are synthesized from their telomeric locationinSFV during resolution in vivo remains to be established.

quenceconservation of the TRTdomainsmaybeareflection

of therequirement foraspecificdegree ofpromoteractivity

to obtain an optimal amount of telomere resolution at the

propertimeduring the viral replicative cycle. Thisargument

is supported by the observation that another late promoter

sequence, denoted cTRT, that maps over 0.4 kb from the

native viral terminus will also function to resolve inverted

repeats. The cTRT is less than 50% identical to the native TRTintermsof primarysequenceandyet supportstelomere

resolution at an appreciable efficiency, whereas all other

control palindromes tested are uniformly negative. Thus

telomereresolution mightbe atleastpartly regulated bythe

affinityof the TRTsequencefor transcriptionfactors which

areavailableatlate times duringinfection. Thesimilarityof the TRT sequence to late promoters thus suggests a novel

mechanism for limiting DNA processingevents toa

partic-ulartemporal stageofthe viral lifecycle.

The terminal regions ofthe vaccinia virus DNAgenome contain alarge region ofnoncoding repeats. Nevertheless,

vaccinia virus transcripts oriented towardtheterminus have

been detected in thisregion (40).The SFV terminicontaina

series of nine tightly packed open reading frames, all of whichareexpressedatearlytimes,with transcription being directed toward the telomeres (29). The Ti open reading frame is thegene mostproximalto the SFV terminus, and three signals to terminate early transcription have been identifiedbetweenTi and thehairpin (49).Thisclustering of termination signals may be a fortuitous observation or it

could be interpreted as an indicator of the importance of

preventing early transcription from entering the noncoding

region of thetermini.

Transcription of the viral telomeres alone is clearly not

sufficient for the resolution ofinverted repeats. The struc-tural requirements that the replicative intermediates be

nearly perfect palindromes with the TRT sequences in a

particular orientation and within a specific distance ofone

anotherhave been previouslydemonstrated (31, 32).Thisis furtherillustrated by the observation that the cTRT identi-fied in SFVis ahomolog ofa vaccinia virus sequencethat

directs transcription into the telomere at late times (40).

However, the SFV cTRT apparently has no effecton

telo-mereresolution untiltwoopposing copiesaremoved within

100 bp ofone another in an inverted repeat configuration.

Genetic studies of vaccinia virus which have attempted to

determine thespecificallelesimportantfor telomere resolu-tion have identified only mutants which are defective in someaspectoflate-gene expression (13, 35). This hasbeen

interpretedas anindication thatsomelate-geneproduct(s)is

essentialfortelomereresolution(35).Mostofthesemutants show defects in RNA polymerase, and it could also be

arguedthat the lack of telomere resolution results fromthe

defectin either late-RNAsynthesisorevensimplypromoter

recognition byelementsof the late-transcription apparatus.

One of themutantswhich isdefective in telomere resolution butcompetentfor latetranscription, ts22, has been charac-terized elsewhere (13, 35, 39). This mutation showsa

reso-lution-negative phenotype and is defective for the

produc-tion oflate-gene productsbecauseofdegradationof the viral mRNA. Another mutant, ts9383, is defective for resolution andhas been mappedto oneof the subunits of thecapping

enzyme (13).

While late transcription of the telomeres appears to be linked insomefashion totheresolution ofreplicative

inter-mediates, the question of the precise role played by RNA

synthesisremainsopen.It has beenshown thattranscription

in vivo can transiently alter the local topology ofthe

tem-plate DNA (21, 27, 48). Specifically, it has been

demon-strated that themovement ofan RNApolymerase complex

along duplex DNA can inducetwo supercoiled domains of

opposite signwhich balanceoneanother. Thegeneration of

positive superhelicaldensity whichoccurs aheadofa

tran-scription complexispresumably relaxedbytheactivityofa

topoisomerase. Indeed, it has recently been shown that in

eucaryotic cells, topoisomerase I may operate in close

conjunction with RNA polymerase II and is localized to

actively transcribed genes (46). However, an absolute

re-quirement for the relaxation of tension accumulated in

transcribed DNA hasyet tobeestablished,and

topoisomer-aseinhibitionstudiessuggestthatsuchanabsolute needmay notexist(43). Itis known thattranscriptionwith its

associ-ated superhelicaltensioncan proceed through palindromes

without causing the extrusion ofcruciform or other major

topologicalalterations (36). However, theeffect of creating

transcriptsfrompromoterswhicharearrangedheadtohead,

such as occurs at poxvirus telomeres, has not been ad-dressed.

