• No results found

Transcriptional analysis of the eight-kilobase mRNA encoding the major capsid protein of human cytomegalovirus.

N/A
N/A
Protected

Academic year: 2019

Share "Transcriptional analysis of the eight-kilobase mRNA encoding the major capsid protein of human cytomegalovirus."

Copied!
6
0
0

Loading.... (view fulltext now)

Full text

(1)

Vol. 64, No. 10 JOURNALOF VIROLOGY, Oct. 1990, p.5167-5172

0022-538X/90/105167-06$02.00/0

CopyrightC 1990, American Society forMicrobiology

Transcriptional Analysis

of the

Eight-Kilobase

mRNA

Encoding the

Major Capsid Protein of

Human

Cytomegalovirus

STEFANIE-ANJA

RUDOLPH, THOMAS STAMMINGER, ANDGERHARD JAHN*

Institut

fur Klinische und Molekulare

Virologie der UniversitatErlangen-Nurnberg,

Loschgestrasse

7, 8520

Erlangen,

Federal Republic ofGermany Received16April1990/Accepted21 June 1990

The

8-kilobase

mRNA codingfor the major capsid protein (MCP)of human cytomegaloviruswasprecisely mapped. Two

5'

ends of the transcript were located within HindIll fragment a, 29 and 34 base pairs, respectively, downstream of thesequenceTATTAGA. The3' endwaslocalized within

HindIlI

fragment b of

the

viral

genome.The MCP transcriptwassynthesizedatlate timesafter infection andwasnotdetectedbefore

viral

DNA

replication.

In addition, the MCPpromoterregion could be identified, which stronglyrespondedto

viral

trans

activation

atearly and latetimes after infection inatransient expression assay.

Human

cytomegalovirus (HCMV) genes are divided into

three groups on the basis of their time of expression in

permissively

infected cells. Immediate-early gene products

are

required for the regulation of early genes. At late times

after infection,

viral RNA originates from all regions of

the

genome,

and the

majority codes for structural proteins

(9, 10, 15, 18, 19). The main structural component of

the virus capsid is the major capsid protein (MCP). The

DNA sequence

of the MCP gene of HCMV was published

recently (3). The MCP gene has been located in the junction

region of

HindlIl

fragments a and U on the genome of

HCMV AD169. The open reading frame (ORF) consists of

4,110

base pairs (bp) and codes for a translation product of

154

kilodaltons.

Northern

(RNA)

blot analyses with

sub-clones

from

the

coding

region detected

a

large

transcript of

about 8

kilobases

(kb)

at

late

times

after

infection

(3). The

study presented here

was

carried out to

precisely

map

the 5'

and 3' ends

of

this mRNA and

to

analyze

transcription

at

various times after viral infection. In addition, a promoter

region

strongly

responding

to

HCMV trans activation has

been identified

and

was

investigated

in

a

transient

expression

assay.

The

approximate size of

the

MCP

mRNA has

been

deter-mined

in

previous studies by Northern

blot

analyses

(3).

By

this

approach,

an

8-kb

transcript

was

detected in

hybridiza-tions with HindIII

fragments

a

and

U,

containing

the

ORF

of

the

MCP

gene.

For

an

approximate localization of

the 5' and

3' termini

of

this

transcript,

Northern blot

analyses

were

performed

with

HindIII

fragments P, b,

and c, which

are

located

adjacent

to

HindlIl

fragments

a

and U

(Fig. 1).

The

8-kb RNA

hybridized

with

HindIII

fragment

b. No

hybrid-ization

was

observed

with

HindIII

fragment

c or

P

(data

not

shown).

For

precise

mapping

of

the 5'

and 3' termination

sites,

RNase

protection analyses

were

carried

out

with

subclones

of

HindIlI

fragments

a

and b. To

determine the initiation site

of

the

MCP

RNA,

plasmid pHS

(Fig.

1),

harboring

a

327-bp

HpaI-StuI

subfragment

of

HindIII

fragment

a,

was

con-structed. The

pHS

insert

corresponds

to a

genomic

region

containing

sequences

97

bp

3' and 227

bp

5'

to

the

first ATG

of the ORF and

was

cloned

into the Bluescribe

vector

*

Corresponding

author.

