• No results found

The Superimposed Deubiquitination Effect of OTULIN and Porcine Reproductive and Respiratory Syndrome Virus (PRRSV) Nsp11 Promotes Multiplication of PRRSV

N/A
N/A
Protected

Academic year: 2019

Share "The Superimposed Deubiquitination Effect of OTULIN and Porcine Reproductive and Respiratory Syndrome Virus (PRRSV) Nsp11 Promotes Multiplication of PRRSV"

Copied!
17
0
0

Loading.... (view fulltext now)

Full text

(1)

The Superimposed Deubiquitination Effect of OTULIN and

Porcine Reproductive and Respiratory Syndrome Virus (PRRSV)

Nsp11 Promotes Multiplication of PRRSV

Yanxin Su,

a

Peidian Shi,

a

Lilin Zhang,

a

Dong Lu,

a

Chengxue Zhao,

a

Ruiqiao Li,

a

Lei Zhang,

a

Jinhai Huang

a

aSchool of Life Sciences, Tianjin University, Tianjin, China

ABSTRACT

Linear ubiquitination plays an important role in the regulation of the

immune response by regulating nuclear factor

B (NF-

B). The linear

ubiquitination-specific deubiquitinase ovarian tumor domain deubiquitinase with linear linkage

specificity (OTULIN) can control the immune signaling transduction pathway by

re-stricting the Met1-linked ubiquitination process. In our study, the porcine OTLLIN

gene was cloned and deubiquitin functions were detected in a porcine reproductive

and respiratory syndrome virus (PRRSV)-infected-cell model. PRRSV infection

pro-motes the expression of the OTULIN gene; in turn, overexpression of OTULIN

con-tributes to PRRSV proliferation. There is negative regulation of innate immunity with

OTULIN during viral infection. The cooperative effects of swine OTULIN and PRRSV

Nsp11 potentiate the ability to reduce levels of cellular protein ubiquitin associated

with innate immunity. Importantly, PRRSV Nsp11 recruits OTULIN through a

nonen-zymatic combination to enhance its ability to remove linear ubiquitination targeting

NEMO, resulting in a superimposed effect that inhibits the production of type I

in-terferons (IFNs). Our report presents a new model of virus utilization of the

ubiquitin-protease system

in vivo

from the perspective of the viral proteins that

in-teract with cell deubiquitination enzymes, providing new ideas for prevention and

control of PRRSV.

IMPORTANCE

Deubiquitination effects of swine OTULIN were identified. The

interac-tion between porcine OTULIN and PRRSV Nsp11 is dependent on the OTU domain.

PRRSV Nsp11 recruits OTULIN through a nonenzymatic combination to promote

re-moval of linear ubiquitination targeting NEMO, resulting in a superimposed effect

that inhibits the production of type I IFNs.

KEYWORDS

porcine OTULIN, porcine reproductive and respiratory syndrome virus

(PRRSV), Nsp11, superimposed deubiquitination, linear ubiquitination

P

orcine reproductive and respiratory syndrome virus (PRRSV) is a critical pathogen in

pig. It is a variety of capsule single-stranded positive-chain virus of arteritis virus (1).

Infections by PRRSV often result in delayed, low-level induction of antiviral cytokines,

thereby destroying the early endogenous immune response, while PRRSV can also

inhibit the normal function of B cells and T cells (2).

When virus infects the natural host cells, the ubiquitin (Ub)-proteasome system

(UPS) is an important target for the virus to help itself better achieve its life cycle (3–5).

The UPS is involved in the replication of a broad range of viruses (6). Hindering the

activity of the cellular ubiquitin proteasome system, the physiological processes of

many viruses are blocked, including invasion by the virus (7), nucleic acid synthesis

(8–11), and the release of virus particles (12). On the other hand, virus infection also

affects the host’s ubiquitin proteasome system (9).

Among various types of ubiquitination modifications, linear ubiquitinylation is a

Received8 February 2018Accepted12 February 2018

Accepted manuscript posted online14 February 2018

CitationSu Y, Shi P, Zhang L, Lu D, Zhao C, Li R, Zhang L, Huang J. 2018. The superimposed deubiquitination effect of OTULIN and porcine reproductive and respiratory syndrome virus (PRRSV) Nsp11 promotes multiplication of PRRSV. J Virol 92:e00175-18.https://doi.org/10 .1128/JVI.00175-18.

EditorJulie K. Pfeiffer, University of Texas Southwestern Medical Center

Copyright© 2018 American Society for Microbiology.All Rights Reserved. Address correspondence to Lei Zhang, zhanglei@tju.edu.cn, or Jinhai Huang, jinhaih@tju.edu.cn.

Y. Su, P. Shi, and L. Zhang contributed equally to this article.

VIRUS-CELL INTERACTIONS

crossm

May 2018 Volume 92 Issue 9 e00175-18 Journal of Virology jvi.asm.org 1

on November 6, 2019 by guest

http://jvi.asm.org/

(2)

newly identified posttranslational modification (13). Linear ubiquitinylation plays an

important role in the regulation of the immune system (14). The linear ubiquitin chain

assembly complex (LUBAC) is composed of two RING E3 ubiquitin ligases, HOIL-1L and

HOIP (15). The complex displays the activity of ubiquitin ligases, thereby identifying the

substrate for extension of poly-linear ubiquitin chains (16).

Some PRRSV encoding proteins possess ubiquitin- or deubiquitin-related functions,

which enable them to block the production of beta interferon (IFN-

) (17). For example,

Du et al. (18) reported that the highly pathogenic porcine reproductive and respiratory

syndrome virus Nsp1

replicating protein can target swine leukocyte antigen class I

molecules for proteasomal degradation. Jing et al. (19) found that LUBAC-induced

NF-

B and proinflammatory cytokine expression can be inhibited in the early phase of

PRRSV infection. Mechanistically, Nsp1

binds to HOIP and HOIL-1L and impairs the

interaction between HOIP and SHARPIN, thus reducing the LUBAC-dependent linear

ubiquitination of NEMO. Sun et al. (20) showed that PRRSV Nsp2 contained a cysteine

protease domain belonging to the ovarian tumor (OTU) protease family at its N

terminus and demonstrated that the Nsp2 OTU domain antagonizes the induction of

type I interferon by interfering with the NF-

B signaling pathway. Further analysis

showed that the Nsp2 OTU domain had ubiquitin debinding activity. Zhang et al. found

that PRRSV NSP4 cleaved the host protein NEMO and inhibited the production of IFN-

in pulmonary alveolar macrophages (PAMs) (21). PRRSV infection significantly reduced

cellular protein ubiquitination, whereas Nsp11 was previously shown to be a key

nonstructural protein that regulates ubiquitination levels during PRRSV infection (22).

Nsp11 was related to the deubiquitination that regulates host type I IFN signaling.

Ubiquitination and deubiquitination are now considered to be important processes

in the regulation of intracellular signals. Ovarian tumor domain deubiquitinase with

linear linkage specificity (OTULIN) is the only known linear ubiquitination-specific

deubiquitinase. It can restrict Met1-linked ubiquitination to control innate immune

signaling (23). OTULIN depletion leads to enhanced formation of linear Ub chains,

resulting in local recruitment of NEMO and activation of I

B kinase alpha (IKK

) or IKK

and, ultimately, NF-

B (24). Further analysis showed that binding of OTULIN to the PUB

domain of HOIP controls NF-

B signaling (25). The OTULIN PIM domain can be

combined with the HOIP-conserved PUB domain of the LUBAC complex. Interestingly,

unphosphorylated OTULIN is an important component of the LUBAC complex, but

phosphorylated OTULIN cannot interact with LUBAC (26). Additionally, a previous study

showed that OTULIN in the human body and in mice can inhibit tumor necrosis factor

(TNF)-related systemic inflammation, acting as a key molecule in the regulation of

immune homeostasis, inflammation, and autoimmune responses (27).

In this study, the relationship between OTULIN and PRRSV replication was

investi-gated. The cooperative action of swine OTULIN and PRRSV Nsp11 contributed to the

reduction of the level of the cellular protein ubiquitin associated with innate immunity.

Our report presents a new model of virus utilization of a ubiquitin-protease system

in

vivo

from the perspective of the interaction of viral proteins with cell deubiquitination

enzymes, providing new ideas for the prevention and control of PRRSV.

RESULTS

Upregulation of OTULIN accumulation of 3D4/21 by PRRSV.

PRRSV infection can

lead to upregulation or downregulation of many genes in cells (28, 29). A transcriptome

sequencing analysis derived from 3D4/21 cell results was carried out to look for genes

that showed significant changes in transcription after PRRSV infection, and OTULIN was

found to be significantly upregulated after viral infection (Fig. 1a). As it is a novel

deubiquitinating enzyme specifically targeting the linear ubiquitin chain among these

genes and specifically participating in the innate immune signaling pathway of the

linear ubiquitination, analyses of the functions of porcine OTULIN were performed in

this study. To investigate the levels of OTULIN accumulation during PRRSV infection, we

infected 3D4/21 cells with PRRSV at a multiplicity of infection (MOI) of 0.5. Total RNA

was extracted from the cells at different time points postinfection and analyzed for the

on November 6, 2019 by guest

http://jvi.asm.org/

(3)

abundance of OTULIN by quantitative reverse transcription-PCR (qRT-PCR). Compared

to the control group results, PRRSV infection resulted in a significant increase in the

mRNA levels of OTULIN, especially at the late stage of virus infection (Fig. 1b).

