ATP Binding and ATPase Activities Associated with Recombinant Rabbit Hemorrhagic Disease Virus 2C-Like Polypeptide

⌬

served residues G522and T529in motif A, D566and E567in motif B, and K600in motif C were also performed. These

results provide the first experimental characterization of a 2C-like ATPase activity in a member of theCaliciviridae.

Rabbit hemorrhagic disease virus (RHDV), the etiologic agent of a lethal pathology causing severe losses of farmed and wild rabbit populations (11), has been characterized as a mem-ber of theCaliciviridaefamily (16, 18) and, more recently, des-ignated the type species of the genusLagovirus(21). Purified virions contain two positive-polarity polyadenylated single-stranded RNA species, one of about 7.5 kb and the other of about 2.2 kb, bearing a virus-encoded VPg protein covalently attached to its 5⬘end (13, 31). The 2.2-kb subgenomic RNA is colinear for its complete length to the 3⬘-terminal region of the genomic RNA. The data obtained from in vitro translation (30),Escherichia coliexpression studies (12, 31), and the detec-tion of viral protein products after RHDV infecdetec-tion of cultured hepatocytes (6) revealed that the viral RNA is translated into a polyprotein, which is subsequently cleaved to give rise to at least nine mature structural and nonstructural proteins. Nev-ertheless, only four of the eight necessary cleavage sites have been experimentally demonstrated.

Amino acid sequence motifs conserved among proteins with known biological activities have been used to predict the func-tions of uncharacterized polypeptides. Comparative sequence studies between RHDV and picornaviruses have predicted similarities between the RHDV mature cleavage products p37, p15, and p58 and picornaviral 2C nucleoside triphosphatase (NTPase), 3C protease, and 3D RNA-dependent RNA poly-merase, respectively. Experimental data have proved that the prediction was correct for the p15 protease (12) and the p58 polymerase (10), but so far functional studies have not been published for p37, a putative 2C NTPase.

A detailed sequence analysis of the carboxy-terminal region of RHDV cleavage product p37 revealed the presence of two amino acid sequences,522GAPGIGKT529and566DE567, which

correspond to the conserved motifs A (GxxGxGKS/T) and B (DD/E) found in NTP-binding proteins, which have been de-scribed to have a broad range of functions (27). The A site is required for NTP binding, whereas the B site chelates Mg2⫹_, which is then complexed to the␤and␥phosphates of the NTP molecule bound at the A motif (1, 24). The presence of an additional conserved motif C (600KxxxFxSxxxxxS/TTN614),

which is also involved in ATP hydrolysis (20), indicated that

this RHDV protein might be a member of helicase superfamily III, which includes the picornavirus-like (2C-like) proteins (5). In the picornavirus-like supergroup, the poliovirus 2C pro-tein exhibits NTPase activity (14, 20, 22), but so far a helicase activity has not been demonstrated (22).

To investigate the putative NTPase activity of the p37 RHDV cleavage product, its corresponding coding region, encompass-ing the codons for amino acid residues 340 to 718 of the prod-uct of RHDV open reading frame 1, was amplified by PCR from plasmid pRC49 (12) using a sense primer, 5⬘-GGATCC AAGAGTTTCTGGGACAAGG-3⬘, in which aBamHI recog-nition sequence (underlined) has been added preceding the RHDV sequence, and an antisense primer, 5⬘-GAATTCtcaCT CAAATGAGGCCACGTC-3⬘, which incorporated an EcoRI restriction site (underlined) and a translation stop codon (low-ercase). A 1,146-bp DNA fragment corresponding to nucleo-tides (nt) 1027 to 2163 of the Spanish AST/89 RHDV isolate (EMBL accession number Z49271) was amplified and cloned into the pGEM-T vector (Promega). This region of the RHDV genome, which encodes the conserved A, B, and C motifs (Fig. 1A) of the helicase superfamily III members, was selected, taking into account the location of the segment encoding the p37 carboxyl terminus, which was originated by cleavage at the

718EG719peptide bond (12), and also considering the coding

capacity needed for a 37-kDa polypeptide. Nevertheless, it should be mentioned that the p37 NH2-terminal residue has

not been experimentally mapped. For this reason, and taking into account the known cleavage specificity of the RHDV 3C protease, the dipeptide339EG340could be hypothesized to be

the amino-terminal cleavage site giving rise to a 2C-like pro-tein with a calculated molecular mass of 42 kDa.