(Vector

Cloning Systems, San Diego, Calif.) downstream

of

the T7 promoter. Total cellular RNA was

isolated at late

times

after HCMV

infection

as

described by

Chirgwin et al.

(4). RNase

protection

analyses were

performed as

described

previously

(17). In all

experiments, RNA from

mock-in-fected cells

was

used as

a

negative control. To

determine

the

size

of

the

protected

fragments, a DNA sequencing reaction

was run

in

parallel. Full-length

RNA

products were

detected

at

their

expected

sizes.

By

this approach,

we

obtained three

protected

fragments

with the

antisense

transcript from

plas-mid

pHS.

Two

of these RNA fragments

were

175

and 170

bases in size

(Fig.

2A, lane 1). Thus, the

initiation sites of

the

RNA

were

placed 808 and 803

bp downstream

of

the

junction

region

between

HindIII

fragments

P

and a. These sites

are

located 29 and 34

bp downstream

of

the sequence TATTA

GA, which

may represent

a

TATA

motif

(Fig.

2B). Both

nucleotide

positions

were

assumed to represent

initiation

sites of the 8-kb RNA. The third

protected

RNA

fragment

corresponded

to

the

full-length product of

the

pHS

insert

(Fig.

2A, lane 1),

indicating

a

further

transcript

in this

HCMV

region. This

fragment

may

correspond

to

an

RNA

of

about

11

kb that

was

observed in

Northern blot

experiments

with

plasmid

pHX

as a

probe

(Fig.

3A, lane 1). To

test

for

additional

transcriptional

start

sites,

the

HCMV sequence

upstream

of the

pHS

fragment

was

subcloned in small

portions

into the Bluescribe

vector. RNase

protection

anal-yses

with

a

total

of

3

kb

of HCMV

sequence upstream

of

pHS did

not

reveal any

additional

transcription

start

sites

(data

not

shown).

To

localize the 3' terminus

of

the

8-kb

RNA,

a

similar

approach

was

used. Since Northern blot

analyses

had

dem-onstrated

the

termination site of

the

8-kb RNA

to

be

located

within

HindIlI

fragment

b, portions of

this 1.5-kb DNA

fragment

were

subcloned into

the

Bluescribe

vector.

These

subclones

were

used in

Northern

blot

hybridizations

to

detect the

8-kb

transcript.

Subclone

pHX

(Fig. 1),

which

corresponds

to

the

288-bp

HindIII-XmaIII

fragment

adjacent

to

HindIII

fragment U,

hybridized

with the

MCP RNA

(Fig.

3A, lane

1). In

addition,

two

RNAs

of about 3.3 and 2.2 kb

were

observed

(Fig. 3A,

lane

1).

Both

transcripts

had been

described in

previous

Northern blot

analysis

with

HindlIl

fragment

U

as a

probe (3).

They

were

considered

to

corre-spond

to two

ORFs

located

in

HindlIl

fragment

U

down-stream

of the MCP ORF. When

plasmid pPX

(Fig.

1),

which

5167

on November 10, 2019 by guest

http://jvi.asm.org/

(2)

3'

F

pPX

0

pHX

U

b

ORF MCP pBC

5'

pBXCAT

L1

pHS

U

a

1,1T I

a - -.L3

z XX: ~X

-I

I

1

Nl

J

M|(

F

D

|L

|P

E |K

XF14yl

H

HindHI

101

G K

* M

E

_M

I

I

A

I

D

M

*

C

_N

EcoRZ

,

g

deL

h.

0

is

as

Q

4 as as &IF as as

ao0

_W

_

[image:2.612.144.479.65.386.2]

O

a t jig up

FIG. 1. Prototype arrangement of the HCMV AD169genome and positions of plasmid clones used in this study. Restriction sitesfor

cloning and plasmid clones of the 5'- and 3'-terminal regions of the 8-kb RNAareindicated. The4,110-bp ORF of the MCPgeneisshown

atthetop.

contains the

176-bp

HCMV sequence downstream of

plas-mid

pHX,

was

used,

no

hybridization signals with the 8-,

3.3-,

or2.2-kb

RNAs

were

obtained

in

Northern blots

(Fig.

