Copyright © 1997, American Society for Microbiology
A Novel Viral RNA Species in Sindbis Virus-Infected Cells
MATTHEW M. WIELGOSZ
ANDHENRY V. HUANG*
Department of Molecular Microbiology, Washington University School
of Medicine, St. Louis, Missouri 63110-1093
Received 3 March 1997/Accepted 8 August 1997
Sindbis virus (SIN), the type alphavirus, has been studied extensively to identify the viral cis-acting
sequences and proteins involved in RNA transcription and replication. However, very little is known about how
these processes are coordinated. For example, synthesis of the genomic RNA and the subgenomic mRNA
depends on the minus strand. Do these activities occur independently on different templates, or can replication
and transcription take place simultaneously on the same template? We describe the appearance of a
SIN-specific, plus-sense RNA that is intermediate in size between the genomic and subgenomic RNA species. This
RNA, designated RNA II, is observed in a number of different cell lines, both early and late in infection. The
number of RNA II species, their sizes, and their abundances are influenced by the subgenomic promoter. We
have mapped the 3
*
end of RNA II to a site within the subgenomic promoter, four nucleotides before the
initiation site of the subgenomic mRNA. Our results indicate that the appearance of RNA II is correlated with
subgenomic mRNA transcription, such that strong or active promoters tend to increase the abundance of RNA
II, relative to weak or less active promoters. RNA II is most abundantly detected with the full promoter and
is at much lower abundance with the minimal promoter. The possible origins of RNA II are discussed.
The alphaviruses belong to the Togaviridae family. They
have a global distribution and infect insect, avian, and
mam-malian hosts with various degrees of virulence (20, 46, 50, 62).
The identification of viral cis-acting sequences and trans-acting
proteins required for alphavirus replication and transcription
has led to the development of wide-host-range expression
vec-tors (4, 42, 73) and potential vaccines for disease-transmitting
mosquitoes (6).
In Sindbis virus (SIN), the first two-thirds of the incoming
genomic RNA is translated to yield two nonstructural
polypro-teins (nsPs), nsP123 and nsP1234. The polypropolypro-teins and/or
their proteolytic products constitute the viral contribution to
the RNA-dependent RNA polymerase (R-dRp). The exact
composition of the R-dRp is not known, and it may differ
depending on whether the R-dRp is engaged in replication or
transcription. However, several functions have been identified
or assigned to the individual nsPs which participate in viral
RNA synthesis. nsP1 is thought to be the enzyme that caps
viral RNA, since it can bind guanylate nucleotides (1) and
exhibits methyltransferase activity (45). nsP1 also functions in
minus-strand RNA synthesis (69). nsP2 has sequence motifs
characteristic of nucleoside triphosphate binding domains (17,
19, 27) and helicase domains (18). Indeed, nsP2 of Semliki
Forest virus (SFV) exhibits GTPase and ATPase activities
(52). However, attempts to demonstrate helicase activity in this
protein have not been successful (52). nsP2 also functions as
the nsP protease (68) and is critical to subgenomic mRNA
synthesis (24, 58, 59). Specific roles for nsP3 have not been
defined. nsP3 is serine/threonine phosphorylated in vivo (41)
and appears to be involved in genomic replication (24, 33, 35,
36, 64) and subgenomic mRNA transcription (33). nsP4
con-tains the GDD motif that is common to many viral RNA
polymerases (28) and is considered to be the polymerase of
SIN. Several temperature-sensitive (ts) mutations which affect
viral RNA synthesis have been mapped to nsP4 (23, 56), and
one of these renders the virus completely defective in RNA
synthesis (3, 30, 60).
The nsPs and/or their proteolytic products are believed to
assemble on the 3
9
end of the genomic RNA to synthesize a
complementary minus-strand RNA (31, 38). The minus strand
contains two cis-acting sequences that are critical to viral
rep-lication. The first is located at the 3
9
end of the minus strand,
and it directs the replication of genomic RNA, which, in turn,
is used for continued minus-strand synthesis and nsP
transla-tion (31, 40). The second cis-acting sequence is the subgenomic
promoter. It is located approximately 7.6 kb downstream from
the 3
9
end of the minus strand, and it is required for the
transcription of subgenomic mRNA (39, 47). Transcription
initiates at the promoter and by runoff transcription produces
a subgenomic mRNA that is 3
9
coterminal with the genomic
RNA. The subgenomic mRNA encodes the viral structural
proteins, and these package the genomic RNA into progeny
virions (22, 44, 67, 70, 71). As the SIN infection cycle
progresses, genomic RNA is routed predominantly into the
virion assembly pathway, concurrent with an increased rate of
plus-strand RNA synthesis, cessation of minus-strand
synthe-sis, and a decreased rate of nsP translation. The switch from
minus-strand synthesis early in infection to plus-strand
synthe-sis later in infection appears to involve the processing of the
nsPs into their individual nonstructural proteins and/or
pro-teolytic intermediates (12, 34–36).
It is not known how transcription and replication are
coor-dinated on the minus strand. There is some evidence that these
activities occur simultaneously on the same template (57, 63).
Three double-stranded (ds) replicative forms (RFs) have been
identified upon the treatment of partially ds replicative
inter-mediates with RNase (5, 13, 57, 63, 66). RF I constitutes a ds
form of the full-length genome, while RFs II and III
corre-spond to the ds forms of the first two-thirds (the nonstructural
region) and the remaining one-third (the structural region) of
the genome, respectively (66). Sawicki et al. found that an SFV
ts mutant exhibited decreased levels of subgenomic RNA
rel-ative to genomic RNA at the nonpermissive temperature and
displayed a correlated decrease in RFs II and III relative to RF
* Corresponding author. Mailing address: Department of Molecular
Microbiology, Washington University School of Medicine, Box 8230,
660 S. Euclid Ave., St. Louis, MO 63110-1093. Phone: (314) 362-2755.
Fax: (314) 362-1232.
9108
on November 9, 2019 by guest
http://jvi.asm.org/
I (57). Those authors concluded that a virus-specific protein
which functions to promote transcription and block genomic
RNA replication was responsible for the appearance of
RNase-sensitive sites within replicative intermediates, such that RNase
treatment of these species gave rise to RFs II and III (57).
Thus, when the virus-specific protein could not function
nor-mally at the nonpermissive temperature, the RNase-sensitive
sites of the replicative intermediates were masked and RF I
became the dominant species. Similar results were obtained by
Segal and Sreevalsan by using a ts mutant that was defective in
subgenomic mRNA transcription in SIN (63).
Although ds RNA can be obtained from infected cells upon
treatment with RNase, the predominant SIN-specific RNA
species in an infected cell are the single-stranded genomic and
subgenomic RNAs (65). Other single-stranded viral RNA
spe-cies have been observed in SIN (9, 26, 49, 53) and SFV (8, 29,
37). One species, in particular, was found to have a
sedimen-tation coefficient of 38S and an electrophoretic mobility
be-tween those of genomic and subgenomic RNAs under
nonde-naturing conditions (9, 37). When the SFV 38S species was
resolved under denaturing conditions, it was found to
comi-grate with the genomic 42S RNA (29). RNase T1
oligonucle-otide fingerprinting confirmed that the 38S species was most
likely a conformer of the genomic 42S RNA (29).
Recent observations in our laboratory (26) and others (49)
have shown that a glyoxal-denatured RNA species that is
in-termediate in size between genomic and subgenomic RNAs is
present in SIN-infected cells. This RNA, which we call RNA II,
may represent the single-stranded equivalent of RF II. Very
little is known about RNA II, other than that it is SIN specific
(unpublished observations) (49) and its appearance depends
on the SIN subgenomic promoter (26). We report here the
characterization of RNA II.
MATERIALS AND METHODS
Reagents, chemicals, isotopes, recombinant DNA materials, and methods.