Inter-estingly, the trend of expression of OTULIN after Sendai virus (SeV) infection was similar

to that seen after PRRSV infection (Fig. 1c). Furthermore, cell lysates were collected at

24 h postinfection and subjected to Western blot analysis with antibody (Ab) to

OTULIN. There was an increase in cellular levels of OTULIN after PRRSV infection in

comparison to the results seen with mock infection (Fig. 1d). In line with that finding,

the results of flow cytometry analysis further confirmed that the PRRSV infection could

cause upregulation of endogenous OTULIN expression in cells (Fig. 1e). Together, the

results described above showed that PRRSV infection upregulated OTULIN expression

in 3D4/21 cells.

OTULIN contributes to PRRSV proliferation.

Previous research found that the

deubiquitinase OTULIN is an essential negative regulator of inflammation and

autoim-munity (27, 30). To figure out the effect of OTULIN on PRRSV proliferation, Flag-OTULIN

expression plasmids or empty vector was transfected into 3D4/21 cells. 3D4/21 cells

were infected by PRRSV at 12 h posttransfection, and total RNA was extracted from the

cells at 12 h or 24 h postinfection and then analyzed for the mRNA level of the PRRSV

N gene by qRT-PCR. Compared to the control sample, the overexpression of OTULIN

contributed to the mRNA level of the PRRSV N gene, while the result seen at 12 h

postinfection was more remarkable (Fig. 2a). The results of Western blot analysis were

consistent with those obtained using qRT-PCR (Fig. 2b). Meanwhile, the virus titer in

cells after transfection of the OTULIN plasmid was higher than the titer seen with the

FIG 1Porcine OTULIN expression was upregulated during PRRSV infection. (a) Heat map of ubiquitin-related differentially expressed genes made using online websites (https://software.broadinstitute.org/morpheus/). IP, immunoprecipitation. (b and c) 3D4/21 cells were subjected to mock infection or infected with PRRSV (b and c) or SeV (c) at a multiplicity of infection (MOI) of 0.5. Cells were collected at the indicated time points and subjected to real-time RT-PCR to analyze the expression of porcine OTULIN. (d) 3D4/21 cells were subjected to mock infection or infected with PRRSV at a multiplicity of infection (MOI) of 0.5. At 24 h postinfection, cells were collected and subjected to Western blotting (WB) to analyze the expression of porcine OTULIN. (e) 3D4/21 cells were subjected to mock infection or infected with PRRSV at a multiplicity of infection (MOI) of 0.5. Cells were collected at the 24-h time point. Data represent results of flow cytometry analysis of endogenous OTULIN protein expression levels.*,P0.05;**,P0.01;***,P0.001 (two-way ANOVA followed by Bonferroni posttest). Data are representative of results from three independent experiments.

Deubiquitinase OTULIN Promotes PRRSV Multiplication Journal of Virology

May 2018 Volume 92 Issue 9 e00175-18 jvi.asm.org 3

on November 6, 2019 by guest

http://jvi.asm.org/

[image:3.585.47.536.71.365.2]
(4)

control cells (Fig. 2c). In order to further clarify the effect of OTULIN on PRRSV

proliferation, we designed OTULIN small interfering RNA (siRNA). As previously

specu-lated, proliferation of PRRSV was inhibited to some extent when the expression of

intracellular OTULIN was disturbed (Fig. 2d to f). These data indicate that the changes

in cellular OTULIN expression were consistent with PRRSV proliferation and that OTULIN

expression can promote PRRSV proliferation.

The enhancement of OTULIN on PRRSV is related to innate immunity.

IFN-

plays critical roles in the innate immune responses to viral infection (31, 32). Our

previous studies showed that OTULIN is beneficial to PRRSV proliferation, maybe due to

the negative regulation function of porcine OTULIN in innate immunity. To test that

possibility, we examined the mRNA levels of transcription factors and cytokines related

to innate immunity. Overexpression of OTULIN decreased the levels of PRRSV-induced

TNF-

, NF-

B, and interferon regulatory transcription factor 3 (IRF3) activation in

3D4/21 cells, in which NF-KB and IRF3 are important transcription factors for interferon

production (Fig. 3a). Overexpression of OTULIN also attenuated levels of IFN-

induced

by PRRSV (Fig. 3c). While expression of OTULIN was disturbed by the introduction of

siRNA, the mRNA levels of NF-

B and IFN-

were upregulated (Fig. 3b and d). To directly

investigate the effect of OTULIN on antiviral responses, vesicular stomatitis virus (VSV)

was used. 3D4/21 cells transfected with OTULIN expression plasmid showed more

green fluorescence under a fluorescence microscope than empty vector (Fig. 3e).

Correspondingly, levels of VSV RNA replicates were increased in OTULIN-transfected

cells (Fig. 3f), and Western blot analysis showed that expression of VSV green

fluores-cent protein (VSV-GFP) was also increased in the OTULIN group (Fig. 3g). Taken

together, these data demonstrated that OTULIN negatively regulates IFN-

production

and antiviral immune responses, resulting in the enhancement of OTULIN levels on

PRRSV.

OTULIN enhances the PRRSV deubiquitination effect.

Previous reports indicated

that PRRSV infection led to reduced ubiquitination of cellular proteins (22). As OTULIN

FIG 2Contribution of PRRSV replication by OTULIN overexpression in 3D4/21 cells. (a and b) 3D4/21 cells were transfected with Flag-OTULIN or with empty vector or left untransfected. At 12 h posttransfection, cells were infected with PRRSV (MOI of 0.5). The infected cells were collected at 12 h (a) or 24 h (a and b) postinfection, mRNA loads of PRRSV N were tested by qRT-PCR, and PRRSV Nsp2 levels were tested by WB. (c) PRRSV-containing samples were tested by plaque assay. (d and e) 3D4/21 cells were transfected with siRNA of OTULIN or of the negative control (NC) or were left untransfected; 12 h after transfection, cells were infected with PRRSV (MOI of 0.5). The infected cells were collected at 12 h (d) or 24 h (e) postinfection, mRNA loads of PRRSV N and OTULIN were tested by qRT-PCR, and PRRSV Nsp2 levels were tested by WB. (f) PRRSV-containing samples were tested by plaque assay.*,P⬍0.05;**,P⬍0.01;***,P⬍0.001 (two-way ANOVA followed by Bonferroni posttest). Data are representative of results from three independent experiments.

on November 6, 2019 by guest

http://jvi.asm.org/

[image:4.585.44.471.72.309.2]
(5)

is the only known linear ubiquitination-specific deubiquitinase, we tested whether

OTULIN could help PRRSV further decrease intracellular ubiquitination. PRRSV infection

inhibited ubiquitination caused by wild-type ubiquitin (WT-Ub) in 3D4/21 cells, while

overexpression of OTULIN further decreased the ubiquitination (Fig. 4a). Similarly,

OTULIN and PRRSV doubly regulated endogenous ubiquitin levels (Fig. 4b). These data

indicated that the deubiquitination relationship between OTULIN and PRRSV is not

competitive or, at least, that they do not interfere with each other.

OTULIN interaction with Nsp11.

We hypothesized that there is an unknown effect

of the relationship between OTULIN and PRRSV Nsp1 or Nsp11, each of which is a major

protein related to ubiquitination or deubiquitination (19, 22). We confirmed that

Flag-tagged porcine OTULIN interacted specifically with Nsp11 but only interacted with

Nsp1 at a much lower level (Fig. 5a). In agreement with the immunoprecipitation

results, His-OTULIN immobilized on agarose beads efficiently bound to Nsp11-Myc in

cell lysates, whereas His alone did not (Fig. 5b). In addition, PRRSV Nsp11 was able to

FIG 3The enhancement of OTULIN on PRRSV is related to innate immunity. (a and c) 3D4/21 cells were transfected with OTULIN expression plasmid or with control plasmid; 12 h after transfection, cells were infected with PRRSV at an MOI of 0.5 and the mRNA levels of TNF-␣, NF-␬B, IRF3 (a), and IFN-␤(c) were examined by qRT-PCR analysis at 12 h postinfection. (b and d) 3D4/21 cells were transfected with siRNA of OTULIN or the NC; 12 h after transfection, cells were infected with PRRSV at an MOI of 0.5 and the mRNA level of NF-␬B (b) and IFN-␤(d) were examined by qRT-PCR analysis at 24 h postinfection. (e) 3D4/21 cells were transfected with OTULIN expression plasmid or control plasmid; after 18 h, cells were infected with VSV-GFP at an MOI of 0.1 and monolayers were examined and photographed with an inverted fluorescence microscope at 12 h postinfection. The data shown represent one experiment representative of two experiments performed independently with similar results. BF, bright field; FL, fluorescent. (f and g) 3D4/21 cells were transfected with OTULIN expression plasmid or control plasmid; after 18 h, cells were infected with VSV-GFP at an MOI of 0.1 and the mRNA level of VSV were examined by qRT-PCR analysis (f) and WB (g) at 24 h postinfection. Results were normalized to the␤-actin control gene data and are presented relative to those determined for the control cells.*,P⬍0.05;**,P⬍0.01;***,P⬍0.001 (two-way ANOVA followed by Bonferroni posttest). Data are representative of results from three independent experiments.