3A, lane 3). Plasmid pPX exclusively revealed

a

4-kb

tran-script which has been shown

to

encode the

tegument

protein

pp65

of HCMV

(11, 16) (Fig. 3A,

lane

3).

The

precise 3'

terminus of the

8-kb RNA

was

determined in RNase

protec-tion

experiments

withan

antisense transcript derived from

plasmid pHX. Two protected fragments representing 3'

termini of

the

RNA were

detected

at

215 and 135 bp

downstream of the

junction region of HindlIl fragments U

and b

(Fig. 3B, lane 2). The 3.3- and 2.2-kb RNAs appeared

toterminateatthesame

location

asthe 8-kb RNA.

Possible

polyadenylation signals

were found to be located 9 and 15

bp, respectively,

upstream

of the mapped termini (Fig.

3C). Since the

antisense transcript used for the hybridization

reaction contained

two

prominent incompletely

synthesized

fragments, probably due

to

radiolysis

of the probeatpoly(U) stretches

(Fig. 3C),

two

additional signals

were observed

after

RNase

digestion (Fig.

3B,

lane

3). These

signals

didnot

indicate

termination sites of

the transcript.

To

study expression of

the 8-kb RNA throughout the HCMV

replicative cycle, human foreskin fibroblast

(HFF) cells were

infected with HCMV, and

RNA was

isolated

as

described

by Chomczynski and Sacchi

(5) at various times after

infection. Whole-cell RNA

was analyzed for

MCP-specific transcripts by RNase protection with

an

antisense

probe specific for the 5' initiation site derived from plasmid

pHS (Fig. 1).

In

repeated experiments,

itwasnot

possible

to detect the 8-kb RNA earlier than 48 h after infection

(Fig. 4).

Maximum

expression

levels were

observed

at72h

(Fig.

4).

When we

analyzed

RNA that had been isolated 48 h after

infection in the

presence

of

a

200-,ug concentration of

phosphonoformic

acid

(PFA),

an

inhibitor of

viral DNA

replication,

no

signals specific

for the 8-kb RNA were

observed

(Fig. 4,

lane

7). Therefore, by using

the

highly

sensitive RNase

protection technique,

we

could

confirm earlier Northern blot results

indicating

that the 8-kb

RNA

was

exclusively detectable

at

late times after infection.

Totestwhetherafunctionalpromoteris located upstream of the

mapped

5' endof the 8-kb

transcript,

a

480-bp

BamHI-XhoI

fragment comprising

aDNAsequence

of 390 bp

upstream of the

major

capsitewascloned into

plasmid pBLCAT3 (14)

in

front of

the

chloramphenicol acetyltransferase (CAT)

gene as

reporter.

Promoter activation

was

studied by transfecting 20 ,g

of the

resulting

CAT fusiongene,

designated pBXCAT,

into

permissive

HFFcellsasdescribed

previously (17).

Cellswere

superinfected

with HCMV 18 h after transfection and were harvested at

indicated times after

infection (Fig. 5). CAT

assayswere

performed

asdescribed

previously (12). No

pro-moter

activation

was

detectable after

mock infection of

trans-fected cells

(Fig. 5,

lanes

5

to

8). By

24 h

after infection

with

HCMV,

low activation levels

could be

observed, which

in-creased at48 h and reached maximum levelsat72 h

(Fig. 5,

lanes 1 to

4).

When PFA was

used

to

block viral DNA

replication,

CAT

acetylation

valueswere

equivalent

to

values

I ..

9 i

= = =

U

on November 10, 2019 by guest

http://jvi.asm.org/

(3)

NOTES 5169

A

328

--

175-

170-12 A C G T

00

Ils,

_.

- 54

3-4

we

I

w

4. 0

4.03.

*O

p.