Trizol reagent was obtained from Bethesda Research Laboratories (Grand Is-land, N.Y.). Cycloheximide was purchased from Sigma. [a-32P]GTP was from
Amersham (Arlington Heights, Ill.). [32P]orthophosphate and [g-32P]ATP were
obtained from ICN (Costa Mesa, Calif.). Restriction endonucleases and other recombinant DNA materials were purchased from New England Biolabs (Bev-erly, Mass.), Bethesda Research Laboratories, Epicentre Technologies (Madi-son, Wis.), or Boehringer Mannheim. Poly(A) polymerase was acquired from United States Biochemical (Cleveland, Ohio). A version of theDTaq DNA-dependent DNA polymerase was obtained at Washington University (St. Louis, Mo.), but the sequencing reaction was performed as described in theDTaq sequencing kit (United States Biochemical) for kinased primers. All molecular biology procedures were performed as described by Sambrook et al. (54), unless otherwise noted.
Cell lines.Unless otherwise noted, all vertebrate and invertebrate cells were grown at 37 and 30°C, respectively. Baby hamster kidney (BHK-21) cells (ATCC CCL10) were grown in minimal essential medium with Earle’s salts (MEM) supplemented with 10% heat-inactivated (HI) fetal calf serum (FCS). Cells between passages 5 and 15 were used. Primary chicken embryo fibroblasts (CEF) were prepared as described previously (48) and grown in MEM supplemented with 3% HI FCS, 100-U/ml penicillin, and 100-mg/ml streptomycin. Secondary CEF cells were used. C7-10 cells and C6-36 cells (ATCC 1660-CRL), originally isolated from Aedes albopictus larvae (55), were grown in MEM supplemented with 10% HI FCS and 10% tryptone phosphate buffer. Cells between passages 30 and 40 (C7-10) or 124 and 132 (C6-36) were used. African green monkey kidney (Vero) cells (ATCC 81-CCL) were grown in Medium 199 supplemented with 5% FCS (not HI). Cells between passages 125 and 132 were used.
Virus constructs.Toto1000 contains the entire SIN genome [11,703 nucleo-tides, excluding the poly(A) tail] downstream of the SP6 promoter (51). To-to1000 has one subgenomic promoter that is positioned;7.6 kb downstream from the virus’s 59 end. This promoter is required for transcription of the subgenomic mRNA which encodes the virion’s structural proteins. It is;4.2 kb in size and is 39coterminal with the genomic RNA.
TCS is similar to Toto1000, in that it contains the nonstructural (nsP) and structural (STR) coding regions of SIN. However, the nsP and STR coding regions of TCS are separated by the chloramphenicol acetyltransferase (CAT) gene (25). Additionally, TCS contains two subgenomic promoters (25). The first is the CAT promoter, and it is located;7.6 kb downstream from the 59end of
the genomic RNA (;12.6 kb). It is required for transcription of the CAT subgenomic mRNA, which is;5.0 kb in size and 39coterminal with the genomic plus-strand RNA. The second promoter is the STR promoter, and it is located
;8.4 kb downstream from the 59end of the genomic RNA. It is required for transcription of the STR subgenomic mRNA (identical to that of Toto1000), which is;4.2 kb in size and 39coterminal with the genomic plus-strand RNA. The CAT and STR promoters of TCS contain the298/114 subgenomic pro-moter sequences (298 refers to the number of nucleotides upstream of the start site of the subgenomic mRNA, and114 refers to the number of nucleotides downstream of the start site of the subgenomic mRNA).
The B2, III, and219/15 clones have been described previously and differ from TCS only in that their STR promoters are mutant (25, 26). The B2 STR pro-moter sequence was isolated from a library of viruses which contained random sequences between the213 and29 positions of the STR subgenomic promoter. The B2 virus has nucleotide changes at the213,210, and29 positions, where the wild-type A, G, and U nucleotides are replaced with G, A, and A, respec-tively. The III virus was another virus from the213 to29 library, and its STR promoter contained nucleotide changes at positions211 and210, where the wild-type G and G nucleotides have been replaced with C and C, respectively. The219/15 clone was constructed such that its STR subgenomic promoter contains the219 to15 promoter sequences in place of the298/114 promoter. TCIS is identical to TCS, except that a 979-bp insert is positioned immediately downstream of the CAT gene and immediately upstream of the STR promoter. Thus, the CAT subgenomic mRNA of TCIS is;6 kb in size and is 39coterminal with the genomic RNA. The STR subgenomic mRNA of TCIS is identical to that of Toto1000 (;4.2 kb in size and coterminal with the 39end of the genomic plus-strand RNA). TCIS was constructed as follows. TCS was digested with XhoI, and its ends were rendered blunt with T4 DNA polymerase and dephosphory-lated with calf alkaline phosphatase. A 979-bp insert was generated by digesting pSPORT1 (Bethesda Research Laboratories) with TaqI. The 979-bp DNA frag-ment was isolated, and its ends were rendered blunt. The XhoI-digested TCS vector and the 979-bp insert were ligated together by using T4 DNA ligase.
The240/114,240/15, and298/15 clones are identical to TCS, but their STR promoters (240/114,240/15, or298/15) have replaced the298/114 STR promoter of TCS. The construction of these clones was similar to that described for the219/15 clone (25), with some differences. First, the region of interest (i.e.,240/114,240/15, or298/15) was PCR amplified from the To-to1000 template by using oligonucleotides that contained the appropriate 59or 39
promoter sequences, flanked by either the XhoI or XbaI site, respectively. The PCR products were digested with XhoI and XbaI and directionally cloned into the Pneo S shuttle vector (25). The subcloned promoters were then digested with XhoI and BssHII and directionally cloned into TDV (25).
The219/114 clone differs from the219/15 clone in that the STR promoter contains the219/114 promoter in place of the219/15 promoter. The construc-tion of219/114 was done as follows. The219/15 clone was used as template DNA in the PCR amplification of a 211-nucleotide sequence using oligonucle-otides 1940 and 1914. Oligonucleotide 1940 (59CCCGTTTTCACCATGGGCA AATA 39) hybridizes to the noncoding strand of CAT 266 nucleotides upstream of the STR subgenomic mRNA start site. Oligonucleotide 1914 (59CTAGTCT AGAACTATGCTGACTATTTAGG 39) contains the25 to114 sequence and hybridizes to the coding strand of219/15, encompassing nucleotides25 to15 relative to the STR subgenomic RNA start site. The PCR product was digested with XhoI and XbaI and directionally cloned into the219/15 clone.
For the construction of TCS-21, Toto:ts 21 A2 was digested with BglII and ClaI and the 423-bp fragment was directionally cloned into TCS. Toto:ts 21 A2 contains a single G-to-A mutation at nucleotide 2590, changing Cys 304 of nsP2 to Tyr (24).
RNA transcription and transfection and preparation of viral stocks. SstI-linearized plasmids were transcribed in vitro with SP6 DNA-dependent RNA polymerase. The DNA templates were digested with DNase I, and the RNA transcripts were phenol, chloroform, and ether extracted prior to ethanol pre-cipitation. The transfection procedure was similar to that described by Liljestro¨m et al. (43). A 5-mg sample of a given transcript was mixed with 107BHK-21 cells,
and the cells were electroporated in a 0.2-cm gap electrocuvette using a T820 Electro Square Porator (BTX Inc., San Diego, Calif.). Transfected BHK-21 cells were added to 5 ml of growth medium, transferred to a culture dish, and incubated at 37°C for 16 h. The medium was collected and centrifuged at 12,0003g for 20 min at 4°C to pellet cell debris. Aliquots of the medium were placed into 0.5-ml microcentrifuge tubes and stored at280°C until use.
