0022-538X/11/$12.00 doi:10.1128/JVI.01689-10
Copyright © 2011, American Society for Microbiology. All Rights Reserved.
Residues of the Rotavirus RNA-Dependent RNA Polymerase
Template Entry Tunnel That Mediate RNA Recognition
and Genome Replication
䌤
Kristen M. Ogden, Harish N. Ramanathan,† and John T. Patton*
Laboratory of Infectious Diseases, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, Maryland 20826-8026
Received 10 August 2010/Accepted 1 December 2010
To replicate its segmented, double-stranded RNA (dsRNA) genome, the rotavirus RNA-dependent RNA polymerase, VP1, must recognize viral plus-strand RNAs (ⴙRNAs) and guide them into the catalytic center. VP1 binds to the conserved 3ⴕend of rotavirusⴙRNAs via both sequence-dependent and sequence-independent contacts. Sequence-dependent contacts permit recognition of viral ⴙRNAs and specify an autoinhibited positioning of the template within the catalytic site. However, the contributions to dsRNA synthesis of sequence-dependent and sequence-independent VP1-RNA interactions remain unclear. To analyze the impor-tance of VP1 residues that interact withⴙRNA on genome replication, we engineered mutant VP1 proteins and assayed their capacity to synthesize dsRNAin vitro. Our results showed that, individually, mutation of residues that interact specifically with RNA bases did not diminish replication levels. However, simultaneous mutations led to significantly lower levels of dsRNA product, presumably due to impaired recruitment ofⴙRNA tem-plates. In contrast, point mutations of sequence-independent RNA contact residues led to severely diminished replication, likely as a result of improper positioning of templates at the catalytic site. A noteworthy exception was a K419A mutation that enhanced the initiation capacity and product elongation rate of VP1. The specific chemistry of Lys419 and its position at a narrow region of the template entry tunnel appear to contribute to its capacity to moderate replication. Together, our findings suggest that distinct classes of VP1 residues interact withⴙRNA to mediate template recognition and dsRNA synthesis yet function in concert to promote viral RNA replication at appropriate times and rates.
Prior to catalysis, a viral RNA-dependent RNA polymerase (RdRp) must recognize viral templates, guide them to the catalytic site, and position them appropriately for initiation (25). While interactions between the RdRp and its template may mediate these processes, in many cases the details of these interactions are poorly understood. Rotaviruses (RVs) provide an ideal opportunity to study the functional significance of RdRp-RNA interactions, due to the availability of a high-resolution RV RdRp structure andin vitrobiochemical assays to analyze polymerase activity (9, 18, 43). RVs, members of the
Reoviridaefamily, are important etiologic agents of diarrheal
disease (27). RV virions are nonenveloped, triple-layered ico-sahedrons that encapsidate a genome of 11 segments of dou-ble-stranded RNA (dsRNA) (36). Associated with each ge-nome segment is a polymerase complex composed of the viral RdRp (VP1) and viral capping enzyme (VP3) (22, 36). During infection, VP1 interacts with viral RNA to mediate several important processes, including transcription, RNA packaging, and replication (31, 33). Transcription is mediated by VP1 confined within the virion core and results in the synthesis of
plus-strand RNAs (⫹RNAs) from the minus strand of a genomic dsRNA segment (32). Viral ⫹RNAs may be trans-lated by host cell ribosomes or associate with VP1 and VP3 to form precore complexes, which are early intermediates in the virus assembly pathway (13, 33). VP1 binds specifically to a consensus sequence at the 3⬘terminus of RV⫹RNAs (3⬘CS⫹) (5⬘-UGUGACC-3⬘) (33). While specific recognition of the 3⬘CS⫹by VP1 is thought to contribute importantly to pack-aging, VP1/RNA complexes are catalytically inactive (29, 30, 43). In an incompletely understood assembly process, the 11 precore complexes associate with each other and viral inner core shell protein VP2 to form a single-layered RV core (13, 33). In the presence of VP2, VP1 is activated and catalyzes genome replication, making dsRNA genome segments from bound⫹RNAs (30, 33). This strategy of specific⫹RNA rec-ognition by VP1, followed by VP2-dependent VP1 activation, permits the coordination of genome packaging and replication. High-resolution crystal structures revealed that VP1 is a hol-low, globular molecule composed of three domains: the N-termi-nal, polymerase, and C-terminal domains. The polymerase do-main has a cupped, right-handed structure that consists of finger, palm, and thumb subdomains (Fig. 1) and contains the six canonical RdRp motifs (A to F) (5, 18, 26). The N- and C-terminal domains sandwich the polymerase domain, enclos-ing the hollow catalytic center, which is connected to the ex-terior by four tunnels. Based on soaks of VP1 crystals with RNA oligonucleotides and comparisons with the structurally related reovirus RdRp (3), the tunnels are predicted to serve as conduits for (i) template entry, (ii) nucleoside triphosphate
* Corresponding author. Mailing address: Laboratory of Infectious Diseases, National Institute of Allergy and Infectious Diseases, Na-tional Institutes of Health, 50 South Drive, Bethesda, MD 20892. Phone: (301) 594-1615. Fax: (301) 496-8312. E-mail: jpatton@niaid .nih.gov.