Deubiquitinase OTULIN Promotes PRRSV Multiplication Journal of Virology

May 2018 Volume 92 Issue 9 e00175-18 jvi.asm.org 5

on November 6, 2019 by guest

http://jvi.asm.org/

[image:5.585.46.473.68.431.2]
(6)

coprecipitate with endogenous OTULIN, which further demonstrated the interaction

between OTULIN and PRRSV Nsp11 (Fig. 5c). Confocal microscopy showed that

Flag-OTULIN was expressed throughout the cytoplasm and partially coexisted with

Myc-Nsp11 in HeLa and 3D4/21 cell lines, while no such results was seen with the control

cells (Fig. 5d and f). Importantly, we found that OTULIN and NSP11 were able to form

endogenous complexes when PRRSV infected cells (Fig. 5e). Previous reports showed

that the ubiquitination activity of Nsp11 was essential for the activation of its inhibition

of NF-

B whereas the binding of OTULIN to the PUB domain of HOIP was found to

control NF-

B signaling, and our results indicated that OTULIN and Nsp11 directly

interacted with each other.

The OTU domain of OTULIN interacts with PRRSV Nsp11.

Next, to figure out the

specific mechanism of the interaction of OTULIN with Nsp11, we first mapped the

domains of OTULIN and constructed the corresponding truncated body, which

con-sisted of amino acids (aa) 1 to 79, aa 49 to 353, and aa 80 to 353 (Fig. 6a). Roughly,

OTULIN consisted of a PIM domain and an OTU domain; the PIM domain is responsible

for the combination with LUBAC, while the OTU domain containing the

deubiquitinat-ing enzyme active site is responsible for binddeubiquitinat-ing to NEMO. The results showed that

Flag-OTULIN could be coprecipitated with Nsp11-Myc and that the key to the binding

was the OTU domain (Fig. 6b). Given the presence of enzyme sites in the OTU domain,

we next constructed several mutants to find out whether this example of binding

represents enzyme-competitive binding. The results of ubiquitination showed that the

deubiquitination effect of several mutants was weakened to some extent compared

with the wild-type (WT) results, and Flag-OTULIN (H339Y/N341Y) mutants had the

lowest deubiquitination ability (Fig. 6c). The effects of these enzyme site mutants on

type I interferons also differed (Fig. 6e). Immunoprecipitation analysis showed that the

mutation of the enzyme site did not affect the binding of NSP11 to OTULIN (Fig. 6d).

The analysis also demonstrated that PRRSV Nsp11 could interact with the OTU domain

of OTULIN but that the interaction had nothing to do with the OTULIN enzyme sites,

indicating the possibility that Nsp11 is associated with OTULIN targeting NEMO to

remove linear ubiquitin chains.

PRRSV Nsp11 interaction with NEMO.

Previous studies have shown that human

OTULIN can remove linear ubiquitination targeting NEMO (23). So far, the results have

shown that there may be some connection between PRRSV Nsp11 and linear

ubiquiti-nation targeting NEMO. To verify that PRRSV Nsp11 is associated with OTULIN targeting

FIG 4OTULIN enhances the PRRSV deubiquitination effect. (a) 3D4/21 cells were cotransfected with HA-Ub, Flag-OTULIN or empty vector. At 12 h posttransfection, cells were infected with PRRSV (MOI of 0.5) or left uninfected. After 24 h, the infected cells were collected and analyzed by WB. (b) 3D4/21 cells were transfected with Flag-OTULIN or empty vector. At 12 h posttransfection, cells were infected with PRRSV (MOI of 0.5) or left uninfected. After 24 h, the infected cells were collected and the cellular ubiquitin levels were analyzed by WB.

on November 6, 2019 by guest

http://jvi.asm.org/

[image:6.585.59.353.71.245.2]
(7)

FIG 5Identification of the interaction between OTULIN and PRRSV Nsp11. (a) 293T cells were cotransfected with Flag-OTULIN and Nsp1-Myc, Nsp11-Myc, or empty vector. At 24 h after transfection, the cell lysates were precipitated with an anti-Myc monoclonal antibody (MAb) in conjunction with protein A Sepharose and were further detected by Western blotting performed with an anti-Flag MAb antibody and an anti-Myc antibody, respectively. (b) The interaction of OTULIN with PRRSV Nsp11 by pulldown is shown. Bacterial purified His-OTULIN protein interacted with Nsp11-Myc in cell lysates. (c) Detection of the interaction between endogenous OTULIN and PRRSV Nsp11 by coimmunoprecipitation. (d) HeLa or 3D4/21 cells were cotransfected with Nsp11-Myc and Flag-OTULIN. The cells were fixed at 24 h posttransfection and doubly stained with a rabbit anti-Myc MAb and a mouse anti-Flag antibody followed by

(Continued on next page)

Deubiquitinase OTULIN Promotes PRRSV Multiplication Journal of Virology

May 2018 Volume 92 Issue 9 e00175-18 jvi.asm.org 7

on November 6, 2019 by guest

http://jvi.asm.org/

[image:7.585.41.453.64.660.2]
(8)

NEMO to remove linear ubiquitin chains, 293T cells were cotransfected with Nsp11-Myc

and Flag-IKK

, Flag-IKK

, or Flag-NEMO. The results showed that Nsp11 could be

coprecipitated with NEMO, IKK

, and IKK

(Fig. 7a). Furthermore, we found that PRRSV

Nsp11 has a recruitment effect on endogenous OTULIN targeting NEMO (Fig. 7b),

further degrading linear ubiquitination in cells (Fig. 7c). Moreover, colocalization

be-tween PRRSV Nsp11 and NEMO was observed in both HeLa cells (Fig. 7d) and 3D4/21

cells (Fig. 7e) cotransfected with Flag-NEMO and Nsp11-Myc. Additionally, Nsp11 did

not affect the total abundance of OTULIN protein (Fig. 7b), suggesting that there may

be other molecular mechanisms responsible for OTULIN overexpression in PRRSV

infection. These data suggested that Nsp11 recruits extra OTULIN, resulting in an

abnormally reduced linear ubiquitination level in targeting NEMO.

The superimposed effects of OTULIN and Nsp11 on deubiquitination.

Nsp11 is

one of the key proteins involved in reduction of ubiquitin levels when cells are infected

by PRRSV (22). Thus, we tested the effects of OTULIN and Nsp11 on intracellular

ubiquitin levels. Overexpression of Nsp11 in HEK293T cells decreased the ubiquitination

caused by WT-Ub in HEK 293T cells, which was in agreement with the previous reported

data. Interestingly, OTULIN further inhibited ubiquitination in a dose-dependent

man-ner (Fig. 8a). Similarly, OTULIN and Nsp11 also had a syman-nergistic reduction effect on

endogenous ubiquitin levels in cells (Fig. 8b). OTULIN specifically targets linear

ubiq-uitin chains to reduce ubiqubiq-uitination; thus, while expression of OTULIN was disturbed,

the linear ubiquitination level was upregulated (Fig. 8c). Importantly, the linear

ubiquitination-specific deubiquitinase OTULIN had no effect on K48 or K63

polyubiq-uitination (Fig. 8d). Previous studies have shown that PRRSV Nsp11 specifically removed

K48 ubiquitination but had no effect on K63 ubiquitination, and our results were

consistent with that finding. Meanwhile, Nsp11 has no significant effect on linear

ubiquitination levels, suggesting that Nsp11 does not directly affect linear ubiquitin

chains. Those data indicated that OTULIN and Nsp11 have superimposed effects on

intracellular ubiquitination. Nsp11 has a recruiting effect on the delinear ubiquitination

of OTULIN. However, the effect of OTULIN on Nsp11 removal of ubiquitination at K48

was not statistically significant.

Nsp11 further reduces type I interferon production by recruiting OTULIN.

In

order to figure out the physiological changes caused by the cooperation of OTULIN and

Nsp11, HEK 293T cells were transfected with Flag-OTULIN or Nsp11-Myc and were then

infected with SeV, and the mRNA levels of NF-

B, IFN-

, and IRF3 were detected by

qRT-PCR. PRRSV Nsp11 and OTULIN downregulated the expression of NF-

B, and the

downregulation effect on NF-

B was more obvious in cells coexpressed with Nsp11 and

OTULIN (Fig. 9a). Moreover, PRRSV Nsp11 and OTULIN could also downregulate the

expression of IRF3 (Fig. 9b). Meanwhile, OTULIN inhibited IFN production together with

PRRSV Nsp11, and the downregulation effect on IFN-

was more obvious when cells

were coexpressed with Nsp11-Myc and Flag-OTULIN (Fig. 9c). Interestingly, when

OTULIN deubiquitination was inactivated, this additive effect disappeared (Fig. 9a to c).

