Features of the adeno-associated virus origin involved in substrate recognition by the viral Rep protein.

(1)

Features of the

Adeno-Associated Virus Origin Involved in

Substrate

Recognition by the

Viral

Rep

Protein

RICHARD 0. SNYDER,'t DONG-SOO IM,1t TIEHUANI,1 XIAO XIAO,2 RICHARD J. SAMULSKI,2

AND NICHOLAS MUZYCZKAl*

Department of Microbiology, State University ofNew YorkatStony Brook MedicalSchool, Stony Brook New York11794-8621,1 andDepartmentofBiological Sciences,

University ofPittsburgh, Pittsburgh, Pennsylvania 152602

Received 13May 1993/Accepted 12 July 1993

We previously demonstrated that the adeno-associated virus (AAV) Rep68 and Rep78 proteins are able to nick the AAVorigin of DNAreplicationatthe terminal resolution site (trs)inanATP-dependentmanner.Using

fourtypes of modified ormutantsubstrates,we nowhaveinvestigated the substrate requirements of Rep68 in theirsendonuclease reaction. In thefirst kind of substrate, portions of the hairpinned AAV terminalrepeat weredeleted. Only deletions that retained virtually all of the small internal palindromes oftheAAVterminal repeat were active in the endonuclease reaction. This result confirmed previous genetic and biochemical evidencethat thesecondarystructureof theterminalrepeatwas animportant feature forsubstraterecognition. Inthe secondtypeofsubstrate, theirs was moved eight bases furtherawayfrom the end of thegenome.The

mutant wasnicked at a 50-fold-lower frequency relative to awild-type origin, and the nick occurred at the correcttrssequence despite its newposition. This finding indicated that theendonuclease reaction requireda specificsequenceattheirsinaddition tothecorrectsecondarystructure. It alsosuggested that the minimum

irsrecognition sequence extended threebasesfrom the cutsite in the3' direction.The thirdtypeof substrate harbored mismatched base pairs atthetrs. The mismatch substrates contained awild-type sequence onthe

strandnormallycutbutanincorrectsequence onthecomplementarystrand.Allof the mismatchmutantswere capable of being nicked in thepresenceofATP. However, therewassubstantial variationin the level of activity,

suggestingthat the sequence on the opposite strand may also be recognized duringnicking. Analysisofthe mismatch mutants also suggested that a single-stranded irs was a viable substrate for the enzyme. This interpretation was confirmed by analysis ofthe fourth type of substrate tested, which contained a

single-strandedirs. This substrate was alsocleaved efficientlyby the enzymeprovided thatthe correctstrandwas

presentinthesubstrate. Inaddition, thesingle-stranded substrate nolonger requiredATPas acofactor for

nicking. Finally, all of the substrates withmutanttrssbound the Rep protein asefficientlyasthewild-typedid. This finding indicated that thesequence atthe cutsitewas notinvolved in recognition of the terminalrepeat

forspecificbinding by theenzyme.Weconcluded that substrate recognition by the AAVRep protein involves at least two and possibly as many as fourfeatures of the AAV terminal repeat. First, both thesecondary structureelement of the terminalrepeatandaspecificsequenceatthetrsarerequiredfor cutting. Inaddition, theenzymemayrecognizethepolarityofthetwostrandsatthecutsite, oritmayrecognizeanothersequence elementwithinthestemof thehairpin that is required forcorrectbindingtothe terminalrepeat.Finally,our studiesof the ATPrequirement suggest thatasingle-strandedtrsisanintermediate inthe nuclease reaction and that ATPismostlikely requiredtomelt the trspriortocutting.

A key step during adeno-associated virus (AAV) DNA

replication is the resolution of the AAV terminal repeats

(TRs).

Duringthis step,alinearduplexAAV DNAmolecule

which has an end in the covalently closed, hairpinned

configuration

is convertedto anopen duplexend(2, 10, 18,

19).

In

18).

This trs endonuclease reaction (Fig. 1B) can be

cata-lyzed

by either of two related, virus-encoded enzymes,

Rep78

and Rep68, and can be assayed in vitro by using

labeled AAV DNA terminal sequences in the hairpinned

* Correspondingauthor.

t Present address:Departmentof Molecular Biology, Department of Molecular Biology and Genetics, Johns Hopkins University School ofMedicine, Baltimore, MD21205.

:: Presentaddress: Genetic EngineeringCenter, Korea Instituteof Science and Technology, Yusungku, Eoundong San 1, Daejeon, Korea 305-333.

configuration (7, 8). The products of the reactioninclude a substrate that has been cut at nucleotide 124 of the AAVTR (the trs) and contains a molecule of the Rep protein co-valently attached to the 5' end of the nick through atyrosine phosphate linkage (7, 17, 18). An unusual feature of the

reaction is that the trs endonuclease activity requires the presence of a hydrolyzable ATP cofactor (7, 8). The ATP requirement for the in vitro reaction is consistent with the phenotype of mutants in the ATP binding site of the enzyme. Such mutants are defective for AAV DNA replication in vivo and forendonuclease activity in vitro (5, 13, 14).

One of the questions about the trs endonuclease reaction that remained unclearwas how the enzyme recognized its substrate prior to cutting. Previous work by us and others suggested that the ability of the TR to form thecharacteristic T-shaped hairpin structure was essential. Berns and col-leagues (3, 4, 9, 16) were the first to show that the secondary structureof the TR was important for origin function in vivo by substituting a portion of one of the short palindromes that comprise the cross arm of the T-shaped hairpin with different

6096

on November 9, 2019 by guest

http://jvi.asm.org/

(2)

ADENO-ASSOCIATED VIRUS ORIGIN 6097

A

Xbal Xbal Xbal Xbal

NE DNA H=Y

Hpal Hpal

Xbal

t32P-ATP PNK

Xbal wt

Pvull Xbal

a 32P-dCTP /

RT

\- 32P-ATP

%

PNK

Gel PurifyStrands

Hpal

IJ ttrsXII1

Xbal

HpalA

B

[} ~~~NE

tstrs * substrate

|,Rep

* PDC

proteinaseK

phenol denature

1

4

PDC'

7+

[image:2.612.361.514.83.246.2]

~* 73

FIG. 1. (A) Production of NEwild-type andHpaIA XbaI sub-strates. NE DNAsmade from thewild-type (wt) psub20l(+) and mutantHpaIA plasmids were digestedwithXbaI, 5' labeled with

[y-32P]ATP

andpolynucleotidekinase(PNK), andpurifiedon a6%

sequencing gel.Black boxes represent theHpaIlinker inserted into theBallsitesofwild-typepsub2ol(+),which moves the trssite8bp further away from thecovalently closed endof the XbaIsubstratein the mutant. Asterisks denote locations of the 32P label. (B) trs endonuclease reaction. In the reaction, Rep protein binds to a hairpinned terminal XbaI fragment and cuts atnucleotide 124 on onlyoneof the twostrands ofthe trs. As a result, Repbecomes covalentlyattached tothe5' endof the nicktoproducea protein-DNAcomplex(PDC). Subsequent treatmentof the reaction prod-uctswithproteinase Kand denaturingagents producestwo prod-ucts, a 73-base fragment (73) and the reciprocal fragment still attachedto ashortpeptide(PDC').