All attempts to express the amplified cDNA (nt 1027 to 2163) coding for the putative full-length 2C protein inE. coli by using pGEX or pQE vector systems were unsuccessful. No transformants were obtained using these constructs, probably due to the toxic effects of basal levels of the recombinant proteins. Similar cytotoxic effects have been described for the recombinant 2C protein from hepatitis A virus (7). Expression of the hepatitis A virus 2C protein was inhibitory to the growth and protein synthesis of bacteria, but deletion of the 2C N-terminal amphipathic helix (21 amino acid residues) abrogated both this effect and the ability of 2C to associate with eukaryo-tic membranes. For this reason, and taking into account that a carboxy-terminal portion of theFlaviviridaeNS3 protein showed NTPase (25, 28, 29) and helicase (9) activities, an amino-ter-minally truncated version of this polypeptide (⌬2C) encom-* Corresponding author. Mailing address: Departamento de

Bio-quı´mica y Biologı´a Molecular, Universidad de Oviedo, 33006 Oviedo, Spain. Phone: 34-985103563. Fax: 34-985103157. E-mail: parra@biosun .medicina.uniovi.es.

10846

on November 9, 2019 by guest

passing amino acid residues 501 to 718 of the RHDV polypro-tein (Fig. 1A), which contained the putative helicase consensus motifs A, B, and C (5), was expressed inE. colias a glutathione S-transferase (GST) fusion protein. For this purpose, the am-plified p37 cDNA (nt 1027 to 2163) cloned into the pGEM-T vector was digested withNcoI at a unique target sequence found within the cloned cDNA (nt 1508 to 1513 of the RHDV genome) (Fig. 1A), and the cohesive ends were filled using the Klenow fragment. The plasmid was further digested with EcoRI, and the 655-bp fragment was purified and inserted into a blunt-ended BamHI- and EcoRI-digested pGEX-2T ex-pression vector (Amersham Pharmacia Biotech). The result-ing pGEX-⌬2C expression vector included the coding region for the carboxy terminus of the putative 2C protein (Fig. 1A) fused in frame to the 3⬘end of theSchistosoma mansoniGST gene.

The recombinant GST-⌬2C protein (51 kDa) could be efficiently purified fromE. coliBL21 cultures harboring the pGEX-⌬2C plasmid by affinity chromatography (Fig. 1B) using a bulk GST purification module (Amersham Pharmacia Bio-tech) in accordance with the manufacturer’s instructions. The protein pattern of the eluted fractions was analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (8), and the protein concentrations were calculated using the Bio-Rad protein assay. The purified recombinant GST-⌬2C protein was stored at⫺70°C in 50 mM Tris-HCl (pH 8.0) in the presence of 25% glycerol. All attempts to release the ⌬2C moiety from the GST carrier protein by in situ thrombin pro-teolysis gave rise to low-molecular-weight degraded products (data not shown), and consequently the intact recombinant GST-⌬2C fusion was used for the subsequent functional as-says.

In previous works, thin-layer chromatography (TLC) was used successfully for the separation of ribonucleoside triphos-phates and Pi(22). Using a similar experimental approach, we

have been able to demonstrate that the purified recombinant GST-⌬2C protein is able to hydrolyze [␥-32_{P]ATP, resulting in}

the production of32_P

i(Fig. 2A). Similarly to RHDV 2C-like

protein, the poliovirus 2C protein conserved its NTPase

activ-ity as a fusion protein with either maltose binding protein (22) or GST (20).

The standard ATPase assay was performed in a 20-␮l reac-tion mixture containing 20 mM HEPES-KOH (pH 7.5), 5 mM magnesium acetate, 1 mM dithiothreitol, 0.4 ␮Ci of [␥-32_P]

ATP (7,000 Ci mmol⫺1_{) (ICN Biomedicals, Inc.), and 0.1␮g of}

recombinant wild-type or mutant GST-⌬2C protein. The reac-tion was carried out for 5 min at 37°C and stopped by adding 0.1 M EDTA and placing the mixture in ice. One-microliter aliquots were then transferred onto plastic polyethyleneimine cellulose F sheets (Merck), which were then developed with 0.15 M formic acid–0.15 M LiCl in a TLC chamber and ex-posed to X-ray film. The amount of radioactivity in each spot was measured with an Instant-Imager (Packard Instrument Company).