Western blot analysis showed that expression of PRRSV Nsp11 and OTULIN blocked

NF-

B passage into the nucleus and that the inhibitory effects were superimposed (Fig.

9d). These data suggested that Nsp11 could further reduce type I interferon production

by recruiting OTULIN and that the level of influence depends on the deubiquitination

of OTULIN.

DISCUSSION

Ubiquitination generally regulates cellular function by timely and selective addition

of the ubiquitin molecule to its substrate (33). There are eight different types of

FIG 5Legend (Continued)

FITC-conjugated anti-mouse IgG (green) and PE-conjugated anti-rabbit IgG (red). Nuclei were stained with DAPI (blue). (e) Interactions between GFP-OTULIN and Nsp11 were detected by immunofluorescence under conditions of PRRSV infection in 3D4/21 cells. (f) Porcine OTULIN did not colocate with Nsp1-Myc in HeLa cells. Cells were observed using a laser confocal imaging analysis system. Bar, 7␮m.

on November 6, 2019 by guest

http://jvi.asm.org/

(9)

FIG 6The OTU domain of OTULIN interacts with PRRSV Nsp11. (a) Mapping of OTULIN domains. OTULIN is consisted of a PIM domain and an OTU domain. (b) 293T cells were cotransfected with Nsp11-Myc and Flag-OTULIN (aa 1 to 79), Flag-OTULIN (aa 80 to 353), Flag-OTULIN (aa 49 to 363), or Flag-OTULIN (aa 1 to 353). At 24 h posttransfection, the cell lysates were precipitated with an anti-Myc MAb in conjunction with protein A Sepharose and were further detected by Western blotting with an anti-Flag MAb antibody and an anti-Myc antibody, respectively. (c) 293T cells were cotransfected with an HA knockout (HA-KO) (ubiquitin mutants which all lysines mutated to arginine) and Flag-OTULIN mutant plasmid, and the effects of different mutants on the linear ubiquitination were detected by WB. (d) Detection of the interaction between Nsp11-Myc and different Flag-OTULIN mutant by coimmunoprecipitation. (e) Effects of different OTULIN mutants on the type I interferon signaling pathway. HEK 293T cells were transfected with Flag-OTULIN or mutants. At 12 h posttransfection, cells were

(Continued on next page)

Deubiquitinase OTULIN Promotes PRRSV Multiplication Journal of Virology

May 2018 Volume 92 Issue 9 e00175-18 jvi.asm.org 9

on November 6, 2019 by guest

http://jvi.asm.org/

[image:9.585.41.542.73.669.2]
(10)

connection methods. The first seven types include K6, K11, K27, K29, K33, K48, and K63,

which are associated with the internal lysine K and the glycine G at the C terminus of

ubiquitin molecules (34–36). Most of the studies have investigated K48 and K63

polyadenylation modification, in which the polyubiquitination modification at position

K48 mainly plays a role in degradation (37, 38) and the polyubiquitination modification

at position K63 mainly plays a role in signal transduction DNA repair function (39, 40).

In recent years, the eighth type of ubiquitin chain linkage connection method, linear

ubiquitination, was found. The ubiquitin chain is linked by the amino group of ubiquitin

methionine Met1 and the carboxyl group of another ubiquitin glycine.

The ubiquitin proteasome pathway is important for the degradation of intracellular

proteins in eukaryotic cell organisms and can regulate the physiological balance of

proteins (41). Ubiquitin is essential for regulation of various proteins, and

deubiquiti-nation of proteases plays a very important role in the regulation of the first critical

response factor in the innate immune response to viral infection (34). The human

OTULIN gene (Human Genome Organisation [HUGO] Gene Nomenclature Committee

[HGNC]-approved gene nomenclature) is located on 5p15.2 and encodes an OTULIN

protein consisting of 352 amino acids (42). OTULIN specifically binds to Met l-Ub and

LUBAC and hydrolyzes the Met l-Ub chain bound to the substrate specifically (not

acting on the nonubiquitinated protein), allowing ubiquitination and deubiquitination

of the substrate to maintain homeostasis for participation in a variety of biological

functions in the organism. Research has shown that homozygous mutations in the

human OTULIN gene can lead to potentially lethal autoinflammatory states, known as

OTULIN-related autoimmune syndrome (ORAS) (43).

The ubiquitin-proteasome pathway (UPP) is an important target for the virus to help

itself better achieve its life cycle (5, 44). Many viruses can encode proteins to modify the

host’s ubiquitin regulatory mechanisms, and some viruses can even encode some of

the ubiquitination or deubiquitination proteases. Such activity may represent a unique

protective mechanism established by the virus for long periods of confrontation with

host innate immunity. In addition, early replication of the viruses depends on the

nonstructural protein, which exhibits a large amount of enzyme activity, including

polymerization and replicase activity (45, 46). Exploitation of such activity has become

an effective strategy for research on nonstructural proteins involved in virus

deubiq-uitination.

In this study, we successfully amplified the complete coding sequence (CDS) of

OTULIN and performed domain analyses with results that indicated that OTULIN shares

a high level of amino acid sequence identity with

Homo sapiens

and includes a PIM

domain and an OTU domain.

The scientific results of our work can be summarized as follows. First, PRRSV

infection upregulated intracellular OTULIN gene expression; in turn, upregulation of the

OTULIN gene further promoted virus proliferation. Moreover, proliferation of PRRSV was

inhibited when OTULIN gene expression was disturbed. We found that the levels of

OTULIN expression and PRRSV proliferation level are consistent to some extent. Second,

the level of ubiquitin in 3D4/21 cells decreased after PRRSV infection, and the

overex-pression of OTULIN further removed the ubiquitination. Third, further research showed

that PRRSV Nsp11 interacts with OTULIN and that the two colocate with each other; the

key of the interaction between PRRSV Nsp11 and OTULIN is the OTU domain. It is

noteworthy that this binding represents a combination of nonenzymatic live sites and

that the interaction therefore does not affect OTULIN deubiquitination capabilities.

Previous data showed that PRRSV inhibits the ability of type I IFNs to induce an antiviral

response in MARC-145 and PAM cells and that Nsp11 is an important interferon

antagonist. We found that Nsp11 removes the K48 ubiquitin chain and has no direct

FIG 6Legend (Continued)

infected with SeV (MOI of 0.5) or left uninfected. After 12 h, the infected cells were collected and the mRNA levels of NF-␬B, IRF3, and IFN-␤were analyzed by qRT-PCR.*,P⬍0.05;**,P⬍0.01;***,P⬍0.001 (two-way ANOVA followed by Bonferroni posttest). Data are representative of results from three independent experiments.

on November 6, 2019 by guest

http://jvi.asm.org/

(11)

FIG 7PRRSV Nsp11 interact with NEMO. (a) HEK 293T cells were cotransfected with Nsp11-Myc and Flag-IKK␣, Flag-IKK␤, or Flag-NEMO. At 24 h posttransfection, the cell lysates were precipitated with an anti-Flag MAb in conjunction with protein A Sepharose and further detected by Western blotting with an anti-Flag MAb antibody and an anti-Myc antibody, respectively. (b) (c) 293T cells were cotransfected with Flag-NEMO, HA-KO, and Nsp11-Myc or blank vector. At 24 h posttransfection, the cell lysates were precipitated with an anti-Flag MAb in conjunction with protein A Sepharose and further detected by Western blotting with an anti-Myc MAb and an anti-HA antibody, respectively. (d and e) HeLa cells (d) or 3D4/21 cells (e) were cotransfected with Nsp11-Myc and

(Continued on next page)

Deubiquitinase OTULIN Promotes PRRSV Multiplication Journal of Virology

May 2018 Volume 92 Issue 9 e00175-18 jvi.asm.org 11

on November 6, 2019 by guest

http://jvi.asm.org/

[image:11.585.39.399.67.657.2]
(12)

effect on the linear ubiquitin chain but instead recruits OTULIN to enhance its ability to

remove linear ubiquitination targeting NEMO.

PRRSV Nsp11 targets I

B

to remove ubiquitination of K48, thereby inhibiting IFN-

production (22, 47). Our study showed that Nsp11 can influence linear ubiquitination

targeting NEMO by recruiting OTULIN and causing superimposition of the effect of

inhibition of production of type I IFNs. The results imply that the related proteins play

FIG 7Legend (Continued)

Flag-IKK␣, Flag-IKK␤, or Flag-NEMO. The cells were fixed at 24 h posttransfection and doubly stained with a rabbit anti-Myc MAb and a mouse anti-Flag antibody followed by FITC-conjugated anti-mouse IgG (green) and PE-conjugated anti-rabbit IgG (red). Nuclei were stained with DAPI (blue). Cells were observed under a laser confocal imaging analysis system. Bar, 7␮m.