The detailedsignificanceofconvergent promoters to

telo-mereresolution remainstobeworkedout.One model which

Hairpin terminus

on November 10, 2019 by guest

http://jvi.asm.org/

[image:8.612.174.449.72.232.2]

canbe envisaged involves theformation of open complexes by an RNA polymerase complex simultaneously on either side of an inverted repeat. This could result in sufficient unwinding of the DNA helix to allow the formation of a

secondary structure such as a Holliday junction analog

which could be cleaved by recombinationactivities encoded

by poxviruses (19). A model for cruciform extrusion has

been proposed to include site-specific unwinding by a

TRT-specific helicase activity (31). The present data suggest an

alternative activity, namelypromoter-dependentunwinding,

which could accomplish the same goal. Confirmation of the

mechanism for resolution will require an in vitro resolution

system,which this work indicates must include at least some

elements of the late-transcription machinery.

The utilization of promoter sequences to resolve

replica-tive intermediates is an elegantexampleof howviruses have

evolved to utilize a preexisting element for multiple

func-tions. It has been shown that in some eucaryotes, actively

transcribed DNA is preferentially involved in homologous

recombination (47). Similarly a strong correlation between

active transcription and site-specific recombination of the

immunoglobulin kappa genes hasbeendemonstrated (6, 44).

However, webelieve that this is the first example of

tran-scriptional events implicated in activating a site-specific

recombination event in eucaryotic viruses.

ACKNOWLEDGMENTS

We thank C. Upton, R. Condit, and R. Morgan for useful and stimulating discussionsand R. Maranchuk for technical assistance. This work was supported by salary stipends from the Alberta Heritage Foundation for Medical Research and by an operating grant to G.M. from the MRC ofCanada.

REFERENCES

1. Baroudy, B. M., S. Venkatesan, and B. Moss. 1982. Incom-pletely base-paired flip-flop terminal loops link the two DNA strands of the vaccinia virus genome into one uninterrupted polynucleotide chain. Cell28:315-324.

2. Berns, K.I. 1990. Parvoviridae and theirreplication, p. 1743-1763. In B. N. Fields (ed.), Virology, 2nd ed. Raven Press, New York.

3. Bertholet, C., E. V. Meir, B.Heggeler-Bordier, and R.Witteck. 1987. Vaccinia virus produces late mRNA by discontinuous synthesis. Cell50:153-162.

4. Blackburn, E. H. 1990. Telomeres: structure and synthesis. J. Biol. Chem. 265:5919-5921.

5. Blackburn, E. H., and J. G. Gall. 1978. A tandemly repeated sequence at the termini of the extra chromosomal ribosomal RNA genes inTetrahymena. J. Mol. Biol. 120:33-53.

6. Blackwell, K. T., M. W. Moore, G. D.Yancopoulos, H.Suh, S. Lutzker, E. Selsing, and F. W. Alt. 1986. Recombination be-tween immunoglobulin variable region gene segments is en-hanced bytranscription. Nature (London) 324:585-589. 7. Brewer, B. J., and W. L. Fangman. 1988. A replication fork

barrier at the 3' end of yeast ribosomal RNA genes. Cell 55:637-643.

8. Cavalier-Smith, T. 1974. Palindromic base sequences and the replication ofeukaryotic chromosomes. Nature (London)250: 467-470.

9. Chambers, S. P.,S.E.Prior, D. A.Barstow, and N. P. Minton. 1988. The pMTLnic- cloning vectors. I. Improved pUC poly-linker regions tofacilitate the use of sonicated DNA for nucle-otidesequencing. Gene68:139-149.

10. Chirgwin, J. M., A. E. Przbyla, R. J. MacDonald, and W. J. Rutter. 1979. Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18:5294-5299.

11. Condit, R. C., and A.Motyczka.1981. Isolation andpreliminary characterization oftemperature sensitive mutants of vaccinia

virus. Virology113:224-241.