Under the conditions used, the extent of ATP hydrolysis was dependent on the recombinant protein concentration (Fig. 2B). No ATPase activity was observed when the fusion protein was replaced by purified GST (Fig. 2A), supporting the idea that the hydrolytic activity was due to the⌬2C moiety.

Various concentrations of magnesium and manganese salts were used to investigate the divalent ion requirements of the

⌬2C ATPase activity (Fig. 2C). The recombinant enzyme showed a strict requirement of Mg2⫹_{or Mn}2⫹_{under these} cir-cumstances, and therefore an appropriate concentration of mag-nesium acetate (5 mM) was added to all subsequent ATPase assays.

The ⌬2C enzyme activity was also found to be negatively affected by the ionic strength of the incubation medium, as demonstrated by the inhibitory effects observed after the ad-dition of increasing amounts of NaCl (Fig. 2D).

Stimulation of NTPase activity by polynucleotides appears to be a general feature of helicase proteins (2, 3, 23). Never-theless, the addition of 2␮g of poly(U) to the RHDV⌬2C ATPase incubation mixture using the optimized reaction con-ditions gave rise to an unexpected inhibition of the enzyme activity (data not shown). Similar inhibitory effects were also described for the ATPase activity of the poliovirus 2C protein (20).

FIG. 1. Genomic localization of the RHDV p37 cleavage product and SDS-PAGE analysis of the recombinant GST-⌬2C protein. (A) Schematic representation of the full-length RHDV cDNA indicating relevant restriction sites. Numbers indicate nucleotide residues of the RHDV genome or amino acid residues of the RHDV polyprotein. Amino acid residues in conserved motifs A, B, and C are indicated. (B) SDS-PAGE analysis of recombinant RHDV GST-⌬2C preparations. Lane 1, molecular mass markers; lane 2, cell extract from pGEX-⌬2C-transformedE. coli; lane 3, cell extract from pGEX-⌬2C-transformed, isopropyl-␤-D

-thiogalactopyr-anoside (IPTG)-inducedE. coli; lane 4, purified GST-⌬2C fusion protein run on a separate gel.

on November 9, 2019 by guest

http://jvi.asm.org/

To show that the presence of unlabeled UTP in the poly(U) preparation was not responsible for the observed inhibition, we also used 0.5␮g of gel-purified (10) oligo(U) (approximately 50 residues long). A similar (fourfold) inhibition of the

GST-⌬2C protein ATPase activity was found (data not shown), supporting the notion that the negative effects of poly(U) were specifically due to the polynucleotide.

Experiments were also conducted to directly address the putative helicase activity of the GST-⌬2C protein, by following previously described procedures (22). Nevertheless, after re-peated attempts we could not detect any unwinding activity (data not shown). This result could be a consequence of the use of an amino-terminally truncated protein or could indicate that RHDV 2C is not, in fact, a helicase, an activity that also could not be demonstrated for the poliovirus 2C protein (20, 22).

In order to investigate GST-⌬2C nucleotide preferences, we used an indirect approach by studying the inhibitory effects of unlabeled NTPs and deoxy-NTPs (dNTPs) on the observed GST-⌬2C ATPase activity. For this purpose, the standard as-say was carried out in the presence of a molar excess (1 mM) of each individually assayed NTP or dNTP. The resulting re-sidual ATPase activity was measured after 20 min of incuba-tion. The results, summarized in Fig. 3A, showed that 1 mM ATP or dATP strongly inhibited Pirelease (91 or 89%,

respec-tively), indicating that these are the preferred nucleotides for the recombinant enzyme. In contrast, the presence of CTP hardly inhibited (3%) the release of labeled Pi. Intermediate

inhibitory effects could be found in the presence of GTP (53%) and dGTP (38%), whereas the remaining compounds, UTP (23%), dCTP (23%), and dTTP (17%), gave rise to even lower inhibition levels. These results indicate a preference of the enzyme for purine substrates, as was also described for the poliovirus 2C protein (20, 22).