B

AGCCGCCAACGACTATTAGA

GCGTCACAGCCGAGGCGGCG

CGGCGCAGGCGCCGGCCATTC

TCCGGGTCGCGCTGCTTTCC 80

CCGAGCTCCGACGCCTCGCG 100

[image:3.612.169.443.64.426.2]

CTCACGCCGCCGCCGCGATG 120

FIG. 2. Localization of the 5' end of the 8-kb RNA. (A) RNase protection analysis withplasmid pHS, using total late RNA. RNAwas isolated96 hpostinfection fromHCMV-infected ormock-infected fibroblasts. After RNase digestion, fragments werefractionatedon6% polyacrylamide-8 Mureasequencing gels along withaDNAsequenceladder. Lanes: 1, analysis with RNA from HCMV-infected HFF; 2, analysiswithmock-infected RNA.Numbersontheleft indicate thesizes (innucleotides) of the protected fragments. (B) Nucleotidesequence

5'tothe firstATG of the MCP ORF. The initiation sites of the mRNA determined by RNase protection analysisareindicatedbyarrows.The

TATAsequenceand the firstATG of theORFareunderlined. The DNAsequence wasderivedfrom the data of Cheeetal. (3)(nucleotides

7to 127).

obtainedat

48

hwithout PFA

(Fig.

5,

lanes

3 and 9). This

result indicatesthat the

observed

promoter

activation

didnot

depend

on

prior

viral DNA

replication.

This time course

analysis

of

MCPpromoteractivationwas

performed

in

triplicate, resulting

in a

reproducible activation

pattern. In

addition, MCP

pro-moter

activation

was

compared

with

activation of the

promoter of the

pp65

gene.The latter has been showntobeactivatedto

significant

levelsat

early

times, reaching

maximal

expression

at latetimes

(11). When

both promoterswere

analyzed

in

parallel,

an identical time courseof activation wasobserved

(data

not

shown).

Insummary,we wereableto

identify

thepromoter

region

ofthe MCPgene which

strongly responds

toHCMV infec-tion. Time course

analysis

of MCP promoteractivation ina transient

expression

systemrevealed

significant

activationat

early

times

postinfection,

with a further increase at late times after infection. This result is in contrast to data for

expression

of the MCP

RNA,

which could be detected

exclusively

at late times.

Possibly,

additional

cis-acting

signals

that are not included in

plasmid pBXCAT

are

re-quired

to determine

the

kinetic class of this promoter.

Otherwise,

as has been shown for the gene

coding

for the MCP

(VP5)

of

herpes simplex

virustype

1, regulatory

events

occurring

in the context of the viral genome may confer

more

stringent

control ofpromoter activation than are ex-erted inatransient assay system

(8).

The 5' termination site of the 8-kb RNAwaslocalized 27 and 34

bp,

respectively,

downstream of the

possible

TATA motif TATTAGA

by

RNase

protection

analyses.

Besides the

protected

fragments corresponding

to the initiation site of the 8-kb

transcript,

a third

signal

was observed which

corresponded

to the

entirely protected

antisense

probe.

It has been

reported

for the VP5geneof

herpes simplex

virus type 1 that two minor initiation sites of the 6-kb mRNA occurwithin 30 and90

bp

upstreamof the main initiationsite

(6. 7).

For the MCPgene of

HCMV,

this seems not to be

very

likely

since no further

transcriptional

initiation sites could be localized within 3 kb of HCMVsequenceupstream of the determined 5' ends of the 8-kb RNA.

The 3' termination sites of the 8-kbRNA werelocated at

positions

+9 and

+15, respectively,

downstream of the

putative polyadenylation signals

ATTAAA and AATAAA. 20

40

60 VOL. 64,1990

on November 10, 2019 by guest

http://jvi.asm.org/

(4)

5170 NOTES

A C G T

a..

as. :w

..m

.j4

1 2 3 M

Owl

_-_a

[image:4.612.133.493.90.602.2]

135-00

...

*:.::...;

?

.t..:

...:;.

-: ... ... : :.

..:: ::::

*.

*.:.::X.X

.: .;

.