Infection and RNA labeling.Cells (;0.43106to 0.63106) were seeded onto
60-mm-diameter culture dishes. Vertebrate and invertebrate cells were main-tained at 37 or 30°C, respectively, for approximately 24 h. After this time, vertebrate cells approached 90% confluence while invertebrate cells approached 50% confluence. Vertebrate and invertebrate cells were both infected with virus at a multiplicity of infection (MOI) of 5 at either 37°C (vertebrate cells) or 30°C (invertebrate cells) in solution A (phosphate-buffered saline minus Mg21and Ca21) supplemented with 1% HI FCS. At 1 h postinfection (hpi), the inoculum was removed and the cells were washed twice with solution A (23°C) supple-mented with 1% HI FCS. The cell cultures then received 3 ml of the appropriate medium and were maintained at 37 or 30°C.
For RNA labeling in vertebrate cells, dactinomycin (1-mg/ml final concentra-tion) was added to the medium 1 h before labeling. The medium was then
on November 9, 2019 by guest
http://jvi.asm.org/
removed and replaced with 1.5 ml of labeling medium (1-mg/ml dactinomycin and 100-mC/ml [32P]orthophosphate in the appropriate phosphate-free cell
me-dium). The cells were incubated at 37°C for 2 h. RNA labeling for invertebrate cells was essentially the same as that for the vertebrate cells. Dactinomycin (5-mg/ml final concentration) was added to the medium 0.5 h before labeling (either 20.5 or 44.5 hpi). The medium was then removed and replaced with 1.5 ml of labeling medium (identical to the vertebrate labeling medium except for 5-mg/ml dactinomycin). The cells were incubated at 30°C for 3 h.
RNA isolation and analysis.The medium overlying each cell monolayer was removed, and the cells were washed twice with ice-cold solution A. The cells were solubilized with 3 ml of Trizol reagent and stored at280°C. RNA was isolated in accordance with the manufacturer’s protocol and dissolved in 10 to 30ml of diethylpyrocarbonate-treated water. Approximately 1/10 of the total RNA from a given cell sample was denatured with glyoxal and dimethyl sulfoxide (7) and electrophoresed through 1% agarose gels in 10 mM sodium phosphate (pH 7.0) (54). Gels were fixed with methanol and dried.32P-labeled RNA was detected by
autoradiography with film that was flash hypersensitized up to an A440of;0.15
above that of nonflashed film (32, 54). Exposures were done at280°C for 1 to 5 days without an intensifying screen.
32P-labeled RNA was quantitated on a Bio-Rad PhosphorImager. The
back-ground counts were estimated by the average counts above and below those of the RNA species and subtracted from the counts for the RNA species. The relative molar quantity of each viral RNA was determined by multiplying its background-subtracted counts by a size correction factor. For example, the relative amount of the structural subgenomic RNA of TCS compared to genomic RNA was calculated by multiplying the actual counts of the subgenomic RNA by 3.03 (length of TCS genome divided by the length of the STR subgenomic RNA, i.e., 12,589/4,156).
Northern blot analysis.The Northern blotting procedure was performed as previously described (54), with minor changes. Samples (3mg) of total RNAs from TCS-, Toto1000-, and mock-infected cells were denatured and resolved on a 1% agarose gel. The gel was soaked in 20 mM NaOH for 20 min and then washed extensively with water. The gel was neutralized with 203SSC (13SSC is 0.15 M NaCl plus 0.015 M sodium citrate), and the RNA was blot transferred overnight to a Hybond N1membrane (Amersham). The membrane was dried at room temperature and irradiated with 120 mJ of UV light (254 nm) with a Stratagene auto-cross-linker (Stratagene, La Jolla, Calif.). All probes used in the Northern analyses were in vitro transcribed from DNA templates by using the T7 DNA-dependent RNA polymerase and were radiolabeled with [a-32P]GTP. The
STR probe template contains the capsid coding sequences of Toto1000 between nucleotides 7612 and 7871 cloned into the HindIII site of pSPORT1. The CAT probe template contains nucleotides 195 to 442 of the bacterial CAT gene (2) directionally cloned into pSPORT1 at the BamHI and EcoRI sites. The non-structural (NSP) probe template contains the nsP4 coding sequences of To-to1000 between nucleotides 7338 and 7593 cloned at the HindIII site of pSPORT1. The runoff site for the STR and NSP probes was MluI, and that for the CAT probe was BamHI. The RNA probes were each of minus-sense polarity. To reprobe a blot, probes were removed from the membrane by twice pouring an
;98°C solution of 1% sodium dodecyl sulfate onto the membrane.
Poly(A) tailing.Total RNA (4mg in a volume of 7ml) was incubated at 50°C for 10 min, and then cooled on ice before the addition of 8ml of poly(A) reaction buffer [37.5 mM Tris HCl [pH 7.0], 1.68 mM MnCl2, 3.0 mM MgCl2, 1.87 mM
ATP, 94mM dithiothreitol, 1.5-mg/ml bovine serum albumin, 112.3 mM KCl, 18.7% glycerol, 18.8-U/ml poly(A) polymerase]. Poly(A) reactions were carried out at 30°C for 20 min with 10-U/ml (final concentration) poly(A) polymerase and were stopped by addition of phenol. Total RNA was chloroform and ether extracted and then ethanol precipitated with a tRNA carrier.
RT and PCR.Total RNA from the poly(A) reactions was solubilized in 10ml of a NotI oligo(dT) mixture [32mM NotI oligo(dT); 59GATCTAGAGCGGCC GCCCTTTTTTTTTTTTTTT 39in diethylpyrocarbonate-treated water), heated at 70°C for 10 min, and then cooled on ice. The reverse transcription (RT) reactions were performed in accordance with the Superscript II protocol at 48°C for 1 h. The reactions were terminated by heat denaturation at 70°C for 10 min. Half of each RT reaction mixture was used in a 100-ml PCR mixture with the 1940 and NotI oligo(dT) oligonucleotides at 1mM as primers and 2.5 U of Tth polymerase. Thirty-five PCR cycles were performed (one cycle was 40 s at 95°C, 30 s at 60°C, and 40 s at 72°C).
Cycle sequencing analysis.PCR-amplified products were resolved on 2.5% NuSieve GTG gels and gel purified (54). A 5-fmol sample of the PCR product was used per dideoxynucleotide termination reaction, in accordance with the
DTaq cycle sequencing kit instructions for kinased primers. The219/15 PCR product was sequenced with the 1941 primer (59GAATTACAACAGTACTGC GATGA 39), which hybridizes to the noncoding strand of CAT 152 nucleotides upstream of the STR subgenomic mRNA start site. The PCR products obtained for the XbaI TCS transcript, TCS, and B2 samples were sequenced with primer 1913 (59 CCGCTCGAGGGGGCCCATTACACCTGTCCTAC 39), which hy-bridizes to the noncoding strand of TCS, encompassing nucleotides298 to283 relative to the STR subgenomic mRNA start site. The sequencing reaction products were resolved on 8% denaturing polyacrylamide (19:1 acrylamide-bisacrylamide ratio) gels (54) and analyzed by autoradiography.
RESULTS
Gel analyses of SIN intracellular RNA reveal two prominent
bands: the 49S genomic and 26S subgenomic RNAs. A third
RNA species is frequently observed (see Toto1000 in Fig. 1A).