To further substantiate the nucleotide preferences of recom-binant GST-⌬2C, we investigated the effect of an excess of unlabeled nucleotides on the ATP-binding activity of the RHDV GST-⌬2C protein. For this purpose, the purified re-combinant protein was incubated with [␣-32_{P]ATP in the}

pres-ence or abspres-ence of unlabeled competing nucleotides. The cross-linking reaction mixtures (20 ␮l), containing 1␮g of wild-type or mutant GST-⌬2C protein in 25 mM Tris-HCl (pH 8)–5 mM magnesium acetate–1␮Ci of [␣-32_{P]ATP (400 Ci}

mmol⫺1_{) (Amersham Pharmacia Biotech)–12.5% glycerol–1.5}

mM dithiothreitol, were incubated on ice for 15 min before irradiation for about 8 min at 8 cm from the light source (0.78 J cm⫺2_{) using a Stratalinker (Stratagene). After UV}

cross-link-ing, the samples were boiled for 5 min in the presence of elec-trophoresis sample buffer and analyzed by SDS–12% PAGE (8). The gel was stained with Coomassie blue, dried, and auto-radiographed. The radioactivity in each band was measured using an Instant-Imager (Packard Instrument Company). After correcting for the amount of protein in each band, as measured by densitometry, the percentage of ATP binding to the mutant proteins was calculated relative to the amount of ATP bound to the wild-type protein.

FIG. 2. Biochemical characterization of GST-⌬2C ATPase activity. (A) Autoradiograph of a TLC plate from a standard assay showing [␥-32_{P]ATP and}32_P imobility.

(B) Effect of GST-⌬2C concentration on ATPase activity. (C) Effects of Mg2⫹_{and Mn}2⫹_{on GST-⌬2C ATPase activity. (D) Effect of NaCl concentration on GST-⌬2C} ATPase activity.

on November 9, 2019 by guest

As expected from its ATPase activity, the RHDV⌬2C pro-tein was also able to efficiently bind ATP, as indicated by the major labeled band observed (Fig. 3B) corresponding to the mobility of recombinant GST-⌬2C protein. The radioactive label was efficiently competed by the presence of 1 mM unla-beled ATP, GTP, dATP, or dGTP in the incubation medium. In the presence of 1 mM CTP, UTP, dCTP, or dTTP, only small amounts of ADP-protein complexes could still be ob-served, indicating a lower binding capacity for the RHDV⌬2C protein.

The ATPase and ATP-binding studies, in the presence of a molar excess of unlabeled competing NTPs or dNTPs both confirmed a preference order of RHDV⌬2C for the various nucleotides used, with the purines being the preferred com-pounds.

In order to investigate the contribution of the A, B, and C conserved motifs to ATP binding and hydrolysis by the⌬2C polypeptide, we performed a limited number of site-directed mutagenesis experiments. Highly conserved amino acid resi-dues were chosen as targets for mutagenesis, and the resiresi-dues that were introduced (replacing those naturally occurring in RHDV) could be classified into two groups. The first group included changes to residues that were never found at the cor-responding position in other NTP-binding proteins (4), such as mutations G522I and T529A in domain A, D566L in motif B, and

K600Q in the conserved C sequence. The second type of

mu-tants included amino acid changes to residues similar to those

found at the equivalent positions of 2C-like proteins of pico-rnaviruses, such as T529S in region A and E567D in the B motif.

For mutant construction, theBamHI-EcoRI fragment from the pGEX-⌬2C plasmid was ligated into the BamHI and EcoRI sites of pBluescript SK(⫹), originating the recombinant plasmid pBS-⌬2C, which was used to perform in vitro site-directed mutagenesis using the Chameleon double-stranded kit (Stratagene) and following the manufacturer’s instructions. Mutagenic oligonucleotide primers, ranging from 27 to 33 nt (Table 1), were designed to produce point mutations in the conserved sequence motifs A, B, and C. The resulting mutant BamHI-EcoRI DNA fragments were then inserted into the BamHI-EcoRI-digested pGEX-2T expression plasmid. Each of the mutated expression vectors was transformed intoE. coli BL21 cells, and the GST-⌬2C mutant proteins were produced and purified as described above for the wild-type protein. To assess the overall purity and molecular size of the resulting recombinant polypeptides, equivalent amounts of each puri-fied protein preparation were analyzed by SDS-PAGE, and the gel was stained with Coomassie blue. A major 51-kDa protein band of comparable intensity was observed for the wild-type and all mutant GST-⌬2C polypeptides (data not shown).