...:: ::.::..:... .:

S.S

..:.:S#

c

HindIII

AAGCTTACGGAAAATACGACAGAGAAGACGAGTCCTGTCACTTTAGCCATGGTCTGCGGC 60

GATCTCTAAACAGAGGACCCTGATAATGGGAAACGGACACTAGGCGTCCGCGCCATACGG 120

GATTAAAACAAAAAAAAATCGGTGGTGGTGTGTGATGGGGTGTGGTGACGGTGGGGCTTC 180

GCCTCTTTTTTTTGTAATAAAAAAAGACACTGAATAATCCGCGGTTGTCTCTGTGTAGAA 240

XmaIII

CGTTTTTATTTCGGGTTCCGCGTTTGGTCGCCTGCCTATGTAAGGCGGCGGCCGCAGAGG 300

FIG. 3. Localization of the 3' end of the 8-kbRNA within HindIII fragmentb.(A)Northernblotanalysis,using plasmids pHX(lanes 1

and2)andpPX (lanes3 and4)forhybridizationwith RNAfromHCMV-infected(lanes1and3)and mock-infected(lanes2and4)fibroblasts

purified 96hpostinfection. Hybridizationwithplasmid pHXdetected the 8-kb RNA and two additionaltranscriptsof about 3.3and 2.2 kb (lane1).PlasmidpPXcontainingtheadjacentDNAregiondownstreamofplasmid pHX hybridizedwithanRNA of about 4 kb(lane3). (13)

RNase protection analysis, using plasmid pHX and late RNA isolated 96 h after infection with HCMV. Lanes: 1, mock-infected RNA hybridized withariboprobederived fromplasmidpHX;2, late RNAhybridizedwithariboprobederived fromplasmidpHX; 3, RNA from theriboprobeused forhybridization; M,marker lane(pBR322, MspI digested). Numbers in themarginsindicatethe sizes of theprotected fragmentsascomparedwithasequencingreactionruninparallel. (C)HCMV nucleotide sequence ofplasmid pHXincludingthe termination sites of the 8-kb RNA. The 3' ends determined byRNase protection analysis are indicated by arrows. Polyadenylation sequences are

underlined. The DNAsequencewasderived from the data ofRugeretal.(16) (nucleotides 1 to300).

ApHX

1 2

ppX

B

3 4

4kb--3.3kb

-2.2 kb

J. VIROL.

on November 10, 2019 by guest

http://jvi.asm.org/

(5)

NOTES 5171

1

2 3 4

5 6 7

6h 24t48h 72h M 48hPFA

A0169 MOCK AD169

6 24 48 72 6 24 48 72 48pFA

s

t

0

_ _

-1 2 3 4 5 6 7 8 9

[image:5.612.335.544.72.235.2]

FIG. 5. CATassayof plasmid pBXCATinHCMV-infected and mock-infectedcells.Plasmid pBXCATwastransiently expressedin HFF cells, followedby superinfection with HCMV. Cell extracts were prepared at various times after infection as indicated and assayed for CATactivity.Lanes: 1 to4,cell lysatesprepared6,24, 48,and 72 hafter infectionwithHCMV;5 to8,celllysates prepared 6,24, 48,and 72 hafter mockinfection;9,cell lysateprepared48 h afterinfectionwithHCMVin the presence of PFA.

FIG. 4. RNase protection analysis, using plasmid pHS and total cellular RNA purified at different times postinfection. Lane 1,

Molecularweight standard(pBR322, MspI digested). In lanes 2to5, the riboprobe derived from plasmid pHSwashybridized with RNA purified 6, 24, 48, and 72 h after infection with HCMV; in lane 6, the riboprobewashybridized with mock RNA; in lane 7, theriboprobe washybridized with RNA purified 48 h after infection with HCMV

inthepresence of PFA. Theupper signal in lanes 4 and 5

corre-spondstoasize of328 nucleotides. The lower signals in lanes 4 and 5correspondtosizes of 175and 170nucleotides andrepresentthe initiation sitesof the 8-kbRNAasshown inFig. 2.