† Present address: Laboratory of Molecular Biology, National tute of Diabetes and Digestive and Kidney Diseases, National Insti-tutes of Health, 5 Center Drive, Bethesda, MD 20892.
䌤Published ahead of print on 8 December 2010.
1958
on November 7, 2019 by guest
http://jvi.asm.org/
FIG. 1. Overview of VP1 structure and interactions with the 3⬘CS⫹. (A and B) Surface representations of VP1 with a bound 5⬘-UGUGACC-3⬘ oligonucleotide. (A) Complete structure. (B) A cutaway that permits visualization of the four tunnels and hollow catalytic center of VP1. Tunnels are labeled. (C) A ribbon drawing of VP1 in the same orientation as in panel A is shown on the left. A black box outlines the area that is magnified in the image on the right. For clarity, some regions of VP1 have been removed. Motif F of VP1 is labeled, and nucleotide bases of the oligonucleotide are numbered in a 3⬘-to-5⬘direction, in the magnified image. Side chains of residues mutated in this study are shown, with H bonds depicted as red lines. (D) Interactions of VP1 residues with the UGUGACC oligonucleotide. The image is similar to that in panel C, with the VP1 ribbon hidden for clarity. Side chains of VP1 residues mutated in this study are labeled, with H bonds depicted as red lines. (E) Alignment of the 3⬘CS⫹with the VP1 catalytic pocket. Nucleotide bases of the UGUGACC oligonucleotide and occupying the priming (P) and incoming nucleotide (N) sites are labeled. VP1 is hidden for clarity. In all panels, the VP1 N-terminal domain (khaki), C-terminal domain (pink), and finger (blue), palm (red), and thumb (green) subdomains of the polymerase domain are colored. The UGUGACC oligonucleotide is shown as a yellow stick model. Superpositioning of a crystal structure of reovirus RdRp3, captured during initiation, on an RV VP1 crystal structure was used to approximate the positions of components of the VP1 initiation complex (18, 41). These components are Mn2⫹ions (dark gray spheres) and NTPs (green stick
models) occupying the P and N sites.
on November 7, 2019 by guest
http://jvi.asm.org/
(NTP) entry, (iii)⫹RNA exit, and (iv) dsRNA and minus-strand RNA (⫺RNA) exit (Fig. 1B) (41).
The VP1 template entry tunnel has a wide opening and narrows, like a funnel, before widening again into the hollow catalytic center of VP1 (Fig. 1B) (18). The tunnel surface is highly electropositive, allowing it to attract the ribose-phos-phate backbone of RNA. Analysis of VP1 crystals soaked with oligonucleotides representing the 3⬘CS⫹ (VP1/3⬘CS⫹ com-plexes) has revealed how VP1 recognizes the 3⬘ends of⫹RNA templates. The 3⬘CS⫹is anchored in the template entry tunnel and catalytic center via stacking interactions and an extensive network of hydrogen bonds that establish high-affinity binding (Fig. 1C). VP1 residues involved in these interactions form (i) sequence-dependent contacts with the UGUG bases of the 3⬘CS⫹ (residues Asn186, Lys188, Arg190, Phe416, Arg701, and Gly702) or (ii) sequence-independent contacts, primarily with the phosphate linkages and ribose groups of the RNA backbone (residues Ser398, Lys419, Lys420, Ile462, Ile464, Lys594, and Lys597) (Table 1). To date, VP1 is the only RdRp for which a stretch of sequence-dependent interactions with RNA has been observed. Gel shift assays have shown that the UGUG residues of the 3⬘CS⫹are important for VP1 binding
(43). VP1 residues involved in sequence-dependent interac-tions are generally conserved among RVs that contain a UGUG sequence in the 3⬘CS⫹(group A, C, and D strains), whereas residues involved in sequence-independent interac-tions are conserved among all known RV VP1 molecules (23, 44). These observations suggest that the two groups of resi-dues, sequence dependent and sequence independent, serve important, but perhaps distinct, functions. In particular, base-specific recognition is likely connected to interactions occur-ring between VP1 and⫹RNAs that mediate packaging and the formation of initiation complexes, whereas sequence-indepen-dent interactions may be more relevant to RNA catalytic events, including initiation and elongation.