To test the ability of each mutant protein to hydrolyze [␥-32_{P]ATP, a time course experiment was performed using}

the standard ATPase assay. Aliquots (1␮l) from the reaction mixture were withdrawn at 3, 6, 12, and 18 min and spotted onto polyethyleneimine cellulose sheets. After the TLC sepa-FIG. 3. Effects of NTPs and dNTPs on GST-⌬2C ATP hydrolysis and ATP-binding activity. (A) Hydrolysis of [␥-32_{P]ATP by GST-⌬2C protein in the presence of}

a 1 mM concentration of each individually assayed unlabeled NTP or dNTP. (B) Autoradiograph of an SDS-PAGE gel showing the effects of an excess of unlabeled NTPs or dNTPs on the ATP-binding activity of GST-⌬2C protein. NA, no unlabeled nucleotide added.

TABLE 1. DNA oligomers used for site-directed mutagenesis

Domain Point mutanta _{Amino acid sequence Mutagenic oligonucleotide sequence}b

A WTc

522GAPGIGKT529

G522I I--- 5⬘ATGCCTGGGGCTATTTTGAAAATGACAGCCACG3⬘

T529A ---A 5⬘CTGTGGACTAAGTAGGCTTTACCAATGCCTGG3⬘

T529S ---S 5⬘GTGGACTAAGTAGGATTTACCAATGCCTGG3⬘

B WT 566DE567

D566L L- 5⬘GTGTTGAACTCGAGCGCAATAGCAACC3⬘

E567D -D 5⬘CCACAAGTGTTGAAGTCGTCCGCAATAGC3⬘

C WT 600KNKVFNSKYLLCTTN614

K600Q Q--- 5⬘GAAAACTTTGTTCTGGTTCTCAGCCTTGTC3⬘

a_{The number refers to the amino acid position in the RHDV polyprotein.} b_{Mutated nucleotide residues are underlined.}

c_{WT, wild type.}

on November 9, 2019 by guest

http://jvi.asm.org/

ration and plate autoradiography, the released Pi was

mea-sured using an Instant-Imager (Packard Instrument Company) and expressed as a percentage of the total phosphate (Fig. 4). The data indicated that the nonconserved amino acid sub-stitutions directed to domains A (G522I and T529A) and B

(D566L) completely abolished ATPase activity. In contrast, the

nonconserved mutation in domain C (K600Q) showed

wild-type activity. The conserved Glu-to-Asp change in domain B (E567D) resulted in the loss of about 50% of the wild-type

NTPase activity. Surprisingly, the conservative threonine-to-serine substitution in domain A (T529S) resulted in a severe

loss of the ATPase activity (12 to 15% of the wild-type levels). It has been previously shown that the A and B sites play important roles in NTP binding. X-ray crystallography data have indicated that the invariant K residue of site A was in direct contact with the␤and ␥phosphates of the bound nu-cleotide, while the first Asp residue of the B site interacted, via a water molecule, with a magnesium ion complexed with the␤

and␥phosphates (1, 17, 24). To investigate the ATP-binding properties of the⌬2C point mutants, we used a UV cross-linking assay, in which ATP is photolyzed by UV light in the presence or absence of Mg2⫹_{, resulting in a covalent bond} between the protein and the [␣-32_P]ATP.

In the absence of Mg2⫹_{, the ATP-binding capacities of the} wild-type and mutant proteins were reduced about fivefold (Fig. 5), supporting the relevance of this ion for nucleotide binding. In addition, nonconserved substitutions in either do-main A (G522I and T529A) or domain B (D566L) resulted in a

dramatic decrease in ATP cross-linking (Fig. 5). On the other hand, the conservative mutations T529S (domain A) and E567D

(domain B) had moderate effects (Fig. 5) on the ATP-binding capacities of the mutant proteins.

In contrast with the results found for sites A and B, a non-conservative substitution (K600Q) in domain C did not alter the

ATP-binding capacity of the mutant protein (Fig. 5).