FIG 8The superimposed effect of OTULIN and Nsp11 on deubiquitination. (a) HEK 293T cells were cotransfected with HA-Ub, Flag-OTULIN, or Nsp11-Myc. At 24 h posttransfection, the cells were collected and analyzed by WB. (b) HEK 293T cells were transfected with Flag-OTULIN or Nsp11-Myc. After 24 h, cells were collected and the cellular ubiquitin levels were analyzed by WB. (c) HEK 293T cells were transfected with siRNA of OTULIN or NC; after 12 h, cells were transfected with HA-KO, and after 24 h posttransfection, cells were collected and the cellular ubiquitin levels were analyzed by WB. (d) HEK 293T cells were transfected with Flag-OTULIN, Nsp11-Myc, and HA-K48, HA-K63 (ubiquitin mutants retaining a single lysine residue), HA-KO, or HA-Ub. At 24 h posttransfection, the cells were collected and analyzed by WB.

on November 6, 2019 by guest

http://jvi.asm.org/

[image:12.585.44.503.68.520.2]
(13)

a role in the innate immunity of the host when the virus invades. Interestingly, the

antagonism of the viral proteins may not be directed at single molecules but may act

on the synergy of multiple molecules.

Porcine reproductive and respiratory syndrome virus (PRRSV) is a critical pathogen

of swine (47). Infection of PRRSV significantly reduced cellular protein ubiquitination,

whereas Nsp11 was found to be a key nonstructural protein that regulates

ubiquitina-tion levels during PRRSV infecubiquitina-tion. Our study explored the role of OTULIN in PRRSV

infection and the effect of PRRSV infection on intracellular OTULIN. We found that the

cooperative effect of swine OTULIN and PRRSV Nsp11 can enhance the ability of Nsp11

to reduce cellular levels of the protein ubiquitin, which is associated with innate

immunity. In brief, PRRSV infection upregulates OTULIN expression. Nsp11 is produced

during PRRSV replication, and it recruits more OTULIN molecules to reduce

ubiquiti-FIG 9Nsp11 further reduces type I interferon production by recruiting OTULIN. (a,b, and c) HEK 293T cells were transfected with Nsp11-Myc, Flag-OTULIN, or mutant. At 12 h posttransfection, cells were infected with SeV (MOI of 0.5) or left uninfected. After 12 h, the infected cells were collected and the mRNA levels of NF-␬B (a), IRF3 (b), and IFN-␤(c) were analyzed by qRT-PCR. (d) HEK 293T cells were transfected with Nsp11-Myc, Flag-OTULIN, or mutant. At 12 h posttransfection, cells were infected with SeV (MOI of 0.5). After 24 h, the infected cells were collected and the expression levels of p65 in the nucleus or cytoplasm were analyzed by WB. (e) Models of Nsp11 and OTULIN reduction of type I IFN production.*,P⬍0.05;**,P⬍0.01;***,P⬍0.001 (two-way ANOVA followed by Bonferroni posttest). Data are representative of results from three independent experiments.

Deubiquitinase OTULIN Promotes PRRSV Multiplication Journal of Virology

May 2018 Volume 92 Issue 9 e00175-18 jvi.asm.org 13

on November 6, 2019 by guest

http://jvi.asm.org/

[image:13.585.40.540.72.507.2]
(14)

nation levels in interferon signaling pathways, thus inhibiting the production of type I

interferon and promoting the proliferation of the virus (Fig. 9e). Our report provides a

new model of virus utilization of the ubiquitin-protease system

in vivo

from the

perspective of the interaction of viral proteins with cell deubiquitination enzymes.

However, whether OTULIN plays another role in PRRSV infection needs to be further

studied. The molecular mechanism by which PRRSV infection leads to the upregulation

of OTULIN expression remains unclear. The specific sites of molecular interaction still

need further exploration.

MATERIALS AND METHODS

Cells, virus, and antibody.Porcine alveolar macrophage (PAM) cell line 3D4/21 (CRL-2843) was grown in RPMI 1640 medium (Gibco) supplemented with 10% fetal bovine serum (FBS) (Biological Industries). Human embryonic kidney (HEK) 293T cells, MARC-145 cells, and HeLa cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal FBS, 100 U/ml penicillin, and 10␮g/ml streptomycin sulfate in a humidified incubator at 37°C and 5% CO2. A stock of porcine

reproductive and respiratory syndrome virus (PRRSV-JXwn06) with a titer of 104PFU/ml was employed

in this study. Antibody to OTULIN was prepared by immunizing mice with the purified protein. Anti-PRRSV Nsp11 was a gift from China Agricultural University. Labeled antibodies used in the exper-iments were purchased from Cell Signaling Technology (CST) and Applied Biological Materials Inc. (ABM). Internal reference antibody and secondary antibodies were purchased from Invitrogen.

RT-PCR amplification of complete porcine OTULIN CDS.A pair of oligonucleotide primers from the 5=-terminal coding sequence (CDS) and 3=-terminal CDS were designed based on the predicted OTULIN sequence as shown in Table 1. Intracellular total RNAs were extracted using TRIzol reagent. Total RNAs were reverse transcribed into cDNA using reverse transcriptase (TaKaRa).

Determination of virus titer.The virus titer was determined using the 50% tissue culture infective dose (TCID50) method. Marc145 cells were seeded in 96-well plates (Corning Inc., Corning, NY, USA) at a

ratio of 1⫻104cells/well, and a series of dilutions (approximately 10⫺2to 10⫺6) of a viral suspension in

2% DMEM were inoculated in triplicate onto Marc-145 monolayer cells and incubated for 1 h at 37°C. The normal cells were used as a mock control. The reaction mixtures were incubated at 37°C for 7 days, and TCID50values were calculated according to the Reed-Muench formula. The PFU levels of PRRSV on

[image:14.585.44.543.80.317.2]

Marc145 cells were determined by a method using methyl cellulose overlay and crystal violet staining. Confocal microscopy.The procedure used for confocal microscopy was described previously (48). Briefly, HeLa or 3D4/21 cells grown on coverslips in 12-well plates (Corning Inc., Corning, NY, USA) at 30% to 50% confluence were transfected with plasmids expressing OTULIN (0.5␮g) or Nsp11 (0.5␮g). The empty plasmid was used as a negative control (NC). For endogenous fluorescence detection, 3D4/21 cells transfected with plasmid were infected with PRRSV at an MOI of 0.5. At 24 h posttransfection or infection, the cells were fixed with 4% paraformaldehyde for 15 min at room temperature, permeabilized for 10 min with phosphate-buffered saline (PBS) containing 0.3% Triton X-100 and 2% bovine serum albumin (BSA), and then blocked with 5% BSA–PBS for 30 min. Next, cells were incubated with anti-Flag, anti-Myc, anti-hemagglutinin (anti-HA), and anti-PRRSV Nsp11 antibodies for 1 h at room temperature in a humid

TABLE 1The primers used for PCR amplification

Primer name GenBank no. Primer sequence (5=–3=)

T-OTULIN-F XM_003133841.4 CATGTGGCTCTTAATAATTCTGC

T-OTULIN-R ATAAAGACCAGCATCGGACCAAGACT

pCMV-OTULIN-F XM_003133841.4 CGCTCGAGCGATGCGTCGGGGGACCATGCCT

pCMV-OTULIN-R GGATCCCTACAGACTTGTCTCCTCACACA

pet-28a-OTULIN-F XM_003133841.4 ACAGCAAATGGGTCGCGGATCCATGTATCGTGCAGCGGAT

pet-28a-OTULIN-R GACGGAGCTCGAATTCGGATCCCAGACTTGTCTCCTCA

pCMV-OTULIN(1-79)-F XM_003133841.4 GGAATTCCATGCGTCGGGGGACCAT

pCMV-OTULIN(1-79)-R GGATCCTCATCTGGGTTCTGATGCC

pCMV-OTULIN(80-353)-F XM_003133841.4 GGAATTCCATGTTAAGTGTAGCTCCTG

pCMV-OTULIN(80-353)-R GGATCCTCACAGACTTGTCTCCTCACAC

pCMV-OTULIN(49-353)-F XM_003133841.4 GGAATTCCATGGCCGAGCACGAGGAGGA

pCMV-OTULIN(49-353)-R GGATCCTCACAGACTTGTCTCCTCACAC

pcDNA3.1-Nsp1-F JX317649.1 CGGAATTCATGTCTGGGATACTTGAT

pcDNA3.1-Nsp1-R GCTCTAGATCACAGATCCTCTTCAGAGATGAGTTTCTGCTCACCGTACCACTTATGACT

pcDNA3.1-Nsp11-F JX317649.1 CGGAATTCATGGGGTCGAGCTCCCCGCT

pcDNA3.1-Nsp11-R GCTCTAGATCACAGATCCTCTTCAGAGATGAGTTTCTGCTCTTCAAGTTGAAAATAGGC

on November 6, 2019 by guest

http://jvi.asm.org/

(15)

chamber. Following a wash performed with PBS 3 times for 5 min each time, the cells were incubated with fluorescein isothiocyanate (FITC)-conjugated anti-mouse IgG or phycoerythrin (PE)-conjugated anti-rabbit IgG secondary antibody for an additional hour. Nuclear DNA was stained with 4,6-diamidino-2-phenylindole (DAPI) (Molecular Probes). The localization of OTULIN and Nsp11 was observed under an inverted fluorescence and phase-contrast microscope (Olympus). Images were taken at⫻100 magnifi-cation.