[image:3.585.49.536.82.461.2]An interesting feature of the crystal structure of VP1/3⬘CS⫹ complexes is that the RNA 3⬘ terminus is positioned in the catalytic center such that it has overshot the register for de novoinitiation by a single nucleotide (Fig. 1C and E) (18, 41). The overshot positioning of the 3⬘RNA end suggests that VP1 is in an autoinhibited conformation. It is possible that during the viral life cycle an overshot conformation of VP1/3⬘CS⫹ complexes contributes to the coordination of⫹RNA packag-ing and genome replication by preventpackag-ing dsRNA synthesis at
TABLE 1. Interactions of VP1 SD and SI residues with the 3⬘CS⫹and other VP1 residues
Residue Location in VP1
Contact(s) with:
3⬘CS⫹ Other VP1 residues
Asp127 N-terminal domain Side-chain carboxylate H bond with Arg190 side-chain
guanidium
Asn186 N-terminal domain Side-chain amide H bond with O6of G-6 base Side-chain carboxylate H bonds with Lys188 and
Arg190 side-chain amides, main-chain amide H bond with Arg190 main-chain carbonyl Lys188 N-terminal domain Side-chainε-amino group H bond with N7
of G-6 base
Main-chain amide H bond with side-chain carboxylate of Asn186, main-chain carbonyl H bonds with guanidium and amine of Arg701 side chain Arg190 N-terminal domain Side chain stacks against G-6 purine ring Side chain stacks against Arg701 side chain, side-chain
guanidium H bond with Asp127 side-chain carboxylate, main-chain amide H bond with Asn186 main-chain carbonyl, main-chain carbonyl H bond with Asn186 main-chain amide
Ser398 Finger subdomain Side-chain hydroxyl H bond to C-2 phosphate Ser401 Finger subdomain Side-chain hydroxyl H bond to G-4 phosphate,
main-chain amide H bond to A-3 phosphate Phe416 Finger subdomain Main-chain amide H bond with O4of U7
base, main-chain carbonyl H bond with N3
of U7 base, side-chain phenyl ring stacks against U7 pyrimidine ring
Lys419 Finger subdomain Side-chainε-amino group H bond with G-4 phosphate
Lys420 Finger subdomain Side-chainε-amino group H bonds with C-2 phosphate and A-3 ribose
Ile461 Finger subdomain Hydrophobic side-chain stacking against residues of
finger subdomain Ile462 Finger subdomain Side chain stacks against A-3 purine ring
Ile464 Finger subdomain Side chain stacks against A-3 ribose and phosphate
Lys594 Finger subdomain Side-chainε-amino group H bond with C-1 phosphate
Lys597 Palm subdomain Side-chainε-amino group H bond with C-1 ribose
Arg701 Thumb subdomain Main-chain carbonyl H bonds with N1and N2
of G-4 base
Side-chain guanidium H bond with Lys188 main-chain carbonyl, side chain stacks against Arg190 side chain
Gly702 Thumb subdomain Main-chain carbonyl H bond with N3
of U5 base
on November 7, 2019 by guest
http://jvi.asm.org/
inappropriate stages of assembly. Although the precise order of assembly events is not yet known, in the presence of VP2, VP1/3⬘CS⫹complexes must undergo conformational changes that allow the priming (P) and incoming nucleotide (N) sites of the VP1 catalytic pocket (Fig. 1C and E) to be occupied by GTP residues, resulting in phosphodiester bond formation and minus-strand initiation (9).