From the site-directed mutagenesis studies it could be con-cluded that the replacement of the motif A conserved Gly and Thr residues completely abolished the ATP-binding capacity and ATPase activity of the RHDV ⌬2C protein. Similar changes in the poliovirus 2C protein (Gly129Ile [14] and

Ser136Ala [26]) produced nonviable viruses after transfection

of cultured cells. It was also found that the replacement of the conserved Asp566 residue with Leu in motif B severely

im-type of mutation was lethal in poliovirus 2C, as no viral RNA replication could be detected in cells transfected with mutant transcripts, suggesting a functional role for the NTP-binding motif of 2C in the RNA replication and pro-liferation of poliovirus (14). The lack of ATP binding ob-tained with the RHDV⌬2C site B mutant (D566L) does not

agree with the results of an earlier mutational study involv-ing the B motif (DEAD) of the mammalian translation initiation factor eIF-4A, which is included in the superfamily II helicases (5). In this case, ATP binding was not affected by mutations in the B motif, although ATP hydrolysis was abolished (19). This discrepancy may reflect differences in the ATP-binding capacities of the members of superfamilies II and III of RNA helicases. In addition, mutations in other conserved amino acid residues, such as Lys135 (domain A)

and Asp177(motif B), also abolished the ATPase activity of the

poliovirus 2C protein (15, 20).

Conservative-replacement studies, with amino acid residues from RHDV ⌬2C motifs A and B replaced by residues ob-served at the equivalent picornavirus 2C protein positions, showed that this type of changes more severely affected ATP hydrolysis than ATP-binding capacity, suggesting the biological relevance of these residues, particularly that of Thr529.

Never-theless, in the poliovirus system, where in vivo studies can be performed, no viable mutants could be isolated after transfec-tion of cultured cells using mutated transcripts at the con-served domain A Ser (S136T) or domain B Asp (D177E) from

poliovirus 2C (26).

The analysis of the purified RHDV mutant protein carrying the K600Q change (motif C) showed wild-type ATPase and

ATP-binding activities. In contrast to this observation, it has been previously reported that replacement of the conserved Asn residue in poliovirus 2C motif C inhibited the ATPase activity to undetectable levels, suggesting the requirement of motif C for the hydrolytic activity (20). Our results might indicate that not all the conserved residues in motif C play similar roles or that, despite the high similarities observed, some significant functional differences could be found between the 2C polypeptides from poliovirus and caliciviruses.

The in vivo significance of these replacements could not be assessed in the RHDV system due to the lack of both a per-missive cell culture and the possibility of producing infective viral transcripts. Nevertheless, the data reported in this work provide the first experimental evidence of the existence of a 2C-like ATPase activity in a member of theCaliciviridae, thus supporting the previous predictions of a 2C NTPase protein based on amino acid sequence analysis.

This work was supported by grant PB96-0552-CO2-O1 from Direc-cio´n General Ensen˜anza Superior, Spain.

FIG. 4. ATPase activity of wild-type (wt) and mutant GST-⌬2C proteins. Each data point represents the average of three independent determinations.

on November 9, 2019 by guest

and R. De Francesco.1998. Multiple enzymatic activities associated with recombinant NS3 protein of hepatitis C virus. J. Virol.72:6758–6769. 4.Gorbalenya, A. E., E. V. Koonin, and Y. I. Wolf.1990. A new superfamily of

putative NTP-binding domains encoded by genomes of small DNA and RNA viruses. FEBS Lett.262:145–148.

5.Kadare´, G., and A.-L. Haenni.1997. Virus-encoded RNA helicases. J. Virol.

71:2583–2590.

6.Ko¨nig, M., H.-J. Thiel, and G. Meyers.1998. Detection of viral proteins after infection of cultured hepatocytes with rabbit hemorrhagic disease virus. J. Virol.72:4492–4497.

7.Kusov, Y. Y., C. Probst, M. Jecht, P. D. Jost, and V. Gauss-Muller.1998. Membrane association and RNA binding of recombinant hepatitis A virus protein 2C. Arch. Virol.143:931–944.

8.Laemmli, U. K.1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature227:680–685.

9.Li, H., S. Clum, S. You, K. E. Ebner, and R. Padmanabhan.1999. The serine protease and RNA-stimulated nucleoside triphosphatase and RNA helicase functional domains of dengue virus type 2 NS3 converge within a region of 20 amino acids. J. Virol.73:3108–3116.

10. Lo´pez Va´zquez, A., J. M. Martı´n Alonso, R. Casais, J. A. Boga, and F. Parra.

1998. Expression of enzymatically active rabbit hemorrhagic disease virus RNA-dependent RNA polymerase inEscherichia coli. J. Virol.72:2999– 3004.