We call this RNA II. Similar RNAs have been observed and
shown to be isomers of the 49S genomic RNA (e.g., through
denaturation) (29). We previously showed that insertion of an
additional promoter into the SIN genome results in the
tran-scription of an additional mRNA. The new mRNA, like the
normal SIN subgenomic mRNA, initiates at the promoter and,
by runoff transcription, produces a new subgenomic mRNA
that is 3
9
coterminal with the genomic RNA (see CAT and
STR subgenomic mRNAs in Fig. 1A). Interestingly, these
vi-ruses produce two species of RNA II. Indeed, several physical
characteristics of RNA II are determined by the subgenomic
promoter (26). Toto1000 has one subgenomic promoter which
directs the transcription of the STR subgenomic RNA. TCS
and its derivatives (B2,
2
19/
1
5, III, and TCIS) have two—the
CAT promoter, which directs the transcription of the CAT
subgenomic RNA, and the STR promoter, which directs the
transcription of the STR subgenomic RNA. As shown in Fig.
1A, Toto1000 has only one RNA II species, while TCS and its
derivatives have two. These results show that the number of
different RNA II species in the cell correlates with the number
of promoters in the infecting virus.
The second property of RNA II that is affected by the
sub-genomic promoter is size. The STR promoter of Toto1000 and
the CAT promoters of TCS and its derivatives are each
[image:3.612.309.547.71.306.2]posi-tioned
;
7.6 kb downstream from the 5
9
ends of each virus.
FIG. 1. Properties of RNA II that are determined by the subgenomic pro-moter. (A) BHK-21 cells were infected with the appropriate virus at an MOI of 5 and treated with dactinomycin 1 h before labeling with [32P]orthophosphate at
3 hpi. At 5 hpi, total RNA was isolated, denatured, and resolved on a 1% agarose gel. Exposures were at280°C for 2 to 5 days. G is genomic RNA. Lg and Sm are the large and small RNA II species, respectively. The CAT and STR subgenomic RNAs are designated CAT and STR, respectively. (B) Same as in A but the in vivo-incorporated label of each RNA (relative to the genomic RNA of the virus) was quantitated on a Bio-Rad PhosphorImager and used to calculate the STR/ CAT and Lg/Sm ratios shown. These relative molar ratios have been normalized
against those obtained for TCS.
on November 9, 2019 by guest
http://jvi.asm.org/
Accordingly, the sole RNA II species of Toto1000 and the
small RNA II species of TCS and its derivatives have identical
mobilities, corresponding to a size of 7.6 kb (Fig. 1A). The
same relationship holds for the STR promoters of TCS and its
derivatives, which are positioned
;
8.43 kb downstream from
each virus’s 5
9
end (except for that of TCIS). The STR
pro-moter of TCIS is positioned 979 nucleotides downstream from
the original STR promoter position of TCS. As shown in Fig.
1A, the new position of the STR promoter correlated with an
increase in the size of the large RNA II species, from
;
8.43 to
;
9.41 kb. These results not only demonstrate that the size of
RNA II is determined by the position of the subgenomic
pro-moter but also suggest that RNA II is colinear with the 5
9
end
of genomic RNA and has a 3
9
end that is close to the position
of the subgenomic promoter.
A third characteristic of RNA II that is affected by the
subgenomic promoter is abundance. We previously found that
the abundance of RNA II decreases when the strength of the
subgenomic promoter decreases (26). Indeed, the
2
19/
1
5
vi-rus, whose STR promoter contains the
2
19/
1
5 promoter
se-quence in place of the
2
98/
1
14 STR promoter of TCS, has a
weaker STR promoter than TCS (as assessed by the relative
decrease in the STR-to-CAT subgenomic RNA ratios), and
this correlated with decreased large (Lg)-to-small (Sm) RNA
II ratios compared to TCS (Fig. 1A). Similar results were
obtained with the B2 virus, which contains a weaker STR
promoter than TCS (see Materials and Methods). The relative
molar ratio of STR to CAT subgenomic mRNAs for B2 is
;
0.6
(as assessed by PhosphorImager scans), while that for TCS is
1.9. Correspondingly, the ratio of Lg to Sm RNA II for B2 is
;
0.5, while that for TCS is
;
1.5. In contrast, the STR
pro-moter of virus III has activity comparable to that of the TCS
STR promoter (26), where the relative molar ratios of STR to
CAT subgenomic mRNAs are 1.7 for III and 1.9 for TCS. This
corresponded to a Lg-to-Sm RNA II ratio similar to that
ob-tained for TCS (
;
1.0 for III and
;
1.5 for TCS).
We explored the association of RNA II abundance and
subgenomic promoter activity further, with derivatives of TCS
that contained various deletions in their respective STR
pro-moters. The
2
40/
1
14,
2
40/
1
5,
2
98/
1
5, and
2
19/
1
14 viruses
are identical to TCS, except that their STR promoter
se-quences have replaced the
2
98/
1
14 STR promoter of TCS. As
shown in Fig. 1B, the Lg-to-Sm RNA II ratios of the
2
19/
1
5
and
2
19/
1
14 viruses are lower than that obtained for TCS,
and these correlate with decreased STR-to-CAT subgenomic
mRNA ratios (relative to TCS). Note that the STR/CAT and
Lg/Sm ratios listed in Fig. 1B are normalized against those
obtained for TCS. The addition of the
1
6 to
1
14 promoter
sequences to the minimal
2
19/
1
5 promoter in
2
19/
1
14
de-creased its STR-to-CAT subgenomic mRNA ratio nearly
threefold compared to that of
2
19/
1
5, and this corresponded
to a Lg-to-Sm RNA II ratio that was lower than that obtained
for
2
19/
1
5. In contrast, the STR-to-CAT subgenomic mRNA
ratios of the
2
40/
1
5 and
2
98/
1
5 viruses are not appreciably
different from that of
2
19/
1
5, but their Lg-to-Sm RNA II
ratios are four- to fivefold greater than that of
2
19/
1
5 (Fig.
1B). These results indicate that the
2
40 to
2
20 promoter
sequences, when placed upstream of the minimal
2
19/
1
5
pro-moter, can increase the abundance of RNA II in a way that
does not appear to be related to promoter strength.
Interest-ingly, the
2
40 to
2
20 promoter sequences do enhance
pro-moter strength when they are placed upstream of the
2
19/
1
14
STR promoter. Indeed, the activity of the
2
40/
1
14 STR
pro-moter is nearly indistinguishable from that of the
2
98/
1
14
STR promoter of TCS (Fig. 1B).
Appearance of RNA II in different cells.
RNA II has
previ-ously been observed in BHK-21 hamster and C7-10 mosquito
cells (25, 26). We used Vero, CEF, and C6-36 cells as
addi-tional hosts for infection by TCS and analyzed the appearance
of RNA II at different times during the infection cycle. The
times at which total RNA was harvested were determined by
selecting the stages of TCS growth that were comparable
among the different cell types. As shown in Fig. 2, RNA II was
detected in all of the vertebrate (Fig. 2A) and invertebrate
(Fig. 2B) cells tested, both early and late in infection. The
mock-infected samples of the vertebrate and invertebrate cells
did not yield any radiolabeled RNA species similar in size to
RNA II (data not shown). RNA II was observed in BHK-21
cells infected at 30°C and as early as 3 or 8 hpi in BHK-21 and
C7-10 cells, respectively (data not shown). These experiments
demonstrate that the appearance of RNA II is not limited to a
particular cell type, stage of infection, or temperature and
suggest that the appearance of this RNA in infected cells is a
general phenomenon. We performed several experiments like
those depicted in Fig. 2 to measure the relative molar
abun-dance of RNA II compared to the genomic and subgenomic
RNAs of TCS and Toto1000. Intracellular viral RNAs were
labeled for 2 h before isolation and gel analysis. The results are
summarized in Table 1. Under these conditions, the relative
molar abundance of RNA II changes by about twofold
be-tween 5 and 8 hpi (Table 1). On average, there is
approxi-mately 1 RNA II species to every 7 genomic or 50 subgenomic
RNAs in Toto1000-infected cells. These are minimal
esti-mates, as the stability of RNA II may be less than that of the
other viral RNAs.