Xbal

trs- strand

3'label

Xbal

trs- strand

5' label

trs

trs+strand

5' label

FIG. 2. Substrates with single-stranded trs's. Plasmid psub201 (+)wasdigested with PvuII and XbaI, and the terminal fragments were purified from a nondenaturing 4% polyacrylamide gel. The strandswere either 3' labeledwith [a-32P]dCTP and reverse

tran-scriptase (RT) or 5' labeled with [_y-32P]ATP and polynucleotide kinase (PNK). Following labeling, each strandwasisolated froma sequencing gel. Asterisksdenotelocations of the32plabel.trs'and trs- indicate whether the substrate contains the strand which is normally cut by Rep or the complementary strand. Because psub20l(+) is missingthe first 15bpof the AAVTR,the DNA in the immediatevicinityof thetrs(oritscomplement)issinglestranded for14 basestothe left of the site(i.e.,toward thecovalentlyclosed end of thesubstrate) and for the remainder of the substratetothe right of thetis.

thetrs,(iii)thestrandpolarityatthetrs,and(iv)asequence

in the long stem of the T-shaped hairpin. In addition, we have found that substratescontaining a single-stranded trs no longer requirethepresenceof ATP fortrsendonuclease activity. This finding suggests that a single-stranded sub-stratemaybeanintermediate in the endonuclease reaction.

MATERIALSAND METHODS sequences. Sequences which maintained the secondary

structure retained origin activity. They suggested that the actual sequences of the twoshortinternalpalindromes that formed the cross arm of the T were not critical for origin function, but rather the abilitytoform thecorrectsecondary structure was.

Gel shift andDNAprotection studies supportedthe idea thatsecondarystructure wasimportant (1, 6).These studies demonstrated that only terminal sequences in the hairpin configurationwereabletobindRepproteininvitro despite the fact that both thehairpin andresolved forms of the TR contained essentially the sameDNA sequences. However, in vitro binding studies also suggested that the T-shaped secondarystructure was nottheonlyfeaturerecognized by the Rep protein. A hairpin substrate which had a similar secondarystructurebut adifferent sequencethroughoutthe entire T-shaped palindromewasunabletobindtotheAAV Repproteins(6).

Inthis study,we have usedmodified substrates in the in vitrogel shift andtrs endonuclease assaystoidentify some of the features of the TR that are required for substrate recognition. Coupled withpreviousstudies,ourexperiments suggestthat there are atleast twoandpossibly asmanyas four features of theTRthat may be necessaryfor substrate

recognition: (i)thesecondary structure, (ii)the sequenceat

Plasmids and NE substrate DNA. Plasmid psub2Ol(+)

contains a wild-type AAV terminal repeat and has been

described

previously

(15);

the

particular

isolate used was

SSV16. Plasmid

HpaIA

wasmadebyinsertingan8-bp HpaI

linkeratbothBalI sites (positions 121 and 4559 of the AAV

sequences) of psub20l(+) and will be described in detail elsewhere. The plasmids were prepared by using standard

procedures (11). NE substratewas madeas described pre-viously (18).

Wild-type and HpalAmutant origin substrates. To make the HpaIA and wild-type terminal XbaI hairpin substrates

(Fig. 1A), the respectiveNE substrateswere digestedwith

XbaI, treated with calfintestinal alkalinephosphatase, and 5' end labeled with polynucleotide kinase and

[-y-32P]ATP

(4,500 Ci/mmol; ICN). The terminal fragments were then

purified by electrophoresis on a 6% sequencing gel. Both terminalXbaIfragments inNE DNA are identical.

Single-strandedterminal substrates. Togenerate the

single-stranded substrates,plasmid

psub2Ol(+)

was

digested

with XbaI andPvuII and the terminal fragments were isolated from a nondenaturing 4%

polyacrylamide

gel. The

PvuII-XbaIfragments (Fig. 2)werethen labeledat either their 3' ends with Moloney murine leukemia virus reverse tran-scriptase (Bethesda Research

Laboratories)

and

[a-32P]

dCTP (3,000 Ci/mmol; ICN) or their 5' ends

by

treatment VOL.67, 1993

on November 9, 2019 by guest

http://jvi.asm.org/

[image:2.612.101.252.88.314.2]

(3)

A

trs+(wt)

strand i

trs Anneal

Ligate

1,Xt^lDr{

*

( ei Ft

Mismatch

substrate A

t<

J < ~~~~trs ;unty

B

AGAGGGAGTGGCCGCTGCATCTCCATCACTAGGGGTTCCTTGTAG

AGAGGGAGTGGCCCCCTCCATCACTAGGGGTTCCTTGTAG

AGAGGGAGTGGGGTTGACCATCACTAGGGGTTCCTTGTAG

-TCTCCCTCACCGGTTGAGGTAGTGATCCCCAAGGAACATC trs

FIG. 3. Synthesis and structureofmismatc Plasmid psub2Ol(+) was digested with Pvu] labeled, andthe palindromic terminal

trs+

wild-purified from a sequencing gel. Oligonucleotid

plementarytothe

trs+

strandof thePvuII-Xba

weresynthesized. Each oligonucleotidewas5' the

trs+

strand,annealed, and ligated.Asterisk 5' ends. The ligated productswerethenisolate gel. The position of the trs is indicated. (E oligonucleotides in each of the mismatchsubst is the sequence of the

trs+

wild-type (wt) ;

oligonucleotideswere annealed and ligated. mismatched base pairs in the oligonucleotide diagramof themutantand wild-typesubstrates trs. Arrows indicate the strand which conta substrate. Substrate 998 containsatwo-basen strand and a seven-base insertion/substitutio

strand. Substrate 1000 contains a two-base strands. Substrate 1013 contains a six-base r

Substrate 1012containsthe wild-type sequenci

withcalfintestinal alkaline phosphatasea: otide kinase and

[_y-32P]ATP

(4,500 Ci/m

were separated on a 6% sequencing ge] difference in the size due to the four-bas XbaI site and eluted from gel slices.

Mismatch trs substrates. A series of which harbor mismatched base pairs at

structed (Fig. 3). Plasmid psub2ol(+) N

XbaI and PvuII, and the terminal fragm( from a nondenaturing 4% polyacrylamid XbaI fragmentswerethentreated withcall

phosphatase and 5' labeled with polynuc [y-32P]ATP (4,500 Ci/mmol). The strands

a6%sequencing gel, and the trs-containin isolated. Oligonucleotides whichwerecon tis+ strand of the PvuII-XbaI termina chemically synthesized (Applied Biosystc nucleotides contained sequences which

sizes of mismatches at the trs when ani strands(Fig. 3B). The oligonucleotidesw polynucleotidekinase and [-y-32P]ATP (4,; 5'-labeled

trs+

strands were added to 10(

5'-labeled oligonucleotides in thepresenc

20 mMTris (pH 7.5), and 2mM MgCl2 ir

125

,ul.