11. Marcato, P. S., C. Benazzi, G. Vecchi, M. Galeotti, S. L. Della, G. Sarli, and P. Lucidi.1991. Clinical and pathological features of viral haemorrhagic disease of rabbits and the European brown hare syndrome. Rev. Sci. Tech. Off. Int. Epizoot.10:371–392.

12. Martı´n Alonso, J. M., R. Casais, J. A. Boga, and F. Parra.1996. Processing of rabbit hemorrhagic disease virus polyprotein. J. Virol.70:1261–1265. 13. Meyers, G., C. Wirblich, and H.-J. Thiel.1991. Rabbit hemorrhagic disease

virus: molecular cloning and nucleotide sequencing of a calicivirus genome. Virology184:664–676.

14. Mirzayan, C., and E. Wimmer.1992. Genetic analysis of an NTP-binding motif in poliovirus polypeptide 2C. Virology189:547–555.

15. Mirzayan, C., and E. Wimmer.1994. Biochemical studies on poliovirus polypeptide 2C: evidence for ATPase activity. Virology199:176–187. 16. Ohlinger, V. F., B. Haas, G. Meyers, F. Weiland, and H.-J. Thiel.1990.

Identification and characterization of the virus causing rabbit hemorrhagic disease. J. Virol.64:3331–3336.

20. Pfister, T., and E. Wimmer.1999. Characterization of the nucleoside triphos-phatase activity of poliovirus protein 2C reveals a mechanism by which guanidine inhibits poliovirus replication. J. Biol. Chem.274:6992–7001. 21. Pringle, C. R.1998. Virus taxonomy—San Diego 1998. Arch. Virol.143:

1449–1459.

22. Rodrı´guez, P. L., and L. Carrasco.1993. Poliovirus protein 2C has ATPase and GTPase activities. J. Biol. Chem.268:8105–8110.

23. Stau¨ber, N., J. Martinez-Costas, G. Sutton, K. Monastyrskaya, and P. Roy.

1997. Bluetongue virus VP6 protein binds ATP and exhibits an RNA-de-pendent ATPase function and a helicase activity that catalyze the unwinding of double-stranded RNA substrates. J. Virol.71:7220–7226.

24. Story, R. M., and T. A. Steitz.1992. Structure of the recA protein-ADP complex. Nature355:374–376.

25. Suzich, J. A., J. K. Tamura, F. Palmer-Hill, P. Warrener, A. Grakoui, C. M. Rice, S. M. Feinstone, and M. S. Collett.1993. Hepatitis C virus NS3 protein polynucleotide-stimulated nucleoside triphosphatase and comparison with the related pestivirus and flavivirus enzymes. J. Virol.67:6152–6158. 26. Teterina, N. L., K. M. Kean, A. E. Gorbalenya, V. I. Agol, and M. Girard.

1992. Analysis of the functional significance of amino acid residues in the putative NTP-binding pattern of the poliovirus 2C protein. J. Gen. Virol.73:

1977–1986.

27. Walker, J. E., M. Saraste, M. J. Runswick, and N. J. Gay.1982. Distantly related sequences in the␣and␤subunits of ATP synthetase, myosin, kinases and other ATP-requiring enzymes and a common nucleotide binding fold. EMBO J.1:945–951.

28. Warrener, P., J. K. Tamura, and M. S. Collett. 1993. RNA-stimulated NTPase activity associated with yellow fever virus NS3 protein expressed in bacteria. J. Virol.67:989–996.

29. Wengler, G., and G. Wengler.1991. The carboxy-terminal part of the NS 3 protein of the West Nile flavivirus can be isolated as a soluble protein after proteolytic cleavage and represents an RNA-stimulated NTPase. Virology

184:707–715.

30. Wirblich, C., M. Sibilia, M. B. Boniotti, C. Rossi, H.-J. Thiel, and G. Meyers.

1995. 3C-like protease of rabbit hemorrhagic disease virus: identification of cleavage sites in the ORF1 polyprotein and analysis of cleavage specificity. J. Virol.69:7159–7168.

31. Wirblich, C., H.-J. Thiel, and G. Meyers.1996. Genetic map of the calicivirus rabbit hemorrhagic disease virus as deduced from in vitro translation studies. J. Virol.70:7974–7983.

on November 9, 2019 by guest

http://jvi.asm.org/