Northern blot analysis of RNA II.
We previously found that
a negative-sense probe complementary to the 5
9
end of
[image:4.612.321.534.70.307.2]genomic RNA could detect RNA II by Northern blot
hybrid-ization (unpublished results). This indicated that RNA II is of
FIG. 2. Appearance of RNA II in different vertebrate (A) and invertebrate (B) cells, both early and late in infection. Cells were infected with TCS at an MOI of 5 and treated with dactinomycin for 1 h (vertebrate) or 0.5 h (invertebrate) before labeling with [32P]orthophosphate. The cells were labeled for 2 h
(verte-brate) or 3.5 h (inverte(verte-brate) before total RNA was isolated at the times shown. For definitions of abbreviations, see the legend to Fig. 1.
on November 9, 2019 by guest
http://jvi.asm.org/
plus-sense polarity and suggested that its 5
9
end is coterminal
with genomic RNA. Furthermore, the results of Fig. 1A
sug-gested that the 3
9
end of RNA II is close to the position of the
subgenomic promoter. We determined the boundary of each
RNA II species in TCS- and Toto1000-infected cells by
North-ern blot analysis using negative-sense probes that hybridize to
positions both upstream and downstream of the subgenomic
promoter.
We first used an STR probe that is complementary to
se-quences immediately downstream of the STR subgenomic
pro-moter, between nucleotides
1
15 and
1
259 of Toto1000 or
nucleotides
1
21 and
1
264 of TCS. There are 35 nucleotides in
the STR subgenomic untranslated region (downstream of the
STR promoter) which are identical to those in the CAT
sub-genomic untranslated region (downstream of the TCS CAT
promoter). The Lg RNA II species of TCS contains these
nucleotides and may be detected by the STR probe. As shown
in Fig. 3A, the STR probe detected the genomic RNA of each
virus, as well as the CAT subgenomic mRNA of TCS and the
STR subgenomic mRNA of both viruses. However, the STR
probe failed to detect the RNA II species of either virus. This
result indicates that the 35 nucleotides of complementarity
between the Lg RNA II species of TCS and the STR probe was
insufficient for its detection and suggests that any RNA II
species whose 3
9
end extends beyond the STR subgenomic
promoter to include only the 35 nucleotides of the STR or
[image:5.612.53.548.81.153.2]FIG. 3. Northern blot analysis of RNA II. BHK-21 cells were infected with Toto1000 or TCS at an MOI of 5 or mock infected. Total RNA was harvested at 5 hpi. RNA (3mg per sample) was resolved on a 1% agarose gel and transferred to a nylon membrane. The membrane was probed with an in vitro-transcribed minus-sense STR probe (A), CAT probe RNA (B), or NSP probe (C). (D) Target RNAs of the different probes for TCS between nucleotides 7250 and 8750. The coding regions of TCS are designated NSP, CAT, and STR and are shown as filled boxes (black, textured gray, and white, respectively). The white boxes represent the untranslated region downstream of the CAT and STR promoters. The CAT and STR promoters are represented by arrows and the subscript P. The hash marks designate 150-nucleotide intervals. The open area upstream of the STR promoter represents the XhoI and ApaI sites of TCS. The probes are labeled and represented as shaded boxes which correspond to their target sequences. For definitions of abbreviations, see the legend to Fig. 1.
TABLE 1. Relative molar ratios of RNA II in TCS and Toto1000-infected BHK-21 cells at 37°C
Virus, hpi Ratio6SD
a
nb
G/STR G/CAT G/Sm G/Lg STR/Sm STR/Lg CAT/Sm
Toto1000, 5
0.10
6
0.03
5
6
1
47
6
10
3
Toto1000, 8
0.14
6
0.04
8
6
2
55
6
6
3
TCS, 5
0.33
6
0.05
0.56
6
0.14
15
6
4
18
6
4
59
6
10
27
6
8
5
TCS, 8
0.25
6
0.07
0.56
6
0.16
10
6
4
10
6
1
37
6
7
17
6
6
3
aThe in vivo incorporated label of each RNA species (relative to the genomic RNA of the virus) was quantitated on a Bio-Rad PhosphorImager and used to calculate
the relative molar ratios shown. G refers to the genomic RNA, STR and CAT refer to the STR and CAT subgenomic RNAs, and Sm and Lg refer to the small and large RNA II species, respectively. SD, standard deviation of each RNA ratio, from n experiments.
bn, number of independent experiments performed.
on November 9, 2019 by guest
http://jvi.asm.org/
CAT subgenomic untranslated region (which are
complemen-tary to the STR probe) would not be detected. Thus, the 3
9
end
of RNA II does not extend significantly beyond the STR
pro-moter.
We removed the STR probe from the membrane and
re-probed the blot a second time with a CAT probe that is
com-plementary to the 5
9
untranslated region of CAT and a portion
of the CAT coding region between nucleotides 7657 and 7876
of TCS, several hundred nucleotides upstream of the STR
promoter and 45 nucleotides downstream of the CAT
pro-moter. As shown in Fig. 3B, the genomic and CAT subgenomic
RNA species of TCS were detected but the STR subgenomic
mRNA of TCS was not. The CAT probe did not detect any
RNA species in the Toto1000 sample, since this virus does not
contain any CAT sequence. The CAT probe did detect the Lg
RNA II species of TCS but failed to detect the Sm RNA II
species. This indicates that the 3
9
end of the Lg RNA II species
extends sufficiently beyond the CAT promoter for its detection
but the 3
9
end of the Sm RNA II species does not.
To map the 3
9
end of RNA II more precisely, we stripped off
the CAT probe and reprobed the blot a third time with an NSP
probe that is complementary to nucleotides
2
263 to
2
5 of the
subgenomic promoter. The STR and CAT promoters of TCS
have identical sequences between nucleotides
2
98 and
2
5.
Thus, the NSP probe is complementary to 93 nucleotides of the
CAT subgenomic mRNA of TCS and may detect this species.
The results presented in Fig. 3C demonstrate that the genomes
of TCS and Toto1000 were detected, as expected. The NSP
probe did not hybridize to the STR subgenomic mRNA but did
give a signal for the CAT subgenomic mRNA of
TCS—indi-cating that the 93 nucleotides of complementary between the
NSP probe and the CAT subgenomic mRNA of TCS were
sufficient for its detection. The NSP probe also detected the
RNA II species of each virus. This result, in combination with
those obtained from Fig. 3A and B, demonstrates that the 3
9
end of each RNA II species lies in close proximity to the
position of the subgenomic promoter.
3
*
end of RNA II.
Because the abundance of RNA II is low
(Table 1), we polyadenylated the 3
9
end of this species to
facilitate its amplification for sequence analysis. A control
ex-periment was first performed by using runoff transcripts that
were synthesized from the XbaI-digested TCS plasmid. In
TCS, the XbaI site is 15 nucleotides downstream of the STR
promoter. Thus, transcripts which terminate at this site are
similar in size to the large RNA II species of TCS. We used 100
fmol of transcript in two separate polyadenylation reactions,
either in the presence or in the absence of RNA from
unin-fected BHK-21 or C7-10 cells. After the polyadenylation
reac-tions, the NotI oligo(dT) primer was used to prime cDNA
synthesis and the products were PCR amplified by using the
1940 and NotI oligo(dT) primers (Fig. 4A). Any RNA having
a free 3
9
-OH should be polyadenylated and competent for
subsequent cDNA synthesis. However, only those products
which contain CAT sequences complementary to the 1940
primer should be amplified. The distance from the 5
9
end of
the 1940 primer to the XbaI runoff site is 284 nucleotides, and
the length of the NotI oligo(dT) primer is 33 nucleotides.