12. Davison, A. J., and B. Moss. 1989. The structure of vaccinia virus late promoters. J. Mol. Biol. 210:771-784.

13. Delange, A. M. 1989. Identification of temperature-sensitive mutants ofvacciniavirusthat aredefective intheconversion of concatemeric replicative intermediates to the mature linear DNA genome.J. Virol. 63:2437-2444.

14. Delange, A. M., andG.McFadden.1987. Efficient resolution of replicated poxvirus telomeres to native hairpin structures

re-quirestwo invertedsymmetrical copies of a core target DNA sequence.J. Virol. 61:1957-1963.

15. Delange,A. M.,andG. McFadden. 1990.Therole of telomeres inpoxvirus DNAreplication. Curr. Top. Microbiol. Immunol. 163:71-92.

16. Delange, A. M., M. Reddy, D. Scraba, C. Upton, and G. McFadden. 1986.Replicationandresolution of clonedpoxvirus telomeresinvivogenerateslinearminichromosomes with intact viral hairpin termini. J. Virol. 59:249-259.

17. Depamphilis, M.L. 1988. Transcriptional elements as compo-nentsof eukaryoticorigins of DNA replication. Cell 52:635-638. 18. Ellis, T. H. N.,and A. Day. 1986. Ahairpin plastidgenome in

barley. EMBOJ. 5:2769-2776.

19. Evans, D. H., D.Stuart, and G.McFadden.1988.High levels of genetic recombination among co-transfected plasmid DNA in poxvirus-infected mammalian cells. J. Virol. 62:367-375. 20. Franke,C. A.,C. M. Rice, J. H. Strauss, and D. E. Hruby. 1985.

Neomycinresistanceas adominant selectable markerfor selec-tion and isolation ofvaccinia virus recombinants. Mol. Cell. Biol. 5:1918-1924.

21. Giaever,G. N., and J.C. Wang. 1988. Supercoiling of intracel-lular DNA can occurin eukaryotic cells. Cell 55:849-856. 22. Gonzalez, A., A. Talevera, J. M. Almendral, andE. Vinuela.

1986. Hairpin loop structure of African swine fever virus. Nucleic Acids Res. 14:6835-6846.

23. Hassell, J. A., W. J. Muller, and C. R. Mueller. 1986. Thedual role of the polyomavirus enhancer in transcription and DNA replication. CancerCells4:561-569.

24. Hatton, K. S., V. Dhar, E. H. Brown, M. A. Iqbal, S. Stuart, V.T. Didamo, and C. L. Schildkraut. 1988.Replicationprogram of active and inactive multigene families in mammalian cells. Mol. Cell. Biol. 8:2149-2158.

25. Kelly, T. J., M. S. Wold, and J. Li. 1988.Initiation of viralDNA replication. Adv. Virus Res. 34:1-42.

26. Kunkel, T. A., J. D. Roberts, and R. A. Zabour.1987.Rapid and efficientsite-specific mutagenesiswithoutphenotypic selection. Methods Enzymol. 154:367-382.

27. Liu, L. F., and J. C. Wang. 1987. Supercoiling of the DNA template during transcription. Proc. Natl. Acad. Sci. USA 84:7024-7027.

28. Macaulay, C., and G. McFadden. 1989. Tumorigenic poxvi-ruses: characterizationofanearlypromoterfromShope fibroma virus. Virology 172:237-246.

29. Macaulay, C., C. Upton, and G. McFadden. 1987.Tumorigenic poxviruses: transcriptional mapping of the terminal inverted repeats of Shope fibroma virus. Virology 158:381-393. 30. Mackett, M., G. L. Smith, and B. Moss. 1984. General method

forproductionand selectionof infectious vaccinia virus

recom-binants expressingforeigngenes. J. Virol. 49:857-864. 31. McFadden, G., D. Stuart, C. Upton, P. Dickie, andA. Morgan.

1988. Replication and resolution of poxvirus telomeres, p. 77-85. In T. Kelly and B. Stillman (ed.), Cancer cells 6. Cold Spring HarborLaboratory, Cold SpringHarbor, N.Y. 32. Merchlinsky, M. 1990. Resolution ofpoxvirustelomeres:

proc-essing ofvaccinia virus concatemerjunctions by conservative strand exchange. J. Virol. 64:3437-3446.