The mixtures were heated to 100°C for 10 min, quickly chilledonice, incubated for2hat37°C, and ethanol precipitated. T4 DNAligase (400U; New EnglandBiolabs) was added to the annealed mixtures (totalvolumeof 40 LI), and the mixtures were incubated at 37°C for 1.5 h. The ligation mixtures were ethanolprecipitatedandseparated on a6% sequencinggel. The ligated products wereelutedfrom thegel.

Isolation of Rep68 (I) fraction. The purified Rep fraction used in these studies was Rep68 (I). It was identical to the

Oligo

fraction described previously (7). Rep68

(I)

was purified

998 from a 0.2 M NaClextract of HeLa cell nuclei infected with adenovirus type 2 and AAV bychromatography on phenyl-1000 Sepharose,

DEAE-cellulose,

and single-stranded

DNA-cel-1013 ~

lulose,

and itwas

essentially

free of

contaminating

endonu-1013 clease, exonuclease, and phosphatase activities.

1012

2(wt) Protein-DNA binding assay. Gel shift assays were

per-t'

formedessentially as described previously (6). The reaction

trs+(wt) trs mixtures

contained,

in a volume of 20

,ul,

25 mM

N-2-strand hydroxyethylpiperazine-N'-2-ethanesulfonic acid (HEPES)-KOH (pH 7.5), 10 mM MgCl2, 1 mM dithiothreitol, 2% ,h trs substrates. (A) glycerol, 0.25

,ug

of bovine serum albumin (BSA), 50 mM

II and XbaI and S NaCl, 0.01% Nonidet P-40, 1,ugof poly(dI)

poly(dC),

2 to -type (wt) strand was 3

pAl

of Rep68(I), and approximately0.1ngofthe 2P-labeled les whichwere com- DNA substrate. The reaction mixtures were incubated at

il

terminalfragments roomtemperature for 20min and thenwereloaded onto4% labeled,mixed with

sindicate32P-labeled polyacrylamide gels (37.5:1 acrylamide/bisacrylamide d from a sequencing

weight ratio)

containing 0.5 x Tris-borate-EDTA (pH 7.6). I) Sequences of the Gels were

electrophoresed

in the same 0.5x Tris-borate-trates. At the bottom EDTA buffer at room temperature for about 2 h at 20 mA. strand to which the They were then transferred to Whatman 3MMpaper, dried, Jnderlining indicates and autoradiographed.

e On the right is a trs endonuclease assay. The standard trs endonuclease

ins

the trs in each assay wasperformed essentially as described previously (7).

nismatch

onthetrs+ Thereaction mixture contained, in a volumeof 20,u,25 mM

n loop on the trs- HEPES-KOH (pH 7.5), 5 mM MgCl2, 1 mM dithiothreitol, mismatch on both 0.4 mM ATP, 0.2,ug ofBSA, 1 ,ug of poly(dI) poly(dC), mismatch at the trs. radiolabeled NE XbaI substrate, and S U ofRep68 (I). The e on both strands. reaction began with the additionofMgCl2 and was incubated for 60min at37°C. Sodium dodecyl sulfate(SDS) wasadded to the completed reactions to a finalconcentration of 1%; the reactions were boiled for 5 min and then loaded onto a 6%

nd then polynucle- nondenaturing polyacrylamide gel. Alternatively, the reac-mol). The strands tions were treated with proteinase K, phenol extracted, and I by virtue of the ethanol precipitated. These reaction products were then

,e

overhang of the dissolved in formamideloading dye,boiled, and loadedonto an 8% acrylamide DNA sequencing gel containing 50% mutant substrates (wt/vol)urea (12).Electrophoresiswas performed at 65°Cto the trs was con- avoid the formation ofsecondary structure within theAAV was digested with TRs asdescribed previously(10). Theamount of radioactiv-ents were isolated ity in product bands was measuredwith an Ambis gas flow le gel. The Pvull- counter. To estimate therelativeefficiency of HpaIA mutant f intestinal alkaline nicking compared with that of the wild-type NE XbaI

leotide kinase and substrate, the percentage of total substrate nicked was were separated on calculated by counting the radioactivity in the product

vg

(trs+)

strand was 73-base fragment and the total radioactivity in the starting

nplementary to the substrate. In the case of the mismatch substrates, direct 1lfragments were comparison of theradioactivity in either of the two product ems). These oligo- bands (the 73-base fragment and the 149- or 154-base frag-produced different ment) was sufficient fordetermining therelative efficiency of nealed to the trs+ the reaction with different mismatch substrates. This was ere 5' labeled with because the same preparation of5'-labeled trs+ strand was 500 Ci/mmol). The used for the synthesis of all of the mismatch substrates. )ng of each of the Thus, the specific activities of the 5' label in the mismatch e of 50 mM NaCl, substrates werethesame, and the73-base products contain-a totcontain-al volume of ing this label could be directly compared. In addition,

* A Oligo

on November 9, 2019 by guest

http://jvi.asm.org/

[image:3.612.62.300.59.283.2]

(4)

A BssH cie Sma UNC

7

If

Sr-na

_3

nBssH _Sm UNC

LA3

CEssHJce Srra U BND

l;r

UN_

FIG. 4. Secondary structure requirement for trs endonuclease activity. The wild-type 5'-labeled NEXbaI fragmnent (B) was di-gested with SmaI, DdeI,orBssHIItoproduce substrates thatwere

missing various portions of theTR.Allof the substrates contained

awild-typetrs atthenormal position andwerelabeledatthesame 5' end (asterisk). (A) Products of a trs endonuclease reaction in which thedigested substrateswereincubated in thepresence(+)or

absence (-) of Rep68 and separated on a6% nondenaturing

poly-acrylamide gel. The position of the 73-baseproduct is indicated on

the right. (C) Results ofaproteinDNA binding (gel shift)assayin

which the bound products (BND) were separated from starting

substrate (UNB) on a 4%polyacrylamide gel after the substrates

wereincubated in thepresence(+)orabsence (-) of Rep68. UNC

reactions contained thestarting NEXbaI fragment that hadnotbeen cutwithrestrictionenzymes.

[-y-32P]ATP of thesamespecificactivitywasusedfor label-ing allof theoligonucleotides containingmutant complemen-tary strands. Although in principle these oligonucleotides might have been labeled tovarious extents, only molecules inwhich the oligonucleotides had been successfullyligated to the trs+ strand (and therefore contained a phosphate

group attheir 5' ends)were isolatedfrom gels andused as

substrates in the endonuclease reaction. Thus, the specific activities of the label at the internal position were also

identical in all of the mismatchsubstrates.

RESULTS

Effect ofsecondarystructure on trs endonuclease activity. To determine what portions of the AAV terminal hairpin were essential fortrs endonuclease activity, we performed theexperiment illustrated inFig. 4. The wild-type terminal XbaI hairpin fragment was labeled at its 5' end and then

digested witha series of restriction enzymes (SmaI, DdeI, andBssHII) which removed portionsof the terminal hairpin

but left the sequence in the immediate vicinity of the trs

intact(Fig. 4B).The substrate that hadbeencutwith DdeI, forexample,wasmissingthecross armof theTbut retained

most of the sequence in the long stem of the original

T-shaped XbaI fragment. Successful cleavage ofanyof the

substrates byRep68 wouldproduce a73-base fragment.