Consequently, a PCR product of no less than 317 bp was
expected (Fig. 4A). Indeed, we obtained from each transcript
sample (either in the presence or in the absence of RNA from
uninfected cells) a PCR product that was slightly larger than
310 bp (data not shown). The results of Fig. 4B show that the
sequence of each PCR product is identical to that of the TCS
STR promoter and the poly(A) tail was added exactly at the
XbaI site.
We then treated RNA from TCS-infected cells with this
amplification method. Total RNA (4
m
g) was used in the
poly-adenylation reaction, and RT-PCR was performed as
de-scribed before. A PCR product of approximately 300 bp was
generated (Fig. 4A). The results presented in Fig. 4C show that
the sequence of the PCR product was that of the TCS STR
promoter, and the poly(A) tail was added to position
2
4 of the
STR promoter. In related experiments, we found that the small
RNA II species of TCS and the large RNA II species of
TCS-infected CEF and C7-10 cells have sequences identical to
that of the STR subgenomic promoter, with poly(A) tails
added to position
2
4 of the subgenomic promoter (data not
shown). Taken together, these results suggest that similar
mechanisms generate the 3
9
end of RNA II in different cell
types and different subgenomic promoters.
We also tested if the 3
9
end of the large RNA II species in
2
19/
1
5- and B2-infected cells were different from that
ob-tained with TCS. The size of the PCR product of the B2
sample was approximately 300 bp, while that of
2
19/
1
5 was
;
220 bp (since nucleotides
2
98 to
2
20 of the STR promoter
are deleted) (data not shown). The abundance of the B2 and
2
19/
1
5 PCR products was lower than that of the TCS product
(data not shown), probably because these viruses have
rela-tively less of the Lg RNA II species than the Sm RNA II
species, compared with TCS (Fig. 1A). As shown in Fig. 4D,
the sequence of each PCR product is identical to that of the
STR promoter of each virus. In both cases, the poly(A) tail was
added to position
2
4 of the STR promoter. These results
indicate that the
2
19/
1
5 subgenomic promoter alone, in the
absence of flanking promoter sequences, determines the 3
9
end
of RNA II. Similarly, nucleotide substitutions at positions
2
13,
2
10, and
2
9 of the B2 STR promoter do not affect the 3
9
end
of RNA II.
Possible origins of RNA II.
Since RNA II is of plus-sense
polarity (Fig. 3 and 4), it is conceivable that it might originate
from the cleavage of genomic RNA at the position of the
subgenomic promoter at any time during the isolation or
anal-ysis of viral RNA. We tested this possibility by adding
radio-labeled TCS transcripts to Trizol-solubilized monolayers of
infected or mock-infected cells. The results of Fig. 5A show
that the samples which received TCS transcripts did not
gen-erate prominent, RNA II-like species and indicate that the
procedures used to isolate and analyze the viral RNA of TCS
do not cleave genomic RNA at the position of the subgenomic
promoter to yield significant amounts of RNA II-like species.
It should be noted that RNA species similar in size to the STR
subgenomic mRNA of TCS do accumulate, and these species
appear to be in vitro transcripts that prematurely terminate
within the nsP coding region (as assessed by Northern blot
analysis).
The generation of RNA II by some unknown mechanism
may require active transcription at the subgenomic promoter,
since the appearance of RNA II is correlated with subgenomic
mRNA synthesis (Fig. 1 and 2). Thus, inhibition of subgenomic
mRNA synthesis should prevent the appearance of RNA II.
This hypothesis was tested two ways.
Cycloheximide prevents or limits the formation of first-time
subgenomic mRNA transcription complexes during the early
part of infection but does not affect replication complexes
which have formed prior to treatment (61). We used this drug
between 2 and 3 hpi (a time at which the formation of
sub-genomic transcription complexes should be sensitive to
cyclo-heximide treatment) to observe its effect on the appearance of
RNA II. At 5 hpi, total RNA was isolated. As shown in Fig. 5B,
the samples that received cycloheximide within the first 140
min pi had substantially less subgenomic RNA than did
sam-ples receiving later treatments. This correlated with a decrease
on November 9, 2019 by guest
http://jvi.asm.org/
in the abundance of RNA II to nearly undetectable levels. At
2 h 40 min pi, the effect of cycloheximide on subgenomic
mRNA synthesis was minimal and this corresponded to an
increased abundance of RNA II compared to that in samples
treated earlier. At 3 hpi, the effect of cycloheximide was not
apparent. Indeed, the relative abundances of the subgenomic
mRNAs and RNA II to the genomic RNA for the 3-h
cyclo-heximide sample was indistinguishable from that of the
un-treated sample. We also found that cycloheximide-un-treated
samples that were isolated at 3 versus 5 hpi exhibited similar
patterns of inhibited subgenomic mRNA synthesis, and this
correlated with a decrease in the abundance of RNA II (data
not shown). These results suggest that treatment with
cyclo-heximide during the early part of the infection cycle inhibits
the translation of proteins that are required for subgenomic
mRNA synthesis and correspondingly reduces the abundance
of RNA II to nearly undetectable levels. The results of Fig. 5B
also suggest that genomic RNA, despite having an increased
abundance relative to subgenomic mRNA in this experiment,
is not cleaved during the isolation and analysis of viral RNA to
yield RNA II.
[image:7.612.66.523.98.476.2]The second method we employed to determine the effect of
defective subgenomic mRNA synthesis on the abundance of
RNA II involved the use of a mutant virus. Toto:ts 21 A2 is
RNA negative at the nonpermissive temperature (58) and is
defective in subgenomic mRNA synthesis in a
temperature-independent manner (11). The causal mutation of Toto:ts 21
A2 maps to residue 304 of nsP2 but does not affect nsP
pro-cessing (24). We introduced this mutation into the TCS
con-struct to create TCS-21. Cells were infected with TCS and
FIG. 4. Sequence determination of the 39end of RNA II. (A) Primers used to amplify and sequence the 39end of the XbaI TCS transcript and the Lg RNA II species of TCS. The 1940 and NotI oligo(dT) primers were used for RT-PCR amplification, and the 1913 primer was used for sequencing. The 59ends of each primer are shown as gray-filled circles. The lines that are labeled RNA or single-stranded DNA (ss DNA) represent intermediates used in the amplification procedure for each sample but are scaled with respect to the Lg RNA II species of TCS. The coding regions in each PCR product are represented by filled boxes (textured gray for CAT and black for NSP). The open box for the XbaI TCS transcript represents the region downstream of the STR subgenomic mRNA start site (indicated with an arrow). The cDNA species are extended minimally by 33 nucleotides [the length of the NotI oligo(dT) primer]. The line which makes up the right side of each PCR product represents this 33-nucleotide extension. (B) 39-end sequence of XbaI-linearized TCS transcripts, either in the presence or in the absence of RNA from C7-10 cells. Each sequence reads from left to right (G, A, T, and C, respectively). (C) 39-end sequence of the large RNA II species of TCS. (D) 39-end sequences of the large RNA II species of B2 and219/15, respectively.
on November 9, 2019 by guest
http://jvi.asm.org/
TCS-21 at either 30°C (in duplicate) or 40°C. Duplicate cell
cultures which were infected at 30°C were shifted to 40°C at 4
hpi. At 8 hpi, total RNA was isolated from each sample. As shown
in Fig. 5C, the TCS-21-infected samples maintained at 30°C or
shifted to 40°C were noticeably defective in subgenomic mRNA
synthesis compared to those of TCS. This corresponded to a
substantial decrease in the abundance of RNA II for TCS-21,
relative to that of TCS. The TCS-21 sample infected and
main-tained at 40°C exhibited defective RNA synthesis for all viral
RNAs. These results demonstrate that an alteration in the coding
region of nsP2 adversely affects subgenomic mRNA transcription,
and this correlates to a reduction in the abundance of RNA II.