33. Merchlinsky, M., and B. Moss. 1986. Resolution of linear minichromosomes with hairpin ends from circular plasmids containing vaccinia virus concatemer junctions. Cell 45:879-884.

34. Merchlinsky, M., and B. Moss. 1989. Nucleotide sequence required for resolution ofthe concatemerjunction of vaccinia virus DNA. J. Virol. 63:4354-4361.

35. Merchlinsky, M., and B. Moss. 1989. Resolution of vaccinia

on November 10, 2019 by guest

http://jvi.asm.org/

virusDNAconcatemerjunctionsrequireslate geneexpression. J. Virol. 63:1595-1603.

36. Morales, N. M., S. D.Cobourn,and U.Muller.1990. Effect of in vitro transcription on cruciform stability. Nucleic Acids Res. 18:2777-2782.

37. Moss, B. 1990.Poxviridaeandtheirreplication,p.2074-2111. In B.N. Fields (ed.), Virology, 2nd ed. Raven Press, New York. 38. Moyer, R. W., and R. L. Graves. 1981. The mechanism of

cytoplasmic orthopox replication. Cell27:391-401.

39. Pacha, R. F., and R. C. Condit. 1985. Characterization ofa temperature-sensitive mutantof vaccinia virus reveals anovel function thatprevents thevirus-induced breakdown ofRNA. J. Virol.56:395-403.

40. Parsons, B. L., and D. J. Pickup. 1990. Transcription of or-thopoxvirus telomeres at latetimes during infection. Virology 175:69-80.

41. Patel,I.,and D.Bastia. 1986. Areplicationorigin is turned off by anorigin "silencer" sequence. Cell47:785-792.

42. Pritchard, A. E., and D. J.Cummings. 1981.Replicationof the linear mitochondrial DNA from Paramecium: sequence and structureoftheinitiation and crosslink. Proc. Natl. Acad.Sci. USA 78:7341-7345.

43. Schaak, J., P.Schendel, and T. Shenk. 1990. Transcription of adenovirus and Helacell genes in the presence of drugsthat inhibit topoisomerase I and II function. Nucleic Acids Res. 18:1499-1508.

44. Schlissel, M. S.,and D. Baltimore. 1989.Activation of immuno-globulin kappagenerearrangement correlates withinduction of

germline kappagenetranscription. Cell 58:1001-1007. 45. Schwer, B., P. Visca,J. C. Vos, and H. G.Stunnenberg. 1987.

Discontinuous transcription or RNA processing of vaccinia virus late messengers results in a 5' poly(A) leader. Cell 50:163-169.

46. Stewart, A. F., R. E. Herrera, and A. Nordheim. 1990. Rapid induction of c-fos transcription reveals quantitative linkage of RNApolymerase IIand DNAtopoisomeraseI enzyme activi-ties. Cell 60:141-149.

47. Thomas, B. J., and R. Rothstein. 1989. Elevatedrecombination ratesintranscriptionally active DNA. Cell56:619-630. 48. Tsao, Y. P., H. Y. Wu,andL. F.Liu.1989.Transcription driven

supercoiling: direct biochemical evidence from in vitro studies. Cell56:111-118.

49. Upton, C., A. M. Delange, and G. McFadden. 1987.Tumorigenic poxviruses: genomic organization and DNA sequence of the telomeric region of the Shope fibroma virusgenome. Virology 160:20-30.

50. Watson, J. D. 1972. Origin ofconcatemericT7 DNA. Nature (London)New Biol. 239:197-201.

51. Wills, A., A. M. Delange, C. Gregson, C. Macaulay, and G. McFadden.1983.Physicalcharacterization and molecular clon-ing oftheShope fibroma virus genome. Virology 130:403-414. 52. Yuen, L., and B. Moss. 1987. Oligonucleotidesequence

signal-ing transcriptional termination of vaccinia virus early genes. Proc. Natl.Acad. Sci. USA 84:6417-6421.

53. Zakian, V. A.1989.Structureand function of telomeres.Annu. Rev.Genet. 23:579-604.

on November 10, 2019 by guest

http://jvi.asm.org/