We found that only the uncut wild-type starting substrate and the substrate that had been cut with SmaI retained trs endonuclease activity (Fig. 4A). Gel shift binding studies performed with the modified hairpins (Fig. 4C) confirmed our previous results (6) and demonstrated that only the uncut andSmaI-cut hairpins could bind Rep68 at detectable levels. We concluded that virtually all of the terminal hairpin was necessary for substrate binding and trs endonuclease activ-ity. The results suggested that the sequence in the immediate vicinity of thetrs itself was not sufficient for trs endonucle-ase activity and were consistent with the idea that the secondary structure of the substrate played a role in sub-straterecognition.

Synthesis of mutant trs substrates. We next focused on the trs and examined whether the enzyme required a specific sequence or secondary structure at the trs for nicking to occur. Three types of mutant substrates were made. Each type contained alterations of the sequences or structure in the immediate vicinity of the trs but did not change the sequence or secondary structure of the rest of the hairpin.

(i)Mutant trs substrate. The first type of mutant substrate, HpaIA, was constructed by inserting an 8-bp HpaI linker into the BalI site 3 bp away from the trs at both ends of the AAV genome in plasmidpsub2Ol(+)(Fig. 1A). The result of thisinsertion was that the normal 6 bp immediately flanking thewild-type cut site were moved 8 bp further away from the covalently closed end of the molecule and a new sequence (theHpaI linker) was inserted at the normal cutting position. The question addressed by analysis of the HpaIA mutant was whether the enzyme required a specific sequence at the trs orwhether the enzyme would cut any sequence provided that it was placed at thecorrect distance from the covalently closed end of the molecule. Wild-type and HpaIA mutant NEDNAs were synthesized as before from their respective plasmids, and the terminal XbaI hairpin fragments were isolated and labeled at their 5' ends (Fig. 1A). The trs's in both the wild-type and mutant NE XbaI substrates were fully duplex.

(ii) Single-stranded trs substrates. Single-stranded trs sub-strates were produced by digesting psub2Ol(+) with PvuII and XbaI and then isolating the resulting terminal fragments from a nondenaturing polyacrylamide gel. The terminal fragments were either 3' or 5' labeled, and each of the strands was isolated from a sequencing gel (Fig. 2) to generate the trs+ and trs-complementary (trs-) strand sub-strates. Because of the manner in which psub2Ol(+) was constructed, the first 15 bases of the AAV TR were missing

Q5).

Thus, the PvuII-XbaI terminal hairpin fragments gen-erated frompsub2Ol(+) contained a trs that was flanked by single-stranded DNA for at least 14 bases on both sides of the cut site (Fig. 2; see also bottom of Fig. 3B and Fig. 9). The bulk of the hairpin substrate, however, contained the normal T-shaped secondary structure. The objective of analysis of the single-stranded substrates was to determine whether a duplex trs was essential for trs endonuclease activity.

(iii)Mismatchedtirssubstrates. The third type of substrate that we synthesized contained mismatched bases in the vicinity of the trs. To make these substrates, we annealed oligonucleotides that contained the trs- strand sequence to thePvuII-XbaI wild-type trs+ strand (Fig. 3A). Each trs-oligonucleotide contained a mutation that formed a mis-match bubble or substitution loop at the trs when it was ligated to the trs+ wild-type strand (Fig. 3B). All of the substrates, however, contained the correct trs sequence at thecorrect location on the strand that is normally cut by the VOL. 67,1993

- AL

on November 9, 2019 by guest

http://jvi.asm.org/

[image:4.612.120.243.80.312.2]

(5)

N'E

l

CacK

C

rrisnaAcDi

cccc~ ~ ~~c

°14JC) fr1

CC Cc O

°c OC O U]

I -r

C' _- CI

'XM CD -0)CD C;~,"-) -;

5) r- -V,

Su-3BND ""

Vie;I .

._5

A B C

FIG. 5. Rep68 binding of the mutant substrates. (A) Protein-DNAbinding assays werecarriedoutwith thewild-type(wt) and HpaIAmutant NEXbaI substrates, and the productswere sepa-rated on a4%polyacrylamide gel.Thecontrollane in which no Rep wasaddedcontains HpaIA substrate (HpaIA, -Rep). (B) Gel shift assays inwhich mutant andwild-type substrates were used. The control lane that did not receive Rep68 contains substrate 1000 (1000, -Rep). (C) Protein-DNA binding assaysusing trs+ or trs-strands of the PvuII-XbaIfragmentofpsub20l(+) labeledattheir3' or5' ends. Unbound(UNB) substrates andbound(BND) products areindicatedonthe left.

enzyme (Fig. 3B). Substrate 1012 was wild type on both strands. Substrate 1000 contained a simple two-base mis-match bubble at the position normally cut by the Rep protein. Substrate 998 contained a two-base mismatch rela-tiveto the trs+ strand and a seven-base

insertion/substitu-tion loop symmetricallyplaced on thetrs- strand. Finally, substrate 1013wasmismatched over six bases centered on thetrs.

Binding ofRep68 tomutant trs substrates. We mentioned earlier that in addition to the secondary structure of the terminalhairpin, theRepprotein appeared torequire some sequence element forrecognizing andbindingits substrate

(6).Todetermine whether theregionin thevicinityof thetrs

might contain a sequence that was important for Rep68 binding,wecomparedtheabilityof themutantsubstratesto bindRep68 bythegelshift assay(Fig. 5).Neither themutant HpaIA substrate nor the mismatch substrateswere

signifi-cantly different from comparable wild-type substrates in theirabilitytobind Rep68(Fig. 5AandB). Acharacteristic four- tofive-bandpatternwasproducedwhenboth kinds

6f

substrateswereused. Asimilar patternwas seenwhen the trs+ and trs- PvuIH-XbaI

single-stranded

substrates were used(Fig.5C).Thus,thedifferentstructuresof thetrsin the mismatch and single-stranded substrates or the different sequencein theHpaIAmutantdidnotaffectsignificantlythe

ability

ofRep68tobind these substrates. The results of these

experiments indicated that neither the sequence nor the structureof the DNA in thevicinity of thetrs wasimportant forRep68binding totheTR.

Comparisonofmutantandwild-typetrssequences.Nicking of thewild-typeAAVhairpin occurs ataunique site (nucle-otide 124). In principle, the enzyme might cut at this site because it is located a specific distance away from the

covalentlyclosed end of themoleculeorbecausethe enzyme recognizesaspecificsequenceatthis site that isrequired for

cutting.