In the current study, we sought to determine how sequence-dependent and sequence-insequence-dependent interactions of VP1 res-idues with RV⫹RNA templates contribute to dsRNA synthe-sis. Toward this end, we analyzed the activity of mutant forms of VP1 usingin vitroreplication assays. For clarity, VP1 resi-dues involved in sequence-dependent interactions with the UGUG residues of the 3⬘CS⫹will be referred to as SD resi-dues, and alanine substitution mutants thereof will be called SD mutants (Fig. 1D and Table 1). VP1 residues involved in sequence-independent interactions with the 3⬘CS⫹ and ala-nine substitution mutants thereof will be referred to as SI residues and SI mutants, respectively. Our data suggest that VP1 SD residues promote dsRNA synthesis indirectly, most probably through recognition of⫹RNA templates and anchor-ing the 3⬘end in an overshot position in the entry tunnel and catalytic site. In contrast, VP1 SI residues appear to contribute more directly to dsRNA synthesis by guiding templates into the catalytic center and positioning them appropriately for cataly-sis. Interestingly, a highly conserved lysine residue located in a narrow region of the template entry tunnel was found to mod-erate both initiation and the kinetics of elongation during dsRNA synthesis. Together, these findings suggest that distinct groups of residues in the template entry tunnel and catalytic site work in concert to ensure that⫹RNA templates are rec-ognized for packaging and that genome segments are polymer-ized at the ideal time and at the appropriate pace during the RV replication cycle.
MATERIALS AND METHODS
Generation of rBVs expressing mutant forms of VP1.Recombinant baculovi-ruses (rBVs) expressing mutant VP1 proteins were made using the BaculoDirect expression system (Invitrogen). The parental pENTR-A-VP1 plasmid and rBVs
expressing wild-type (WT) VP1 with a C-terminal hexahistidine (His) tag or WT VP2 from RV strain SA11 were generated as previously described (23). Point mutations were engineered in the VP1 open reading frame (ORF) in pENTR-A-VP1 by outward PCR using AccuprimePfxSupermix (Invitrogen) and 5⬘ -phosphorylated primers containing specific changes (Table 2). A cDNA cassette encoding nucleotides 1519 to 2267 of the SA11 VP1 ORF with a K594A muta-tion was synthesizedde novoby Blue Heron Biotechnology (Bothell, WA) and ligated into pENTR-A-VP1 by restriction digestion using naturally occurring MluI sites in the VP1 sequence. Following sequence confirmation, the VP1-encoding region was inserted into linearized baculovirus DNA, using the Bacu-loDirect C-Term transfection kit (Invitrogen). rBVs were selected using ganci-clovir and harvested from the medium. The VP1 ORF of rBV working stocks was analyzed by DNA sequencing.
Purification of recombinant VP1 and VP2.His-tagged WT and mutant VP1 proteins were prepared as described by McDonald et al. (23). Briefly, Sf9 cells (1.5⫻107) were infected with the appropriate rBV at a multiplicity of infection of⬃5 PFU/cell and incubated in 1⫻supplemented Grace’s insect medium (Invitrogen) containing 10% fetal bovine serum for 72 h at 23°C or for 96 h at 20°C. Infected cells were pelleted, washed twice with phosphate-buffered saline, resuspended in 10 ml of cold VP1 lysis buffer (25 mM NaHPO4, 200 mM NaCl [pH 7.8]) plus 1⫻Complete, EDTA-free protease inhibitor (Roche), and dis-rupted with sonication. Lysates were centrifuged at 15,000⫻gfor 10 min at 4°C to remove the insoluble fraction, and His-tagged VP1 was absorbed from the soluble fraction by incubation with 150l of cobalt resin (50% slurry in VP1 lysis buffer) (Talon). The resin was washed twice with VP1 lysis buffer, and bound VP1 proteins were eluted with 0.25 ml of lysis buffer containing 300 mM imida-zole. Purified VP1 preparations were dialyzed against low-salt buffer (LSB) (2 mM Tris-HCl [pH 7.5], 0.5 mM EDTA, 0.5 mM dithiothreitol) and stored at 4°C. WT VP2 protein was prepared as described by McDonald et al. (23). Sf9 cells (1.25 ⫻108
) were infected with a VP2-expressing rBV at a multiplicity of infection of⬃5 PFU/cell and incubated in 1⫻supplemented Grace’s insect medium (Invitrogen) containing 10% fetal bovine serum and 0.1% Pluronic F-68 (Invitrogen) for 72 h at 27°C with agitation. Infected cells were pelleted, washed twice with phosphate-buffered saline, and resuspended in 25 ml of LSB contain-ing Complete EDTA-free protease inhibitor. Cells were lysed by incubation with 1% deoxycholic acid in low-salt buffer and sonication. VP2 was pelleted through 35% (wt/vol) sucrose in LSB by centrifugation at 80,000⫻gfor 90 min at 10°C, resuspended in 0.5 ml of LSB, and stored at 4°C.