Western blot analysis.Cell lysates were heated in buffer for 10 min and separated by SDS-PAGE. The separated proteins were transferred onto a nitrocellulose (NC) fitter membrane (ExPro), and then membranes were blocked with PBST (1⫻PBS– 0.05% Tween 20) mixed with 5% nonfat dry milk for 1 h at room temperature. The membranes were then stained with primary antibodies at 4°C overnight. The membranes were then washed with 0.05% PBST and stained with the proper horseradish peroxidase (HRP)-conjugated secondary antibodies for 1 h at room temperature. The membrane was washed again and subjected to detection using a chemiluminescence detection kit (Thermo Scientific, Waltham, MA, USA) and, finally, was exposed to a chemiluminescence apparatus (Gel Doc XR⫹ imaging system; Bio-Rad, USA).

Quantitative real-time PCR.Quantification of the relative levels of gene expression was performed using qRT-PCR carried out on an ABI 7500 real-time PCR system and used the comparative cycle threshold (CT) method, according to the instructions of the manufacturer (Applied Biosystems). The

thermal cycler program consisted of 95°C for 10 min and then 45 cycles at 95°C for 15 s, 55°C for 30 s, and 72°C for 30 s and was performed using DBI Bioscience-2043 Bestar SYBR green qPCR Mastermix. All the primers used for quantitative real-time PCR are listed in Table 2.

Immunoprecipitations. Cells cultivated in 60-mm-diameter plates were either singly or doubly transfected with appropriate expression plasmid. At 24 h posttransfection, the cells were harvested in 500 ␮l radioimmunoprecipitation assay (RIPA) lysis buffer (with protease inhibitor cocktail added). Anti-Myc-labeled or anti-Flag-labeled beads (Sigma) were added to the cell lysis supernatant at 10␮l per tube. The reaction mixture was incubated at 4°C for 2 h overnight. The beads were washed three times with lysis buffer for 10 min each time and boiled for 5 min, and the proteins bound to the beads were separated by SDS-PAGE, transferred onto NC membranes, and probed with the proper antibodies against Flag, Myc, or␤-actin.

His tag pulldown.First, a His-OTULIN fusion protein was purified using prokaryotic expression and BL21(DE3) cells with nickel-nitrilotriacetic acid (Ni-NTA) resin (49). The HEK 293T cells cultivated in 60-mm-diameter plates were transfected with plasmids carrying Nsp 11. At 24 h posttransfection, the cells were harvested in 500 ␮l RIPA buffer. The cell lysate was added to the Ni-NTA resin-adsorbed OTULIN fusion protein and incubated at 4°C for 2 h, and then the resin was washed three times with lysis buffer for 10 min each time and boiled for 5 min. Finally, the results were analyzed by Western blotting. Flow cytometry analysis.3D4/21 cells were infected with PRRSV at a multiplicity of infection (MOI) of 0.5 or were subjected to mock infection with RPMI 1640. After 1 h of incubation, the inoculum was removed, and the cells were supplemented with fresh RPMI 1640 medium containing 2% FBS. At 24 h postinfection, cells were gently washed three times with 1⫻PBS, dissociated from the plates with 0.25% trypsin at 37°C for 5 min, and then washed with precooled PBS containing 1% bovine serum albumin (BSA). Cells were stained with mouse monoclonal anti-OTULIN mixed in 2% BSA–PBS for 30 min at room temperature. Following a wash with PBS, the cells were then incubated with FITC-conjugated goat anti-mouse IgG (1:200) secondary antibody for 30 min in darkness. For fluorescence-activated cell sorter (FACS) analysis, a total of 1⫻105cells were analyzed.

[image:15.585.42.373.84.269.2]

Small interfering RNA assay.A small interfering RNA (siRNA) assay was performed by using siRNA targeting the OTULIN gene (siOTULIN) and a negative control (NC), which were synthesized by Gene-Pharma (Tianjin, China) (Table 3). Briefly, 3D4/21 cells grown to 80% confluence in 12-well plates were

TABLE 2The primers used for qRT-PCR amplification

Primer

name GenBank no. Primer sequence (5=–3=)

PRRSV-N-F KX286735.1 GCCTCGTGTTGGGTGGCAGA

PRRSV-N-R CACGGTCGCCCTAATTGAATAGG

OTULIN-F XM_003133841.4 ATCGTGCAGCGGATGAAATAG

OTULIN-R CTGAGACACCTCCTCGTAGCC

TNF-␣-F X57321 GAGATCAACCTGCCCGACT

TNF-␣-R CTTTCTAAACCAGAAGGACGTG

IFN-␤-F NM_001003923 GCAGTATTGATTATCCACGAGA

IFN-␤-R TCTGCCCATCAAGTTCCAC

NF-⌲B-F X61498.1 CCCAGCCATTTGCACACCTCAC

NF-⌲B-R TTCAGAATTGCCCGACCAGTTTTT

␤-Actin-F DQ452569.1 GAATCCTGCGGCATCCACGA

␤-Actin-R CTCGTCGTACTCCTGCTTGCT

Deubiquitinase OTULIN Promotes PRRSV Multiplication Journal of Virology

May 2018 Volume 92 Issue 9 e00175-18 jvi.asm.org 15

on November 6, 2019 by guest

http://jvi.asm.org/

(16)

transfected with the siRNA at a final concentration of 50 nmol with Lipofectamine 3000 (Invitrogen). After 24 h, cells were infected with PRRSV at an MOI of 0.5, and the cells were incubated for additional 24 h. Quantitative real-time PCR (qRT-PCR) and Western blotting analyses were performed to confirm the expression levels.

Statistical analysis.The statistical significance of results of comparisons among different groups was determined by two-way analysis of variance (ANOVA) using GraphPad Prism software (version 6.0). AP value of less than 0.05 was considered statistically significant.

Accession number(s). The sequences of the oligonucleotide primers corresponding to the 5= -terminal coding sequence (CDS) and the 3=-terminal CDS that were designed based on the predicted OTULIN sequence were deposited in GenBank under accession no.XM_003133841.4). The accession numbers corresponding to the primers used in the PCR and qRT-PCR assays are listed in Table 1 and Table 2, respectively.

ACKNOWLEDGMENTS

We declare that we have no potential conflicts of interest with respect to the

research, authorship, and/or publication of this article. The article does not contain any

individual personal data, and guidelines concerning individual consent to publish are

not applicable.

This work was supported by the National Natural Science Foundation of China

(31272540) and the underprop project of Tianjin Science and Technology Committee in

China (16YFZCNC00640).

Jinhai Huang conceived and designed the experiments. Yanxin Su, Peidian Shi,

Ruiqiao Li, Dong Lu, Chengxue Zhao, Lilin Zhang, and Lei Zhang performed the

experiments. Yanxin Su and Lei Zhang analyzed the data. Jinhai Huang contributed

reagents/materials/analysis tools. Yanxin Su and Jinhai Huang wrote the paper.

REFERENCES

1. Thiel HJ, Meyers G, Stark R, Tautz N, Rumenapf T, Unger G, Conzelmann KK. 1993. Molecular characterization of positive-strand RNA viruses: pestiviruses and the porcine reproductive and respiratory syndrome virus (PRRSV). Arch Virol Suppl 7:41–52.https://doi.org/10.1007/978-3 -7091-9300-6_4.

2. Albina E, Piriou L, Hutet E, Cariolet R, L’Hospitalier R. 1998. Immune responses in pigs infected with porcine reproductive and respiratory syndrome virus (PRRSV). Vet Immunol Immunopathol 61:49 – 66.https:// doi.org/10.1016/S0165-2427(97)00134-7.

3. Bültmann A, Eberle J, Haas J. 2000. Ubiquitination of the human immu-nodeficiency virus type 1 env glycoprotein. J Virol 74:5373–5376.https:// doi.org/10.1128/JVI.74.11.5373-5376.2000.

4. Dantuma NP, Masucci MG. 2003. The ubiquitin/proteasome system in Epstein-Barr virus latency and associated malignancies. Semin Cancer Biol 13:69 –76.https://doi.org/10.1016/S1044-579X(02)00101-3. 5. Raaben M, Posthuma CC, Verheije MH, Lintelo EGT, Kikkert M, Drijfhout JW,

Snijder EJ, Rottier PJM, Haan CAMD. 2010. The ubiquitin-proteasome system plays an important role during various stages of the coronavirus infection cycle. J Virol 84:7869 –7879.https://doi.org/10.1128/JVI.00485-10. 6. Satheshkumar PS, Anton LC, Sanz P, Moss B. 2009. Inhibition of the

ubiquitin-proteasome system prevents vaccinia virus DNA replication and expression of intermediate and late genes. J Virol 83:2469.https:// doi.org/10.1128/JVI.01986-08.

7. Yu GY, Lai MM. 2005. The ubiquitin-proteasome system facilitates the transfer of murine coronavirus from endosome to cytoplasm during

virus entry. J Virol 79:644 – 648.https://doi.org/10.1128/JVI.79.1.644-648 .2005.

8. Camborde L, Planchais S, Tournier V, Jakubiec A, Drugeon G, Lacassagne E, Pflieger S, Chenon M, Jupin I. 2010. The ubiquitin-proteasome system regulates the accumulation of Turnip yellow mosaic virus RNA-dependent RNA polymerase during viral infection. Plant Cell 22: 3142–3152.https://doi.org/10.1105/tpc.109.072090.