To determine whether the trs sequence is essential for

73

[image:5.612.374.502.76.315.2]

_-A B

FIG. 6. trs endonuclease activity of mutant substrates. The mutantsubstrateswereincubated in thestandard trsendonuclease reaction (seeMaterials andMethods),andthe products were treated with proteinase K, extracted with phenol, and separated on 8% polyacrylamide sequencing gels.Inbothpanels, the sizes (inbases) of thefragmentsweredetermined by comparisonwith a G+Aladder generated chemically(12) from5'-labeledNEXbaI fragment (not shown). (B) trs endonuclease reactions using the XbaI terminal fragments ofNE substrates made frompsub2Ol(+)(wt [wild-type] lane) andHpaIAmutant(HpaIA lane) plasmids.ThestartingHpaIA NEsubstratewith noRep68 protein added is also shown (HpaIA, -Rep lane). The position of the 73-base product of the nicking reaction isindicated on the left.(B)trsendonuclease reactions using the mismatch substrates. The positions of the 73-base nicking product and the remaining portionof the nicked product(154 and 149) attachedto apeptidefrom AAV Rep68 (produced by proteinase Kdigestionof the reactionproducts)areindicated on the left. The starting 1000substrate also is shown (1000, -Rep). Sub, starting substrate.

endonuclease activity,wecompared theactivities of Rep68 in wild-type and mutant (HpaIA) XbaI terminal hairpin substrates obtained from NE DNA (Fig. 6A). Nicking of wild-type NEsubstrate produced the characteristic 73-base fragment. Incontrast, the newHpaIAlinker sequence that had been inserted at the normal trs position was not a substrate for the enzyme. Had it been a substrate for

nicking,wewould haveseen an81-base fragment (73 bases plus 8 bases of the linker) as the product band, and no 81-base fragment was detected (Fig. 6A). Instead, the en-zymepreferredtocut atthecorrectsequence(3'-GGT/TGA)

at its new position 8 bases further away to produce the 73-base fragment. The frequency of HpaIAnicking at the correctnickingsequencewas approximately1 to5% of the

wild-typesubstrate level. We concludedtwothingsfromthe HpaLAmutantexperiments. First, the Rep protein wouldnot cut the new sequence that had been placed at the correct distance from the cross arms of theT-shaped palindrome; thus, there was a specific sequence required for cutting.

Second, analysis of the HpaIA mutant suggested that the minimumrecognitionsequencefortrsendonucleaseactivity

extended at least three bases to the 3' side of the cut site

r_ f'

on November 9, 2019 by guest

http://jvi.asm.org/

[image:5.612.97.267.80.238.2]

(6)

(3'-GGT/TGA...

.). This was the sequence that has been

moved eight bases and was still recognized as a cut site, albeitat areduced level.

Effect ofstructureandcomplementary strand sequences at thetrs.To determine whetherthe secondarystructure atthe trs orthe sequence onthe strandoppositethe cutsite was

importantfornicking,weperformedtrsendonuclease assays

using the mismatch mutants (Fig. 6B). The mismatch sub-strates were labeled with32Pat twopositions, the 5' end of the substrate andaninternalposition 109 bases fromthetrs

(Fig. 3A). Because of this, the mismatch substrates were

expected to generate two labeled fragments (Fig. 6B), the 73-base fragment labeled at its 5' end and a reciprocal

fragment that was either 149 (substrates 1000, 1012, and

1013)or154(substrate 998)baseslong.Thelarger fragments (149 and 154 bases) had a slightly slower mobility than

expected from their nucleotide content because theywere attached to a peptide from the AAV Rep68 protein after

proteinaseKtreatmentof the reactionproducts (not shown;

Fig. 1B) (7, 18).

In

addition,

the two labeled

positions in the substrate did not have the same specific radioactivity,and thisaccountsfor thedisparityof thesignal

seen between the 73-base and

peptide-attached

products.

Minor bands thatwere common toall of the substrateswere alsoseenandwereoftenseeninthe absence ofRepprotein.

These bands mapped to the position of the label in the substrate or to the strand opposite the label. We believed thatthese minor bandswere the result ofbreakage due to radioactivedecay, andtheywere notinvestigated further.

Although all of the substrates were correctly nicked by Rep68 to produce a 73-base fragment, the wild-type

mole-cule, which contained a fully duplex trs, was the most efficient substrate

[Fig.

6B, lane 1012 (wt)]. Mutant 1000,

which containedatwo-base mismatchatthe trs,was signif-icantly reduced in nicking

efficiency

(15% of the wild type

level).

In contrast,mutant1013,which containedasix-base

mismatchatthetrs,was cutatnearlythesamefrequencyas wild typewas(80%). Finally,mutant998,which containeda

five-baseinsertion loop opposite the trs, cut at only 2% of

the

wild-type

level. The

efficiency

with which mutant 1013

was cut suggested that a duplex trs was not essential for endonuclease activity. The disparitybetween mutant 1013

(six unpaired bases)

and mutant 1000(two unpaired bases)

suggested that the sequence of the complementary strand

was,

nevertheless, important

for enzyme activity.

Rep68

activity

on single-strandedtrs's sites. Todetermine whetherRep68was

capable

of

nicking

a

single-stranded

trs,

we used the trs+ and the trs- strands of the PvuII-XbaI

terminal fragment of

psub201

as substrates

(Fig. 2).

As mentioned

earlier,

these substrateswere singlestranded in

the

vicinity

of thetrsforatleast 14 bases ineitherdirection

from thecutsite. Theproductswereanalyzedon a

sequenc-ing gel

and

compared

withthe

products

of the

wild-type

NE

XbaI substrate,which contained aduplextrs

(Fig. 7).

Like

the

duplex

NE

substrate,

the trs+ strand was nicked

effi-ciently

atthe correctsite to

produce

the 73-base

fragment.

Thus,asingle-strandedtrssequenceisanexcellent substrate for the enzyme. However, a newfragmentof 62 bases also was produced, at a higher frequency than the 73-base

fragment.

This 62-base fragmentwas the result ofaberrant

nicking11bases further away from thecovalently joinedend of the DNA. In

addition,

two minor

fragments (71

and 64

bases)

were consistentlyseen.

When the5'-labeledtrs-strandwastested for

nicking,

no

detectable

nicking

was seen atthe location of thetrs. Other

sites, however,

were nicked at a low

frequency

to

produce

'ig: ,-

-~~~s

-rlr,{

t

_rfc

12 __

119

Lu

[image:6.612.391.484.81.369.2]

-5-D-7

FIG. 7. Nicking of single-stranded substrates. The

single-stranded substrateswereincubatedin the standardti-sendonuclease reaction. Following the reaction, the products were treated with

proteinaseK,phenolextracted,andrun on an8%sequencing gel.A reactionusingthe NEXbaI terminalfragmentasthe substratewas included as a control

[NE

(wt

{wild-type}

duplex)].

The sizes (in bases)of the

fragmnents

generated

from NE andtrs'substratesare indicated on the right; sizes ofproducts fromtrs- substrates are indicated onthe left. Sub, starting substrate. Fragment sizeswere determined by comparison against a

sequencing

ladder generated

from thestartingNEXbaI substratebychemicalcleavage(17) (not shown).

bands of

121, 119,

and 100 bases.

Nicking

atthese

positions

wasconfirmed

by

using

the3'-labeledtrs- strand

substrate,

which

produced

the

reciprocal

fragmnents

of

57, 59,

and78

bases,

respectively.

Other

fragments

that may be visible in

Fig.

7werenot

consistently

seen.