The

signal AATAAA

represents

the

predominant

sequence of 3'-end

processing,

whereas

the

sequence ATTAAA

oc-curs in

only

12% of RNA

polymerase

II genes

(2). Both

polyadenylation signals

have also been localized down-streamofthegene coding for theppl5Oof HCMV

(13)

and downstream ofan

Epstein-Barr

Virus gene

(1).

Northern blot

hybridizations

had

placed

the termination sites of the 8-kb MCPRNA and oftwoadditional RNAs of 3.3 and 2.2 kb tothe

HCMV

insert of

plasmid pHX.

RNase

protection

analysis

indicated that the located termination sites

repre-sentthe 3' termini of these three

transcripts.

The

observa-tion

that two

transcripts

terminate

colinearly

had been

reported

for the 6-kb mRNA

coding

for the VP5 of

herpes

simplex

virus type 1

(6, 7). Thus, mapping

data of the5' and 3' terminiindicate that theMCP RNA is about 7.2 kb in

size,

without

considering

the

length of

the

poly(A)

tail of viral mRNAs. Further studies to more

precisely

define factors involved intransactivation of the MCPpromoterwill

help

to

clarify

the

regulation

of HCMV lategenes.

We thank Bernhard Fleckenstein for continuous support and

Bodo Plachter for critical readingof themanuscript.The excellent

technical assistance of Heike Mochisgreatly appreciated. Thisworkwassupported byDFG and BMFT.

LITERATURECITED

1. Baer, R.,A. T. Bankier, M. D. Biggin, P. L. Deininger, P. J.

Farrell, T. J. Gibson, G.Hatfull, G. S. Hudson, S. C. Satchwell, C. Seguin, P. S. Tuffnell, and B. G. Barrell. 1984. DNA

sequence and expression of the B95-8 Epstein-Barr virus

ge-nome. Nature(London) 310:207-211.

2. Birnstiel,M. L.,M.Busslinger, and K. Strub. 1985. Transcrip-tion termination and 3' processing: the end is in site. Cell 41:349-359.

3. Chee, M., S.-A. Rudolph,B.Plachter, B.Barrell, and G. Jahn. 1989. Identification of themajor capsid proteingeneof human cytomegalovirus. J. Virol. 63:1345-1353.

4. Chirgwin, J. A.,A. E. Przybyla,R. J. MacDonald, andW. J. Rutter. 1979. Isolation ofbiologically active ribonucleic acid

from sourcesenriched in ribonuclease. Biochemistry

18:5294-5299.

5. Chomczynski, P., and N. Sacchi. 1987. Single-step method of

RNAisolationby acidguanidinium

thiocyanate-phenol-chloro-form extraction. Anal. Biochem. 162:156-159.

6. Costa,R.H., G. Cohen,R.Eisenberg,D.Long, andE.Wagner. 1984. Direct demonstrationthatthe abundant 6-kilobaseherpes simplexvirus type1 mRNAmapping between0.23 and 0.27map units encodes themajor capsid protein VP5. J. Virol.

49:287-292.

7. Costa, R.H., B. G.Devi, K. P.Anderson,B. H. Gaylord,and E. K. Wagner. 1981. Characterization of a majorlate herpes simplex virustype1 mRNA.J. Virol. 38:483-496.

8. Costa, R.H.,K.G.Draper,G. Devi-Rao,R. L.Thompson,and E. K.Wagner.1985. Virus-induced modification of the host cell is required for expression of the bacterial chloramphenicol acetyltransferasegenecontrolledbyalateherpes simplexvirus promoter(VP5). J.Virol. 56:19-30.

9. DeMarchi, J. M. 1981. Humancytomegalovirus DNA:

restric-tion enzyme cleavage maps and map locations for immediate

early, early, andlate RNAs. Virology114:23-38.

10. DeMarchi, J. M., G. A. Schmidt, and A. S. Kaplan. 1980. Patterns oftranscriptionof humancytomegalovirus in permis-sivelyinfectedcells.J. Virol. 35:227-286.

11. Depto,A.S.,and R. M.Stenberg. 1989.Regulated expressionof

thehumancytomegalovirus pp65gene:octamersequencein the

promoteris required for activation by viral gene products. J.