[image:4.585.45.546.81.279.2]In vitrotranscription of RNA templates for replication assays.cDNA tem-plates for RV SA11 gene 8 transcription were amplified in PCR mixtures con-taining AccuPrimePfxSuperMix (Invitrogen), the SP65g8R vector (43), the 5⬘ primer 5⬘-GCCCTTTAATACGACTCACTATAGGCTTT-3⬘(the T7 promoter is underlined), and the 3⬘primer 5⬘-GGTCACATAAGCGCTTTCTATTC-3⬘. SA11 gene 8⫹RNAs were synthesized from the cDNA templates using an Ambion MEGAscript T7 kit. The transcripts were passed through mini Quick Spin RNA columns (Roche) to remove unincorporated nucleoside triphosphates (NTPs). RNA concentrations were determined by UV spectrophotometry, and TABLE 2. Primers used to engineer mutations in pENTR-A-VP1
Mutation
Primera
Forward Reverse
D127A GAATATACGGCATCACTAATGG CTCCGCTGTTGGAAATAATTCAG
N186A CCAAGGCATGCAGCAAAGTACAG TACGCCATATTTATTTATCGTTGAGGC
N186A/R190A GCAAAGTACGCATATGAATACG TGCATGCCTTGGTACGCC
K188A CCAAGGCATAACGCAGCATACAG TACGCCATATTTATTTATCGTTGAGGC
R190A GCAAAGTACGCATATGAATACG GTTATGCCTTGGTACGCC
S398A TCAATGGCGTCAGCATCGAATGGTGAG TAGTAAACCAGCTAACTCAGAATCTCG
S401A TCAATGTCGTCAGCAGCGAATGGTGAG TAGTAAACCAGCTAACTCAGAATCTCG
K419A TTTCAACTGCAAAGAATATGCATGTCATGG AAATTGTTTTCCTACCAAACTTTAGCTGC
K419 M TTTCAACTATGAAGAATATGCATGTCATGG AAATTGTTTTCCTACCAAACTTTAGCTGC
K419R TTTCAACTCGAAAGAATATGCATGTCATGG AAATTGTTTTCCTACCAAACTTTAGCTGC
K419W TTTCAACTTGGAAGAATATGCATGTCATGG AAATTGTTTTCCTACCAAACTTTAGCTGC
K420A TTTCAACTAAAGCGAATATGCATGTCATGG AAATTGTTTTCCTACCAAACTTTAGCTGC
I461A ACTAGAGCAATATTCATTCTGCC CCTTCTTCCTGGAACATCTCTTC
I462A ACTAGAATAGCATTCATTCTGCC CCTTCTTCCTGGAACATCTCTTC
I464A ACTAGAATAATATTCGCACTGCC CCTTCTTCCTGGAACATCTCTTC
K597A GGAGAGAAACAAACGGCAGCAGC TGATGCTACTGCCCCGTATTG
R701A GAAAAGGCAGGGCAGAGTACG ATTATTAAGTAGATTTATTCCAGCTCG
G702A GAAAAGAGAGCACAGAGTACG ATTATTAAGTAGATTTATTCC
a
Codons containing altered nucleotide sequences are underlined.
on November 7, 2019 by guest
http://jvi.asm.org/
aliquots were resolved by electrophoresis in 6% Tris-borate-EDTA (TBE)–urea gels (Invitrogen) to assess RNA quality.