ATP

requirement

for mutant substrates. As mentioned

earlier,

theti-sendonuclease

activity

of the

Rep

protein

was

foundtobe unusual in thatit

required

ATPas acofactor. We

have

suggested

that one

explanation

for this

requirement

might

be that theti-s needsto

undergo

local

melting

by

the

ATP-dependent

DNAhelicase

activity

of the enzymebefore it becomesasubstratefor the endonuclease

(7).

Thefact that

a

single-stranded

ti-s was a substrate for the enzyme

sup-ported

this idea. To determine whether

nicking

at a

single-stranded ti-s

required

ATP, ti-s endonuclease assays were

performed

in the presenceorabsence of ATP. After

nicking,

the

products

wereboiled and

analyzed

on a

nondenaturing

6%

polyacrylamide gel (Fig. 8A).

As

expected,

in the

ab-sence ofATP, no 73-base

product

was detected when the

duplex

NE substrate was used.

Also,

very little if any

nicking

was seen when the

HpaIA

mutant or trs- strand

substrate was used. In contrast, the ti-s' strand substrate

was

efficiently

cleavedto

produce

a mixture of the 73- and

VOL. 67,1993

on November 9, 2019 by guest

http://jvi.asm.org/

(7)

B

A TAT

-.,T- IE

C) fD::0 t

.;~~~~~~~~~~~~~7 ro -oir

=~ T T

cc

C:

CD

< secondary structure element

rmlistmlatch 2

.C:

C

r

SS

i

Co c -

-SI

:Sub

T T T

C-G C-G A-T G° C C oG G oC GoC G o C

Bo putative

binding singlestran

element4 K

ndedregion

o G CTC9GTGAGCGAGCGAGCGCGCALGAGGGAGTG*CCAAC*CATCACT.GGGGTTCCT.. C-G

G oC GoC G o C C-G

C o G

GCo G°C

A A

CGGAqTCACTCGCTCGCTCGCGCGTqrCTCCCTCACqGGTTGA*GTAGTGATCCCCAAGGA...

A~~~~~~~~~~~~

A Do

minimumtrssequence

A ...GTGGGGTTAACc

AC¶4CCATCACTA

...3' HpalA °G°G ...&

I...CACCCCA ATTGG TrI/iGGTAGfTGAsT...5'

_

A"

? 34 I/8011

7'

.;;I.1;

Rf p

FIG. 8. ATPdependence of thetrs endonuclease reaction. (A) Nicking of single-stranded substratesin thepresenceorabsenceof ATP. The products oftirs endonuclease reactions containing 5'-labeled duplex NE XbaI substrates (NE) with wild-type (wt) or

mutant (HpaIA) tirs's were compared with single-stranded

sub-strates(ss) containingthestrand that isnormallycut (trs')orthe complementarystrand (trs-). Thereactionswereperformedin the presence(lanes1to5)orabsence(lanes 7to11) ofATP.Following thereactions, SDSwasaddedtoall thesamples and theproducts wereboiledandseparatedon a 6%nondenaturingpolyacrylamide gel. Thepositionsof the starting substrates (Sub) and the73-base product (73) are indicated on the right. The NE HpaIA mutant

substratewascutwithHpaI, boiled,andloaded in lane 6 of thegel

toprovideamarkerfragmentof 79 bases.(B) RequirementofATP for mismatchsubstrates. Standard trs endonuclease reactionswere performedinthe absence ofATP, usingthe mismatch substratesor the 5'-labeledtrs+single-strandedsubstrate.Followingthereaction, SDSwas added to allsamples and the productswereboiled and loadedontoa4%nondenaturingpolyacxylamide gel.Thepositions of the starting substrate (Sub) and the 73- and 62-base nicking productsareindicatedontheright.The firstand last lanes contain the indicatedstarting substrates,whichweretreated withRep.

62-baseproductsthatwerepoorlyresolvedonthisgel.Inthe

presence ofATP, the level ofproduct generated from the tis+ strandsubstrate increased significantly andtheduplex NE DNA became an efficient substrate (Fig. 8A). As ex-pected,the trs-strand substrate and theHpaIAmutantwere

poorsubstrateseveninthepresenceofATP. Theseresults demonstrated that substrates which contain a single-stranded tis site no longer require the presence of ATP. Finally, because the mismatch substrates also contained

someof thetis site in the form ofasingle-stranded bubble,

wetestedthese substrates for the ATPrequirementaswell. In contrast to the tis+ strand substrate, none of the mis-match substrateswere cleaved in the absenceof ATP(Fig. 8B).

DISCUSSION

Thesecondarystructureelement. Itseemsclear thatoneof the featuresof the AAV TRs that is essential forrecognition bytheRepprotein is thesecondarystructure element(Fig. 9). This element consists of the two small internal palin-dromes, CC' andBB', thatgive the AAVhairpin its char-acteristic T-shaped structure. Removal of the two small internal palindromes of the TR (Fig. 9 and Fig. 4, DdeI substrate) producesasubstratethat isneithercutnorbound bytheenzymedespitethefact that nochangesoccurinthe vicinity ofthe trs. This result confirms earlier workwhich

linker

FIG. 9. Features of the AAVterminal hairpin. Thesequenceof thewild-type AAVTRisshown in the hairpinnedconfigurationasit exists in the NE XbaI substrate. Boldface letters indicate bases protected from DNaseIdigestion (6) by purified Repprotein. Below that isthe relevantportion of the HpaIAmutantsequence contain-ing the 8-bplinkerinsertion. The relativepositionsof theminimum

trs sequenceswhich are cut in the wild-type and HpaIAmutant

substratesareindicatedby boxes. Thedotted-line portion of the box indicatesthat theextentof the recognitionsequencetotheright is unknown.The DNaseIprotectionpatternonthemutantis alsonot

known.The smalltriangles indicatethepositionsof aberrantcutting inthe single-stranded substrates. The bottom triangle is the position of the cut that produces the 62-base fragment. The top three triangles show (from left toright) the cuts thatproduce the 100-, 119-, and 121-base fragments. Also shown is the region of the TR that issinglestranded inthetrs'single-stranded substrate. At the left isthesecondarystructure elementwhich consists oftwosmall internalpalindromes (B and C)embedded in the larger palindrome (A)thatforms thestemof theT-shapedstructure.Removal of the B and Cpalindromesabolishesnickingatthetrsandbindingbythe

enzyme.Two orientationsof the B andCpalindromes, flip and flop, exist inwild-typeDNA. TheNEhairpin substrateshown is in the flip orientation and isconverted to theflop orientationwhen it is resolved. In the opposite orientation, the B and C palindromes of the substratewould be reversed, but nochanges would occurin the relative positions or the polarity of the A and D sequences. A putative binding element in the stem that may be required for specific Rep bindingtothe TR is alsoindicated.