9. Widjaja I, de Vries E, Tscherne DM, García-Sastre A, Rottier PJ, de Haan CA. 2010. Inhibition of the ubiquitin-proteasome system affects influ-enza A virus infection at a postfusion step. J Virol 84:9625.https://doi .org/10.1128/JVI.01048-10.

10. Wang Z, Ni J, Li J, Shi B, Xu Y, Yuan Z. 2011. Inhibition of hepatitis B virus replication by cIAP2 involves accelerating the ubiquitin-proteasome-mediated destruction of polymerase. J Virol 85:11457–11467.https://doi .org/10.1128/JVI.00879-11.

11. Kirui J, Mondal A, Mehle A. 2016. Ubiquitination upregulates influenza virus polymerase function. J Virol JVI.01829-16.https://doi.org/10.1128/ JVI.01829-16.

12. Ott DE, Coren LV, Sowder RC, II, Adams J, Nagashima K, Schubert U. 2002. Equine infectious anemia virus and the ubiquitin-proteasome system. J Virol 76:3038 –3044.https://doi.org/10.1128/JVI.76.6.3038-3044 .2002.

[image:16.585.40.370.84.173.2]

13. Deribe YL, Pawson T, Dikic I. 2010. Post-translational modifications in signal integration. Nat Struct Mol Biol 17:666.https://doi.org/10.1038/ nsmb.1842.

TABLE 3Primers used in small interfering RNA assay

Primer name Primer sequence (5=–3=)

Negative control F:UUCUCCGAACGUGUCACGUTT

R:ACGUGACACGUUCGGAGAATT

siOTULIN-1 F:GCAUCAGAACCCAGAUUAATT

R:UUAAUCUGGGUUCUGAUGCTT

siOTULIN-2 F:GCUGCUGAGGAACCAUCUATT

R:UAGAUGGUUCCUCAGCAGCTT

on November 6, 2019 by guest

http://jvi.asm.org/

(17)

14. Ikeda F. 2015. Linear ubiquitination signals in adaptive immune re-sponses. Immunol Rev 266:222.https://doi.org/10.1111/imr.12300. 15. Tokunaga F, Iwai K. 2012. LUBAC, a novel ubiquitin ligase for linear

ubiquitination, is crucial for inflammation and immune responses. Mi-crobes Infect 14:563–572.https://doi.org/10.1016/j.micinf.2012.01.011. 16. Kirisako T, Kamei K, Murata S, Kato M, Fukumoto H, Kanie M, Sano S,

Tokunaga F, Tanaka K, Iwai K. 28 September 2006. A ubiquitin ligase complex assembles linear polyubiquitin chains. EMBO Jhttps://doi.org/ 10.1038/sj.emboj.7601360.

17. Buddaert W, Reeth KV, Pensaert M. 1998. In vivo and in vitro interferon (IFN) studies with the porcine reproductive and respiratory syndrome virus (PRRSV). Adv Exp Med Biol 440:461– 467.

18. Du J, Ge X, Liu Y, Jiang P, Wang Z, Zhang R, Zhou L, Guo X, Han J, Yang H. 2015. Targeting swine leukocyte antigen class I molecules for protea-somal degradation by the nsp1␣replicase protein of the Chinese highly pathogenic porcine reproductive and respiratory syndrome virus strain JXwn06. J Virol 90:682– 693.https://doi.org/10.1128/JVI.02307-15. 19. Jing H, Fang L, Zhen D, Dang W, Hao W, Li G, Ke W, Chen H, Xiao S. 18

January 2017. Porcine reproductive and respiratory syndrome virus nsp1␣inhibits NF-␬B activation by targeting the linear ubiquitin chain assembly complex. J Virolhttps://doi.org/10.1128/JVI.01911-16. 20. Sun Z, Chen ZH, Lawson SR, Fang Y. 2010. The cysteine protease domain

of porcine reproductive and respiratory syndrome virus nonstructural protein 2 possesses deubiquitinating and interferon antagonism func-tions. J Virol 84:7832–7846.https://doi.org/10.1128/JVI.00217-10. 21. Huang C, Zhang Q, Guo XK, Yu ZB, Xu AT, Tang J, Feng WH. 2014.

Porcine reproductive and respiratory syndrome virus nonstructural protein 4 antagonizes beta interferon expression by targeting the NF-␬B essential modulator. J Virol 88:10934 –10945.https://doi.org/ 10.1128/JVI.01396-14.

22. Wang D, Fan J, Fang L, Luo R, Ouyang H, Ouyang C, Zhang H, Chen H, Li K, Xiao S. 2015. The nonstructural protein 11 of porcine reproductive and respiratory syndrome virus inhibits NF-␬B signaling by means of its deubiquitinating activity. Mol Immunol 68:357.https://doi.org/10.1016/ j.molimm.2015.08.011.

23. Fiil BK, Damgaard RB, Wagner SA, Keusekotten K, Fritsch M, Bekker-Jensen S, Mailand N, Choudhary C, Komander D, Gyrd-Hansen M. 2013. OTULIN restricts Met1-linked ubiquitination to control innate immune signaling. Mol Cell 50:818 – 830.https://doi.org/10.1016/j.molcel.2013.06 .004.

24. van Wijk SJL, Fricke F, Herhaus L, Gupta J, Hötte K, Pampaloni F, Grumati P, Kaulich M, Sou YS, Komatsu M, Greten FR, Fulda S, Heilemann M, Dikic I. 2017. Linear ubiquitination of cytosolic Salmonella Typhimurium acti-vates NF-␬B and restricts bacterial proliferation. Nature Microbiology 2:17066.https://doi.org/10.1038/nmicrobiol.2017.66.

25. Schaeffer V, Akutsu M, Olma MH, Gomes LC, Kawasaki M, Dikic I. 2014. Binding of OTULIN to the PUB domain of HOIP controls NF-␬B signaling. Mol Cell 54:349 –361.https://doi.org/10.1016/j.molcel.2014.03.016. 26. Elliott PR, Nielsen SV, Marco-Casanova P, Fiil BK, Keusekotten K, Mailand

N, Freund SM, Gyrd-Hansen M, Komander D. 2014. Molecular basis and regulation of OTULIN-LUBAC interaction. Mol Cell 54:335. https://doi .org/10.1016/j.molcel.2014.03.018.

27. Damgaard RB, Walker JA, Marco-Casanova P, Morgan NV, Titheradge HL, Elliott PR, Mchale D, Maher ER, Anj MK, Komander D. 2016. The deubiq-uitinase OTULIN is an essential negative regulator of inflammation and autoimmunity. Cell 166:1215.https://doi.org/10.1016/j.cell.2016.07.019. 28. Auray G, Lachance C, Wang Y, Gagnon CA, Segura M, Gottschalk M. 2016. Transcriptional analysis of PRRSV-infected porcine dendritic cell re-sponse to Streptococcus suis infection reveals up-regulation of inflammatory-related genes expression. PLoS One 11:e0156019.https:// doi.org/10.1371/journal.pone.0156019.

29. Miller LC, Fleming DS, Li X, Bayles DO, Blecha F, Sang Y. 2017. Compar-ative analysis of signature genes in PRRSV-infected porcine monocyte-derived cells to different stimuli. PLoS One 12:e0181256.https://doi.org/ 10.1371/journal.pone.0181256.

30. Weber A, Elliott PR, Pinto-Fernandez A, Bonham S, Kessler BM, Komander D, Oualid FE, Krappmann D. 14 September 2017. A linear diubiquitin-based probe for efficient and selective detection of the deubiquitinating enzyme OTULIN. Cell Chem Biolhttps://doi.org/10.1016/j.chembiol.2017 .08.006.

31. Loo YM, Owen DM, Li K, Erickson AK, Johnson CL, Fish PM, Carney DS, Wang T, Ishida H, Yoneyama M. 2006. Viral and therapeutic control of IFN-beta promoter stimulator 1 during hepatitis C virus infection. Proc Natl Acad Sci U S A 103:6001.https://doi.org/10.1073/pnas.0601523103. 32. Jin Y, Hu Y, Han D, Wang M. 2011. Chronic heat stress weakened the innate immunity and increased the virulence of highly pathogenic avian influenza virus H5N1 in mice. J Biomed Biotechnol 2011:367846.https:// doi.org/10.1155/2011/367846.

33. Singh RK, Zerath S, Kleifeld O, Scheffner M, Glickman MH, Fushman D. 26 October 2012. Recognition and cleavage of related to ubiquitin 1 (Rub1) and Rub1-ubiquitin chains by components of the ubiquitin-proteasome system. Mol Cell Proteomicshttps://doi.org/10.1074/mcp.M112.022467. 34. Zhong B, Liu X, Wang X, Liu X, Li H, Darnay BG, Lin X, Sun SC, Dong C. 2013. Ubiquitin-specific protease 25 regulates TLR4-dependent innate immune responses through deubiquitination of the adaptor protein TRAF3. Sci Signal 6:ra35.https://doi.org/10.1126/scisignal.2003708. 35. Oualid FE, Hameed DS, Atmioui DE, Hilkmann H, Ovaa H. 2012. Synthesis

of atypical diubiquitin chains. Methods Mol Biol 832:597.https://doi.org/ 10.1007/978-1-61779-474-2_42.