These results are also consistent with those in Fig. 5B and further
support the hypothesis that genomic RNA is not cleaved at the
position of the promoter to generate RNA II during the isolation
and analysis of viral RNA.
DISCUSSION
The results presented here demonstrate that RNA II is of
plus-sense polarity and show that its 3
9
end maps to the
2
4
position of the subgenomic promoter. We do not know how the
promoter acts to give rise to RNA II. It is possible that RNA
secondary structure in the promoter causes the generation of
RNA II. However, the 3
9
end of RNA II is the same, whether
it terminates at the TCS, B2, or
2
19/
1
5 promoter. Thus, any
secondary structure which generates RNA II must be present
in the minimal promoter itself and be unaffected by mutations
in the B2 promoter. Computer analyses failed to detect any
secondary structure in the minimal promoter.
Alternatively, the promoter may act indirectly to facilitate
the binding of specific proteins which cause the generation of
RNA II. The observation that both cycloheximide treatment
early in infection and the mutation of TCS-21 reduce the
amount of subgenomic RNA synthesized relative to genomic
RNA, with a corresponding decrease in the abundance of
RNA II, implies that proteins are more likely to be involved in
the generation of RNA II than is secondary structure inherent
to the promoter.
There are several mechanisms by which proteins bound at
the subgenomic promoter might cause the generation of RNA
II. One class of models invokes RNA cleavage as a possible
mechanism. Proteins bound at the promoter might stimulate
the cleavage of any genomic RNA (at the
2
4 position of the
promoter) that becomes at least locally hybridized to the minus
strand. Another possibility is that proteins may recognize and
cleave the subgenomic promoter at position
2
4 or close to it
on the minus strand. Thus, the replication of genomic RNA on
cleaved minus-strand templates would then terminate at
posi-tion
2
4. Yet another mechanism is that proteins bound to the
promoter cleave nascent genomic RNA once a replication
complex reaches the promoter. All of the cleavage mechanisms
must explain the specificity of cleavage to leave a free 3
9
-OH at
position
2
4 of the promoter.
Although the generation of RNA II via a cleavage
mecha-nism cannot be ruled out, we favor a model in which the
generation of RNA II is a consequence of competition
be-tween the replication of genomic RNA and the initiation of
subgenomic mRNA synthesis. In this model, it is assumed that
replication and transcription occur simultaneously on the same
minus-strand template and that subgenomic transcriptional
initiation is slow compared to genomic RNA elongation. Three
outcomes can be envisioned. First, replication complexes may
physically displace the proteins bound to the promoter that
were engaged in transcriptional initiation. The net effect may
be a reduction in the levels of transcribed subgenomic RNA,
and RNA II would not be generated. Second, replication
com-plexes may pause at the promoter because initiation comcom-plexes
at the promoter would physically block continued genomic
RNA elongation. Once transcription had initiated, replication
complexes could then resume elongation. The net effect may
be a reduction in the levels of replicated genomic RNA. When
cells are lysed for RNA isolation, the partially completed
genomic RNAs in the stalled replication complexes are
re-leased as RNA II molecules. Finally, replication complexes
may pause on the promoter but then dissociate from the
mi-nus-strand template. Once dissociated, the replication
com-plexes may fall apart and release their nascent genomic RNA
as RNA II. RNA II molecules may therefore be dead-end
products. It is interesting that if the pausing or stalling model
is correct, then the 3
9
end of RNA II is essentially a “toe print”
[image:8.612.55.280.69.391.2]of whatever protein was bound to the promoter. Given the
abundance of RNA II relative to the genomic RNA (one to
FIG. 5. Possible origins of RNA II. (A) Nonradioactively labeled TCS and mock-infected BHK-21 cells were solubilized with Trizol at 5 hpi. Full length in vitro transcripts of TCS (radiolabeled with [a-32P]GTP) were immediately added
to each sample, and RNA was analyzed as described in Materials and Methods). The TCS RNA sample (labeled in vivo with [32P]orthophosphate) was used as a
standard to determine the positions of the Lg and Sm RNA II species. (B) BHK-21 cells were infected with TCS and labeled as described in the legend to Fig. 1. At the times listed, cycloheximide was added to samples marked with a plus sign (final concentration, 10mg/ml). Total RNA was isolated at 5 hpi and analyzed as described in the legend to Fig. 1A. (C) TCS and TCS-21 were used to infect BHK-21 cells at the temperatures shown. At 4 hpi, duplicate cell cultures grown at 30°C were shifted to 40°C (labeled 30-40). All cell cultures were treated with dactinomycin 1 h before labeling with [32P]orthophosphate. Cell labeling was
terminated 2 h later, at 8 hpi, and total RNA was isolated and analyzed as described before. For definitions of abbreviations, see the legend to Fig. 1.
on November 9, 2019 by guest
http://jvi.asm.org/
every seven; Table 1), both pausing scenarios predict that the
promoter poses a significant impediment to genomic RNA
synthesis, and this may be a novel mechanism to coordinate
replication and transcription. Alternatively, the dissociated
replication complex may bind to another minus-strand
tem-plate to resume and complete the synthesis of the nascent
genomic RNA. In this case, RNA II may be a precursor to a
recombinant genome that is generated during plus-strand
syn-thesis.
Regardless of the mechanism of RNA II generation, RNA II
may have an effect on the SIN infection cycle. For example,
RNA II may or may not be capped or polyadenylated in vivo,
but there are examples in the literature in which RNA species
devoid of a 5
9
cap, poly(A) tail, or both are translation
com-petent (10, 15, 16, 21, 72). If RNA II were translated, nsP4
would be deficient in at least two amino acids at its carboxy
terminus. Modified nsP4 could function differently from
full-length nsP4 with respect to viral RNA synthesis. Some of these
differences may include altered cis-acting sequence specificity
or processivity. Another effect RNA II may have on the SIN
infection cycle is decreasing the number of virion particles with
full-length genomic RNA. The 3
9
end of RNA II extends well
beyond the putative encapsidation signal (70), so it is not
unreasonable to suggest that it can be packaged. Indeed, an
RNA species similar in size to that expected for RNA II has
been observed in virion particles (14). If RNA II is packaged
and is present in a molar ratio of 1 to 10 compared to genomic
RNA (Table 1), a 10% decrease in the number of virion
par-ticles that contain full-length genomic RNA could lower the
efficiency with which a virus population initiates infection.
Fi-nally, as mentioned before, RNA II may be a precursor to a
recombinant genome. Recombination is one of several
mech-anisms that a virus population can employ to increase its
di-versity. If template switching for a replication complex
oc-curred (due to a block imposed by initiation complexes on the
subgenomic promoter), one might expect a recombinant
ge-nome containing the nsP coding region from one virus gege-nome
and an STR coding region from another.
ACKNOWLEDGMENTS
This work was supported by Public Health Service grant AI26763.
We thank C. M. Rice for Toto:ts 21 A2 and the SIN virologists at
Washington University for helpful discussions.
REFERENCES
1. Ahola, T., and L. Ka¨a¨ria¨inen. 1995. Reaction in alphavirus mRNA capping: formation of a covalent complex of nonstructural protein nsP1 with 7-meth-yl-GMP. Proc. Natl. Acad. Sci. USA 92:507–511.
2. Alton, N. K., and D. Vapnek. 1979. Nucleotide sequence analysis of the chloramphenicol resistance transposon Tn9. Nature 282:864–869. 3. Barton, D. J., S. G. Sawicki, and D. L. Sawicki. 1988. Demonstration in vitro
of temperature-sensitive elongation of RNA in Sindbis virus mutant ts6. J. Virol. 62:3597–3602.
4. Bredenbeek, P. J., I. Frolov, C. M. Rice, and S. Schlesinger. 1993. Sindbis virus expression vectors: packaging of RNA replicons by using defective helper RNAs. J. Virol. 67:6439–6446.