demonstrated that the Rep protein binds the AAV TR

sequenceefficiently only if it is in thehairpin configuration (1, 6).Inaddition,ourresultsareconsistent with the work of Bernsandcolleagues (3, 4, 9),who haveshown that invivo, changesinthesequence ofoneofthe internal palindromes (CC'; Fig. 9) did not significantly affect origin function provided that the new sequencecould form approximately thesamesecondarystructure.TheSmaI-digestedNE XbaI substrate(Fig. 4)containsaCC' palindromewhichretains 5 bp of the CC' stem (Fig. 9) and isnearly as active as the wild-type substrate in the trs endonuclease assay. This finding is consistent with earlier work (4, 16) which

sug-gested that a C palindrome with a 5- to 7-bp stem was probablythe minimumstructure requiredfor in vivoDNA replication. In contrast,we and others have shown previ-ously (4, 16)thatadeletion of thesequencebetween thetwo SmaI sitesreplicates poorlyin vivo. This is because unlike theSmaI-digested NE substrate used here, the SmaI dele-tionwould form atbest3bpof theCC' palindromestemin vivo(the remaining2bp beingusedtoformasingle-stranded loop),anda3-bpstem isapparentlynotsufficienttoforma stableT-shapedstructure.Thus,thein vitro behavior of the trs endonuclease reaction provides a plausiblebiochemical

.3'

5'

ol

on November 9, 2019 by guest

http://jvi.asm.org/

[image:7.612.64.299.76.244.2] [image:7.612.319.555.76.227.2]

(8)

explanation of the in vivo effect of mutant TRs on the

replication of linear AAV DNA molecules. It should be mentioned, however, that Hong et al. (5a) have recently shown thatanAAVplasmid containing a deletion of the first 55bpof the TR iscapable of replicatingas acircular plasmid in vitro. The significance of this observation for the work described here isnotclear.

A specificsequencerequirement atthetrs. The results for theHpaImutant clearlydemonstrate that there is a specific sequence at the trs that is required for nicking. The HpaI linker (Fig. 9) that was substituted for the wild-type se-quenceis apoor substrate fornicking (Fig. 6); instead, the enzyme prefers to cut the wild-type sequence at its new

position 8 bp further away from the end of the molecule.

Thus, the position of the cut made by the nuclease isnot

determined solely by itsposition withrespecttothe end of the molecule. Results for theHpaImutant also suggest that the minimum trs recognition sequence 3' of the cut site is

3'-GGT/T

(Fig. 9).Theextentof therecognitionsequence5'

ofthecutsite couldnotbe determinedfromanalysisof this mutant. Our reason forcalling thisa minimum recognition sequence is based on the fact that this sequencewas less

efficiently cut in its new position in the HpaIA mutant. However, it is notclearwhy the wild-type sequence in the HpaIA mutant was cut poorly at its new position. One

possibilityis that additional bases 3' of theGGT/Tsequence are necessary for efficient endonuclease activity. Another

possibilityis that therecognitionsequenceis,infact, simpler

than GGT/T, but the 8-bplinker insertion placesthet-s on the wrong face of thehelix. In the samevein,we also have not eliminated the possibility that both a specific location andaspecificsequencearerequiredfor thetrs. Clearly,the

analysis of additional mutantswillbe necessaryto resolve these questions. Finally, we would expect AAV genomes

carryingthe HpaIAmutantorigin tobe defective for DNA

replication invivo. This assumption has been shown to be correct, and theevidence will be described elsewhere(20).

Since only one of the two strands at the

tis

is cut, we examined whether the sequenceontheopposite strandwas also important for substrate recognition. Thiswas done by constructingmismatchmutantsinwhich the sequenceonthe strandwhich isnormallycutwaswild type but the sequence on the opposite strand was changed. As a result, each of these substrates also containedamismatch bubble

symmet-rically placedat thecutsite. One of thesesubstrates, 1013,

wascut atnearly thesame frequencyasthe wild typewas

(Fig.3 and6).Thisfinding suggestedthatadouble-stranded trsisnotessential for endonucleaseactivity. However,two other mismatch substrates, one of which contained the smallest mismatch bubble (2 bp),were bothcut much less

efficientlythan the wild typewas.Thisfinding suggestedthat the sequence on the strand complementary to the cut site also was specifically recognized by the enzyme and,

per-haps, participatedin the reaction.

Single-stranded trs's. Our results with the

single-stranded

substrates confirmedthat a

non-base-paired

cut sitecan be an efficientsubstrate for theendonuclease activity. In

addi-tion, several other points emerged. First, the frequencyof

cuttingat thewild-type location of thetrs' single-stranded

substrate was equal to or greater than the frequency at a wild-typedouble-strandedtrs. Thisfinding suggestedthata

single-stranded trs might be, in fact, an intermediate in the endonuclease reaction andimmediately suggestedapossible explanation for the ATP dependence of the endonuclease reaction.PerhapstheATP-dependentDNAhelicase

activity

of the Repprotein was required to unwindthe trs

prior

to

nicking. The fact that ATP was no longer required for

nicking the trs+ substrate provided strong support for the idea thatasingle-stranded cutsite isan intermediate in the reaction. Finally, the fact that substrate 1013 (which con-taineda6-basesingle-stranded regionatthecutsite) contin-ued to require ATP suggested that the putative nicking

intermediatemustconsist ofasingle-strandedregion atthe trs site that is between 6 and 14 bases long.

Another observation made with the trs+ single-stranded

substratewasthata newpositionthatwasfurther away from the covalently closed end of the molecule actually was

preferredfornicking andproduced a62-base product(Fig. 9). Thesignificanceof this observationwas not clearto us.

One

possibility

wasthat the

recognition

sequencefor

cutting

may be simple and was shared by the 62-base site. In a double-stranded substrate, the 62-base sequence normally mightnotfind its way into the active site of the enzyme. The

flexibility

of the single-stranded substrate, however,would

allow the 62-base fragment sequence to be bound by the active siteof the nuclease.

The third issue raised by analysis of the single-stranded

substrateswas thequestionof strand polarity. Weshowed

previously that predominantly only the correct strand is nicked in double-stranded substrates (7,

18).

When we

compared single-stranded substrates, the trs+ strand was

still a much better substrate than the trs- strand was.

Nevertheless,itwaspossibletodetectseveral aberrantcuts on the trs- strand, suggesting that the ability to recognize

strand polarity is relaxed on single-stranded substrates.

Conceivably, the

flexibility

of the single-stranded

region

in thetrs-substrates would allow ittoloopbackinto the active site in the correct strand orientation, while in duplex sub-stratesthis wouldnotbepossible. Regardlessof the

expla-nation, the fact that we detected significant cutting on the wrong strand under certain substrate conditions suggested

thatthere isnormallyamechanism forexcludingrecognition

sequences on the wrong strand and posed the

question

of how the enzyme determines which strand to cut. One

possibility was that the Rep protein has a mechanism for

recognizing directly the polarity of the strands at the trs. Anotherpossibilitywasthat there may be another

recogni-tion element in theTRinadditiontothe

secondary

structure element and thetrssequence.

Evidencefor an additional recognitionelement in the TR. There is reason to suggest that there may be another sequencein theTRrequiredfor

specific binding

of theRep protein. The secondary structure of the terminal

hairpin

is

symmetric,yet the DNase I anddimethyl sulfate

protection

patternsofRepproteinboundtothe TRare

asymmetric

(1,

6) (Fig. 9). Theinternalpalindromethat is closertothecut

site

(CC'

in Fig.