36. He F, Wollscheid HP, Nowicka U, Biancospino M, Valentini E, Ehlinger A, Acconcia F, Magistrati E, Polo S, Walters KJ. 2016. Myosin VI contains a compact structural motif that binds to ubiquitin chains. Cell Rep 14: 2683–2694.https://doi.org/10.1016/j.celrep.2016.01.079.

37. Kulathu Y, Komander D. 2012. Atypical ubiquitylation - the unexplored world of polyubiquitin beyond Lys48 and Lys63 linkages. Nat Rev Mol Cell Biol 13:508 –523.https://doi.org/10.1038/nrm3394.

38. van Nocker S, Vierstra RD. 1993. Multiubiquitin chains linked through lysine 48 are abundant in vivo and are competent intermediates in the ubiquitin proteolytic pathway. J Biol Chem 268:24766.

39. Metcalf JL, Bradshaw PS, Komosa M, Greer SN, Stephen Meyn M, Ohh M. 2014. K63-ubiquitylation of VHL by SOCS1 mediates DNA double-strand break repair. Oncogene 33:1055–1065. https://doi.org/10 .1038/onc.2013.22.

40. Hayakawa M. 2012. Role of K63-linked polyubiquitination in NF-␬B signalling: which ligase catalyzes and what molecule is targeted? J Biochem 151:115–118.https://doi.org/10.1093/jb/mvr139.

41. Arora S, Yang JM, Hait WN. 2005. Identification of the ubiquitin-proteasome pathway in the regulation of the stability of eukaryotic elongation factor-2 kinase. Cancer Res 65:3806 –3810.https://doi.org/10 .1158/0008-5472.CAN-04-4036.

42. Lork M, Verhelst K, Beyaert R. 31 Mar 2017. CYLD, A20 and OTULIN deubiquitinases in NF-[kappa]B signaling and cell death: so similar, yet so different. Cell Death Differhttps://doi.org/10.1038/cdd.2017.46. 43. Fiil BK, Gyrd-Hansen M. 30 September 2016. OTULIN deficiency causes

auto-inflammatory syndrome. Cell Reshttps://doi.org/10.1038/cr.2016 .113.

44. Kanlaya R, Pattanakitsakul SN, Sinchaikul S, Chen ST, Thongboonkerd V. 2010. The ubiquitin-proteasome pathway is important for dengue virus infection in primary human endothelial cells. J Proteome Res 9:4960 – 4971.https://doi.org/10.1021/pr100219y.

45. Prasanth KR, Chuang C, Nagy PD. 2017. Co-opting ATP-generating gly-colytic enzyme PGK1 phosphoglycerate kinase facilitates the assembly of viral replicase complexes. PLoS Pathog 13:e1006689.https://doi.org/ 10.1371/journal.ppat.1006689.

46. Restrepo-Hartwig MA, Ahlquist P. 1996. Brome mosaic virus helicase-and polymerase-like proteins colocalize on the endoplasmic reticulum at sites of viral RNA synthesis. J Virol 70:8908 – 8916.

47. Shi X, Wang L, Li X, Zhang G, Guo J, Zhao D, Chai S, Deng R. 2011. Endoribonuclease activities of porcine reproductive and respiratory syn-drome virus nsp11 was essential for nsp11 to inhibit IFN-␤induction. Mol Immunol 48:1568.https://doi.org/10.1016/j.molimm.2011.03.004. 48. Li R, Zhang L, Shi P, Deng H, Li Y, Ren J, Fu X, Zhang L, Huang J. 2017.

Immunological effects of different types of synthetic CpG oligodeoxy-nucleotides on porcine cells. RSC Adv 7:43289 – 43299.https://doi.org/ 10.1039/C7RA04493C.

49. Li Y, Deng H, Shi PD, Xu DD, Zhang LL, Zhang L, Huang JH. 2017. Toxic effects of seu are different from those of other staphylococcal entero-toxins. Am J Transl Res 9:1618.

Deubiquitinase OTULIN Promotes PRRSV Multiplication Journal of Virology

May 2018 Volume 92 Issue 9 e00175-18 jvi.asm.org 17

on November 6, 2019 by guest

http://jvi.asm.org/

https://doi.org/10.1128/JVI.00175-18 All Rights Reserved. crossm jvi.asm.org on November 6, 2019 by guest (https://software.broadinstitute.org/morpheus/ XM_003133841.4 JX317649.1 KX286735.1 X57321 NM_001003923 X61498.1 DQ452569.1 https://doi.org/10.1007/978-3-7091-9300-6_4 https://doi.org/10.1016/S0165-2427(97)00134-7 https://doi.org/10.1128/JVI.74.11.5373-5376.2000 https://doi.org/10.1016/S1044-579X(02)00101-3. https://doi.org/10.1128/JVI.00485-10. https://doi.org/10.1128/JVI.01986-08 https://doi.org/10.1128/JVI.79.1.644-648.2005 https://doi.org/10.1105/tpc.109.072090. https://doi.org/10.1128/JVI.01048-10 https://doi.org/10.1128/JVI.00879-11 https://doi.org/10.1128/JVI.01829-16 https://doi.org/10.1128/JVI.76.6.3038-3044.2002 https://doi.org/10.1038/nsmb.1842 https://doi.org/10.1111/imr.12300. https://doi.org/10.1016/j.micinf.2012.01.011. https://doi.org/10.1038/sj.emboj.7601360 https://doi.org/10.1128/JVI.02307-15. https://doi.org/10.1128/JVI.01911-16. https://doi.org/10.1128/JVI.00217-10. https://doi.org/10.1128/JVI.01396-14 https://doi.org/10.1016/j.molimm.2015.08.011 https://doi.org/10.1016/j.molcel.2013.06.004 https://doi.org/10.1038/nmicrobiol.2017.66. https://doi.org/10.1016/j.molcel.2014.03.016. https://doi.org/10.1016/j.molcel.2014.03.018 https://doi.org/10.1016/j.cell.2016.07.019. https://doi.org/10.1371/journal.pone.0156019 https://doi.org/10.1371/journal.pone.0181256 https://doi.org/10.1016/j.chembiol.2017.08.006 https://doi.org/10.1073/pnas.0601523103. https://doi.org/10.1155/2011/367846 https://doi.org/10.1074/mcp.M112.022467. https://doi.org/10.1126/scisignal.2003708. https://doi.org/10.1007/978-1-61779-474-2_42 https://doi.org/10.1016/j.celrep.2016.01.079. https://doi.org/10.1038/nrm3394. https://doi.org/10.1038/onc.2013.22 https://doi.org/10.1093/jb/mvr139. https://doi.org/10.1158/0008-5472.CAN-04-4036 https://doi.org/10.1038/cdd.2017.46. https://doi.org/10.1038/cr.2016.113 https://doi.org/10.1021/pr100219y. https://doi.org/10.1371/journal.ppat.1006689 https://doi.org/10.1016/j.molimm.2011.03.004. https://doi.org/10.1039/C7RA04493C

Figure

FIG 1 Porcine OTULIN expression was upregulated during PRRSV infection. (a) Heat map of ubiquitin-related differentially expressed genes made using onlinePRRSV (b and c) or SeV (c) at a multiplicity of infection (MOI) of 0.5
FIG 2 Contribution of PRRSV replication by OTULIN overexpression in 3D4/21 cells. (a and b) 3D4/21 cells were transfected withFlag-OTULIN or with empty vector or left untransfected
FIG 3 The enhancement of OTULIN on PRRSV is related to innate immunity. (a and c) 3D4/21 cells were transfected with OTULIN(b) and IFN-expression plasmid or with control plasmid; 12 h after transfection, cells were infected with PRRSV at an MOI of 0.5 and
FIG 4 OTULIN enhances the PRRSV deubiquitination effect. (a) 3D4/21 cells were cotransfected withHA-Ub, Flag-OTULIN or empty vector
+7

References

Related documents

important to the movement and different from end-point or goal variability. Using concepts derived from the work of Bernstein, we conducted studies using a continuous relative

When compared to those alternating between both types of stoves or those using traditional stoves only, those children who exclusively used Inkawasi cooking stoves showed

The broadband radiance and irradiance of the shortwave spectral range (0.3–2.8 µm) observed using a narrow-angle radiometer (EKO Instruments Co., Ltd., Japan; FOV of 5 ◦ ) and

Variables altered include the turbine isentropic efficiency, the boiler efficiency, the fuel higher heating value and the cost of energy: both natural gas and electricity.. If

Fish may consume froml - 6% of their body weight daily, depending on food quality, water temperature, and metabolic activity (growth, reproduction). Required feeding frequency

Keywords: concrete nonlinear fracture mechanics, quasi-brittle, structural size effect, nuclear structures, finite element theory, mesh sensitivity, crack band

Since the majority of students in this class have limited hardware knowledge, and since network- related hardware concepts are main components of the course content, Perkins’

power flow proportionality exists also with respect to the actual (coupled) mean total energy, actual mean kinetic energy, or actual mean potential energy.. A more detailed