In vitroRNA replication assay.Reaction mixtures (20l) contained 50 mM Tris-HCl (pH 7.1), 1.5% polyethylene glycol (PEG) 8000, 2.5 mM dithiothreitol, 20 mM magnesium acetate, 1.6 mM manganese chloride, 1.25 mM (each) ATP, CTP, and UTP, 5 mM GTP, 2 U RNase inhibitor (New England Biolabs), 10Ci [␣-32
P]UTP (3,000 Ci/mmol), 8 pmol of SA11 gene 8 RV⫹RNA,⬃2 pmol of VP1, and⬃20 pmol of VP2 (43). After incubation for 3 h at 37°C,32P-labeled gene 8 dsRNA products were resolved by electrophoresis in 12% polyacrylamide gels, detected by autoradiography, and quantified using a phosphorimager. In-tensity values for32
P-labeled gene 8 dsRNA products were normalized to VP1 protein levels in the reaction mixtures. A minimum of two replicate experiments from at least two batches of independently purified VP1 proteins were quantified for statistical analysis. One-samplettests of the mean were performed for each data set using Smith’s statistical package, version 2.80.Pvalues of⬍0.05, in comparison to the set value for WT VP1, were considered statistically significant.
In vitroinitiation and elongation assays.Initiation assays were performed using conditions described previously (43). Briefly, reaction mixtures containing all of the components of RNA replication assays except ATP, CTP, UTP, and [␣-32P]UTP were incubated for 15 min at 37°C to promote initiation complex formation. Sodium chloride (NaCl) was added to 400 mM (or the specified concentration) to prevent further initiation complex formation, followed by ad-dition of 1.25 mM (each) ATP, CTP, and UTP and 10Ci [␣-32
P]UTP (3,000 Ci/mmol). Reaction mixtures were incubated for 1 h to permit elongation, prior to addition of SDS sample buffer. The32
P-labeled gene 8 dsRNA products of initiation assays were analyzed as described above. A minimum of three replicate experiments were quantified for statistical analysis. To assess salt sensitivity, initiation assays were performed as described above, but NaCl was added prior to the 15-min preincubation. To assess minus-strand elongation rates, initiation assays were performed as described above but with the addition of 200 mM NaCl. Reactions were stopped by addition of SDS sample buffer at the indicated time points.
Images.VP1 structure images were generated with the UCSF Chimera mo-lecular modeling system, alpha version 1.3, and Protein Data Bank files 2R7R and 1MWH (18, 37, 41). Images showing32
P-labeled gene 8 dsRNA products of
replication, initiation, salt sensitivity, and elongation assays or amounts of input VP1 protein were trimmed and processed for clarity using Adobe Photoshop CS5, version 12.0. Any adjustments to levels or contrast were applied to entire images.
RESULTS
Mutation of individual VP1 SD residues does not diminish dsRNA synthesis. Interactions with UGUG bases are pre-dicted to help stabilize the 3⬘ ends of ⫹RNAs in the VP1 template entry tunnel and catalytic pocket (18), yet these in-teractions recruit the 3⬘CS⫹into an overshot position (Fig. 1C and E). To determine whether base-specific interactions also have more direct roles in dsRNA synthesis, we expressed VP1 proteins containing individual alanine substitutions of SD res-idues. The residues chosen for mutation have side chains that stack against (Phe416 and Arg190) or side-chain or main-chain atoms that form H bonds with (Asn186, Lys188, Phe416, Arg701, and Gly702) the UGUG bases (Fig. 2A and Table 1). Also included in the study were residues that appear to support the structural integrity of VP1 loops in the vicinity of the U5 and G6 RNA bases (Asp127, Asn186, and Arg701). Polymer-ase activity of the mutant VP1 proteins was assayedin vitro using a 1-kb RV gene 8⫹RNA template. The results showed that the R190A, F416A, R701A, and G702A VP1 mutants catalyzed dsRNA synthesis to levels equivalent to those for WT VP1 (Fig. 2B and C). In contrast, the D127A, N186A, and K188A VP1 mutants directed a modest but significant increase (⬃1.5-fold) in the amount of dsRNA synthesized. These
find-E
F
FIG. 2. Characterization of VP1 SD mutants. (A) Ribbon drawing of VP1 with bound oligonucleotide, colored as in Fig. 1. RNA bases and VP1 SD residues are labeled. (B)32P-labeled gene 8 dsRNA products of a replication assay (upper panel) and Page Blue (Fermentas)-stained
polyacrylamide gel showing input VP1 (lower panel). (C) Bar graph showing levels of dsRNA products. (D)32P-labeled gene 8 dsRNA products
of a replication assay (upper panel) and Page Blue-stained polyacrylamide gel showing input VP1 (lower panel). (E)32P-labeled gene 8 dsRNA
products of an initiation assay (upper panel) and Page Blue-stained polyacrylamide gel showing input VP1 (lower panel). (F) Bar graph showing levels of dsRNA products from replication or initiation assays. In bar graphs, results are shown relative to those for WT VP1. Error bars represent standard deviations.ⴱ,P⬍0.05 compared to set value of 1.0 (red dashed line) for WT VP1.