9)

is less protected than the one further away. Furthermore, the

asymmetric protection

pattern

re-mains the same with respect to the trs regardless of the orientation(fliporflop)of thetwosmallpalindromeswithin the secondarystructure element

(1, 6).

The B and C

palin-dromeschange their relative

positions

withrespecttothecut

site after each round ofDNAreplication,yettheprotection patternand the strand thatiscutremain thesame.Thus,the

secondary structureelementis necessary for

binding

but is notsufficient fordirecting asymmetric

binding. Presumably,

the information

required

for

asymmetric

binding

is in the

stem of the hairpin

(Fig.

9, A and D

sequences)

because these sequences remain constant in both the

flip

and

flop

orientations. One reasonwhy

asymmetric

binding might

be necessaryistoplacethe active site ofthe enzyme in the

right

position forcuttingthecorrectstrandat thetrs. VOL. 67,1993

on November 9, 2019 by guest

http://jvi.asm.org/

(9)

Asymmetric binding could be accomplished solely by sensing the polarity of the strands within the stem of the hairpin. If this is true, then the Rep protein should be capable of binding related parvovirus TRs which have a similar secondary structure. Our previous work suggested that thiswas notthe case. Thebovineparvovirus3'-terminal hairpin was not capable of binding the Rep protein at detectable levels (6). Thus, some other feature besides the secondary structure element or strand polarityatthe trs site may be required for specific substrate binding, and this

putativeelement could also directasymmetric binding.

The obviousplacetolookfor theputativebindingelement is at the trs. However, all of the substrates that have modifications of the trs are capable of binding the Rep protein to approximately thesame level (Fig. 5). Thus, the sequence elementrequired for specific binding to the AAV terminal hairpin does not appear to be in the vicinity of the cutsite andmust be somewhere else within the stem of the hairpin. Since the single-stranded region in the trs+ and trs-substrates extends 14 bases from the cut site, this would define one of theboundaries of the putative binding element

(Fig.9). The otherboundarywould bethesecondary struc-tureelement. Specificmutations inthisregion should deter-mine whetherourprediction iscorrect.

We concluded that there are atleast twofeatures of the AAV TR that are required for site specific endonuclease activity. One is the secondary structure element, and the other isaspecificsequenceatthetrs.Inaddition,ourresults suggestthat there may beone or two additional features of the TR thatarerecognized: thestrandpolarityin thestemof thehairpinor abinding element in thestem.Finally,wehave presented evidence that the ATPrequirementof the enzyme is dueto aneed forunwinding thetrspriortocutting.

ACKNOWLEDGMENTS

We thankDougMcCartyand JohnRyanforhelpful suggestions and for critical reading of the manuscript. We also thank Peter Kissel forsynthesizingtheoligonucleotides.

This workwassupported byaProgramProjectgrant(N.M.)from the National Cancer Institute (5 P01 CA2814607), by grant RO1 GM3572302from theNationalInstituteof GeneralMedical Sciences (N.M.)andby PublicHealthServicetraininggrantAI25530from the National Institutes of Health (R.O.S.).

REFERENCES

1. Ashktorab, H., and A. Srivastava. 1989. Identification of nuclear proteins that specifically interact with adeno-associated virus type 2inverted terminal repeathairpinDNA. J.Virol. 63:3034-3039.

2. Berns, K. I., andW. W. Hauswirth. 1979. Adeno-associated viruses. Adv. Virus Res.25:407-449.

3. Bohenzky, R. A., andK. I.Berns. 1989. Interactions between

the termini of adeno-associated virus DNA. J. Mol. Biol. 206:91-100.

4. Bohenzky, R. A., R. B. LeFebvre, and K. I. Berns. 1988. Sequence and symmetry requirementswithin thepalindromic sequencesof theadeno-associated virus terminalrepeat. Virol-ogy166:316-327.

5. Chejanovsky, N., and B. J. Carter.1990. Mutationof a consen-suspurine nucleotide binding site in theadeno-associatedvirus rep gene generates a dominant-negative phenotype for DNA replication.J.Virol.51:329-339.

5a.Hong,G., P. Ward, and K. I. Berns. 1992. In vitroreplicationof adeno-associated virus DNA. Proc. Natl. Acad. Sci. USA 89:4673-4677.

6. Im,D.-S., and N. Muzyczka. 1989. Factors that bind to adeno-associatedvirusterminalrepeats.J.Virol. 63:3095-3104. 7. Im, D.-S., and N. Muzyczka. 1990. The AAV origin binding

proteinRep68 is anATP-dependent site-specificendonuclease with DNA helicaseactivity. Cell61:447-457.

8. Im, D.-S., and N. Muzyczka. 1992.Partial purificationof adeno-associated virus Rep78, Rep68, Rep52, and Rep4O and their biochemical characterization. J.Virol. 66:1119-1128.

9. LeFebvre, R. B.,S. Riva, and K.I.Berns. 1984.Conformation takesprecedenceoversequencein adeno-associated virusDNA replication. Mol.Cell. Biol. 4:1416-1419.

10. Lusby, E., K. H. Fife, and K. I. Berns. 1980. Nucleotide sequenceof the invertedterminalrepetitioninadeno-associated virus DNA. J.Virol.34:402-409.

11. Maniatis, T., E. F. Fritsch, and J.Sambrook. 1982. Molecular cloning: alaboratorymanual. Cold SpringHarbor Laboratory, Cold Spring Harbor,N.Y.

12. Maxam, A. M., and W. Gilbert. 1980.Sequencing end-labeled DNAwithbase-specificcleavages. Methods Enzymol. 65:499-560.

13. McCarty, D. M., T.-H. Ni, and N. Muzyczka. 1992.Analysisof mutations inadeno-associatedvirus Repproteinin vivo and in vitro. J. Virol. 66:4050-4057.

14. Owens, R. A., and B. J. Carter. 1992. In vitro resolution of adeno-associated virushairpinterminibywild-type Repprotein is inhibited by a dominant-negative mutant of rep. J. Virol. 66:1236-1240.

15. Samulski, R. J., L.-S. Chang, and T. Shenk. 1987. A recombi-nant plasmid fromwhich an infectious adeno-associatedvirus genome can be excised in vitro and its use to study viral replication.J.Virol.61:3096-3101.

16. Samulski, R. J., A. Srivastava, K. I. Berns, and N. Muzyczka. 1983. Rescue of adeno-associated virus from recombinant plas-mids: gene correctionwithin the terminalrepeatsof AAV.Cell 33:135-143.

17. Snyder, R. O., D.-S. Im, and N. Muzyczka. 1990.Evidence for covalentattachment of the adeno-associated virus (AAV)Rep proteintothe ends of the AAV genome. J. Virol. 64:6204-6213. 18. Snyder,R.O., R.J.Samulski,andN.Muzyczka. 1990. In vitro resolution of covalently joined AAV chromosome ends. Cell 60:105-113.

19. Straus,S.E.,E. D.Sebring, and J. A. Rose. 1976. Concatemers of alternating plus and minus strands are intermediates in adenovirus-associated virusDNAsynthesis.Proc.Natl. Acad. Sci. USA 73:742-746.

20. Xiao, X.,andR.J. Samulski.Unpublished data.