5. Bruton, C. J., and S. I. Kennedy. 1975. Semliki Forest virus intracellular RNA: properties of the multi-stranded RNA species and kinetics of positive and negative strand synthesis. J. Gen. Virol. 28:111–127.
6. Carlson, J., K. Olson, S. Higgs, and B. Beaty. 1995. Molecular genetic manipulation of mosquito vectors. Annu. Rev. Entomol. 40:359–388. 7. Carmichael, G. G., and G. K. McMaster. 1980. The analysis of nucleic acids
in gels using glyoxal and acridine orange. Methods Enzymol. 65:380–391. 8. Clegg, J. C., and S. I. Kennedy. 1974. Polyadenylic acid sequences in the virus
RNA species of cells infected with Semliki Forest virus. J. Gen. Virol.
22:331–345.
9. Czarniecki, W. C., and T. Sreevalsan. 1979. Sindbis virus RNA replication. I. Properties of the 38S RNA species. J. Gen. Virol. 44:759–771. 10. Danthinne, X., J. Seurinck, F. Meulewaeter, M. M. Van Montagu, and M.
Cornelissen.1993. The 39untranslated region of satellite tobacco necrosis virus RNA stimulates translation in vitro. Mol. Cell. Biol. 13:3340–3349.
11. De´, I., S. G. Sawicki, and D. L. Sawicki. 1996. Sindbis virus RNA-negative mutants that fail to convert from minus-strand to plus-strand synthesis: role of the nsP2 protein. J. Virol. 70:2706–2719.
12. de Groot, R. J., W. R. Hardy, Y. Shirako, and J. H. Strauss. 1990. Cleavage-site preferences of Sindbis virus polyproteins containing the non-structural proteinase. Evidence for temporal regulation of polyprotein processing in vivo. EMBO J. 9:2631–2638.
13. Friedman, R. M., H. B. Levy, and W. B. Carter. 1966. Replication of Semliki Forest virus: three forms of viral RNA produced during infection. Proc. Natl. Acad. Sci. USA 56:440–446.
14. Frolova, E., I. Frolov, and S. Schlesinger. 1997. Packaging signals in alpha-viruses. J. Virol. 71:248–258.
15. Gallie, D. R., and M. Kobayashi. 1994. The role of the 39-untranslated region of non-polyadenylated plant viral mRNAs in regulating translational effi-ciency. Gene 142:159–165.
16. Gallie, D. R., R. L. Tanguay, and V. Leathers. 1995. The tobacco etch viral 59leader and poly(A) tail are functionally synergistic regulators of transla-tion. Gene 165:233–238.
17. Gorbalenya, A. E., E. V. Koonin, A. P. Donchenko, and V. M. Blinov. 1988. A conserved NTP-motif in putative helicases. Nature 333:22.
18. Gorbalenya, A. E., E. V. Koonin, A. P. Donchenko, and V. M. Blinov. 1989. Two related superfamilies of putative helicases involved in replication, re-combination, repair and expression of DNA and RNA genomes. Nucleic Acids Res. 17:4713–4730.
19. Gorbalenya, A. E., E. V. Koonin, and Y. I. Wolf. 1990. A new superfamily of putative NTP-binding domains encoded by genomes of small DNA and RNA viruses. FEBS Lett. 262:145–148.
20. Griffin, D. E. 1986. The Togaviridae and Flaviviridae. Plenum Publishing Corp., New York, N.Y.
21. Gunnery, S., and M. B. Mathews. 1995. Functional mRNA can be generated by RNA polymerase III. Mol. Cell. Biol. 15:3597–3607.
22. Hahn, C. S., C. M. Rice, E. G. Strauss, E. M. Lenches, and J. H. Strauss. 1989. Sindbis virus ts103 has a mutation in glycoprotein E2 that leads to defective assembly of virions. J. Virol. 63:3459–3465.
23. Hahn, Y. S., A. Grakoui, C. M. Rice, E. G. Strauss, and J. H. Strauss. 1989. Mapping of RNA2temperature-sensitive mutants of Sindbis virus: comple-mentation group F mutants have lesions in nsP4. J. Virol. 63:1194–1202. 24. Hahn, Y. S., E. G. Strauss, and J. H. Strauss. 1989. Mapping of RNA2
temperature-sensitive mutants of Sindbis virus: assignment of complemen-tation groups A, B, and G to nonstructural proteins. J. Virol. 63:3142–3150. 25. Hertz, J. M., and H. V. Huang. 1995. Evolution of the Sindbis virus
sub-genomic mRNA promoter in cultured cells. J. Virol. 69:7768–7774. 26. Hertz, J. M., and H. V. Huang. 1995. Host-dependent evolution of the
Sindbis virus promoter for subgenomic mRNA synthesis. J. Virol. 69:7775– 7781.
27. Hodgman, T. C. 1988. A new superfamily of replicative proteins. Nature
333:22–23. (Erratum, 333:578, 1988.)
28. Kamer, G., and P. Argos. 1984. Primary structural comparison of RNA-dependent polymerases from plant, animal and bacterial viruses. Nucleic Acids Res. 12:7269–7282.
29. Kennedy, S. I. 1976. Sequence relationships between the genome and the intracellular RNA species of standard and defective-interfering Semliki For-est virus. J. Mol. Biol. 108:491–511.
30. Kera¨nen, S., and L. Ka¨a¨ria¨inen. 1979. Functional defects of RNA-negative temperature-sensitive mutants of Sindbis and Semliki Forest viruses. J. Virol.
32:19–29.
31. Kuhn, R. J., Z. Hong, and J. H. Strauss. 1990. Mutagenesis of the 39
nontranslated region of Sindbis virus RNA. J. Virol. 64:1465–1476. 32. Laskey, R. A., and A. D. Mills. 1975. Quantitative film detection of3H and
14C in polyacrylamide gels by fluorography. Eur. J. Biochem. 56:335–341.
33. LaStarza, M. W., J. A. Lemm, and C. M. Rice. 1994. Genetic analysis of the nsP3 region of Sindbis virus: evidence for roles in minus-strand and sub-genomic RNA synthesis. J. Virol. 68:5781–5791.
34. Lemm, J. A., and C. M. Rice. 1993. Assembly of functional Sindbis virus RNA replication complexes: requirement for coexpression of P123 and P34. J. Virol. 67:1905–1915.
35. Lemm, J. A., and C. M. Rice. 1993. Roles of nonstructural polyproteins and cleavage products in regulating Sindbis virus RNA replication and transcrip-tion. J. Virol. 67:1916–1926.
36. Lemm, J. A., T. Rumenapf, E. G. Strauss, J. H. Strauss, and C. M. Rice. 1994. Polypeptide requirements for assembly of functional Sindbis virus replication complexes: a model for the temporal regulation of minus- and plus-strand RNA synthesis. EMBO J. 13:2925–2934.
37. Levin, J. G., and R. M. Friedman. 1971. Analysis of arbovirus ribonucleic acid forms by polyacrylamide gel electrophoresis. J. Virol. 7:504–514. 38. Levis, R., H. Huang, and S. Schlesinger. 1987. Engineered defective
inter-fering RNAs of Sindbis virus express bacterial chloramphenical acetyltrans-ferase in avian cells. Proc. Natl. Acad. Sci. USA 84:4811–4815.
39. Levis, R., S. Schlesinger, and H. V. Huang. 1990. Promoter for Sindbis virus RNA-dependent subgenomic RNA transcription. J. Virol. 64:1726–1733. 40. Levis, R., B. G. Weiss, M. Tsiang, H. Huang, and S. Schlesinger. 1986.
Deletion mapping of Sindbis virus DI RNAs derived from cDNAs defines