Virol.63:1232-1238.

12. Fickenscher, H.,T.Stamminger,R.Ruger,and B.Fleckenstein.

1989. The role ofarepetitivepalindromic seauenceelementin

a'

VOL.64, 1990

on November 10, 2019 by guest

http://jvi.asm.org/

[image:5.612.115.246.75.343.2]
(6)

the humancytomegalovirus major immediate early enhancer. J. Gen. Virol.70:107-123.

13. Jahn, G., T. Kouzarides,M. Mach,B.-C.Scholl,B.Plachter,B.

Traupe, E. Preddie,S. C. Satchwell, B. Fleckenstein, and B. G. Barrell.1987. Map position andnucleotidesequenceof thegene for the large phosphoprotein of human cytomegalovirus. J. Virol. 61:1358-1367.

14. Luckow,B., and G.Schutz. 1987.CATconstructswith multiple uniquerestriction sites for the functional analysis of eukaryotic

promotors and regulatory elements. Nucleic Acids Res. 15: 5490.

15. McDonough, S. H., and D. H. Spector. 1983. Transcription in human fibroblasts permissivelyinfected by human cytomegalo-virus strain AD169. Virology 125:31-46.

16. Ruger, B., S.Kiages, B. Walla, J. Albrecht,B.Fleckenstein, P.

Tomlinson, and B. G. Barrell. 1987. Primary structure and

transcription of thegenecoding for thetwovirion phosphopro-teins pp65 and pp7l of human cytomegalovirus. J. Virol. 61: 446-453.

17. Stamminger, T., H.Fickenscher, and B. Fleckenstein. 1990. Cell type-specific induction of the major immediate early enhancer of humancytomegalovirus by cyclic AMP. J. Gen. Virol. 71:105-113.

18. Wathen, M. W., and M. F. Stinski. 1982. Temporalpatternsof humancytomegalovirus transcription: mapping the viral RNAs synthesized at immediate early, early, and late times after infection. J. Virol. 41:462-477.

19. Wathen, M. W., D. R. Thomsen, and M. F. Stinski. 1981. Temporal regulation of humancytomegalovirus transcriptionat

immediateearly and early times after infection. J. Virol. 38:446-459.

on November 10, 2019 by guest

http://jvi.asm.org/

Figure

FIG. 1.cloningat the Prototype arrangement of the HCMV AD169 genome and positions of plasmid clones used in this study
FIG. 2.analysisTATA7polyacrylamide-8isolated5' to to Localization of the 5' end of the 8-kb RNA
FIG. 3.andpurified Localization of the 3' end of the 8-kb RNA within HindIII fragment b
FIG. 5.48,6,afterassayedHFFweremock-infected 24, CAT assay of plasmid pBXCAT in HCMV-infected and cells

References

Related documents

The present study is a part from a larger project, A Cross_Cultural and Inter_Cultural Study of Social Disagreement Strategies by Iranian EFL Learners and American, This study

The ethno botanical efficacy of various parts like leaf, fruit, stem, flower and root of ethanol and ethyl acetate extracts against various clinically

Madeleine’s “belief” that she is Carlotta Valdez, her death and rebirth as Judy (and then Madeleine again) and Scottie’s mental rebirth after his breakdown.. All of these

The scattergram represents the distribution with age of 69 determinations of concentration of potassium in serum of 39 premature infants with respiratory distress syndrome (Table

Despite the fact that the rise in net saving rate, capital stock and total consumption are the same in these two economies, the permanent increase in consumption that an

education courses and conclude this instructional alternative is in the best interests of student learning, it is imperative to hire state certified physical education teachers,

Visoke koncentracije ortofosfata, kao što su one izmjerene u rujnu u piezometrima Zelendvor (2,01 mg/L), PDS-5 (2,55 mg/L) i PDS-7 (3,5 mg/L), mogu ukazivati na onečišćenje

For the poorest farmers in eastern India, then, the benefits of groundwater irrigation have come through three routes: in large part, through purchased pump irrigation and, in a