on November 7, 2019 by guest
http://jvi.asm.org/
ings indicate that individual mutation of SD residues does not critically impair⫹RNA recognition, a prerequisite for dsRNA synthesis, or diminish dsRNA synthesis by another mechanism. The observation that mutation of some residues (Asp127, Asn186, and Lys188) resulted in increased production of dsRNA is consistent with the idea that SD residues function to hold the template in the inactive overshot conformation.
Mutation of multiple VP1 SD residues diminishes dsRNA synthesis.Due to the extensive network of interactions anchor-ing the 3⬘CS⫹in the template entry tunnel, mutation of indi-vidual VP1 SD residues may have an insufficient impact to provide a full picture of their roles in dsRNA synthesis. Thus, we engineered rBVs expressing mutant VP1 proteins in which two (double) (N186A and F416A) or three (triple) (N186A, R190A, and F416A) SD residues were replaced with alanine. Activities of the multipoint mutant polymerases, along with that of the N186A mutant, were assayedin vitro(Fig. 2D). In contrast to our results for individual SD mutants, the double and triple SD mutants exhibited reductions in dsRNA synthe-sis of approximately 2-fold and 20-fold, respectively (Fig. 2D and F). This finding is consistent with previous biochemical assays, which showed that individually the UGUG bases of the 3⬘CS⫹ are of only minimal to intermediate importance for dsRNA synthesis, but as a set they are essential for effective replication and VP1 binding (8, 34, 43). Together with these previous findings, our data suggest that SD interactions pro-mote genome replication primarily through the recognition of viral⫹RNAs.
Initiation is impaired for VP1 multipoint SD mutants.Due to the terminal location of the 3⬘CS⫹in RV⫹RNA, sequence-dependent interactions with VP1 likely affect only early steps in replication, such as template recognition and minus-strand initiation. For RV, initiation is a salt-sensitive process, whereas elongation is salt resistant (9). To assess whether VP1 SD interactions affect initiation complex formation, we performed initiation assays using mutant VP1 proteins. Briefly, the com-ponents of replication assay mixtures, excluding all NTPs but GTP, were preincubated, allowing ample time for initiation complexes to form. Following addition of NaCl, the remain-ing NTPs were added to the reaction mixtures, permittremain-ing elongation but preventing additional initiation. Our results showed that levels of dsRNA produced during the initiation assays were approximately equivalent to those with WT VP1 for the single (N186A) mutant, moderately but significantly reduced for the double mutant, and reduced by 4-fold for the triple mutant (Fig. 2E and F). The finding that dsRNA synthesis is impaired for the VP1 double and triple mutants in initiation assays suggests that UGUG recognition plays a role in the assembly of functional initiation complexes, pos-sibly by recruiting the 3⬘ end of ⫹RNA into the catalytic pocket.
Individual VP1 SI residues contribute to dsRNA synthesis.
[image:6.585.320.516.73.578.2]The high level of conservation among VP1 SI residues, coupled with their proximity to the site of catalysis, suggests that they may be critical for RNA synthesis (Fig. 3A) (18, 23). To de-termine the contributions of these residues to replication, we produced VP1 proteins with individual alanine substitutions of SI residues and assayed the activities of the mutant poly-merasesin vitro. The mutated residues are located primarily in the finger subdomain of VP1 and interact, via H bonds, with
FIG. 3. Characterization of VP1 SI mutants. (A) Ribbon drawing of VP1 with bound oligonucleotide, colored as in Fig. 1. RNA bases, residues that were mutated for experiments shown in panels B to D, motif F, and the P and N sites are labeled. Components of the3 initiation complex, Mn2⫹ions (dark gray spheres) and P- and N-site
NTPs (green stick models), have been modeled in the VP1 structure, based on RdRp superpositioning. (B)32P-labeled gene 8 dsRNA
prod-ucts of a replication assay (upper panel) and Page Blue-stained poly-acrylamide gel showing input VP1 (lower panel). (C)32P-labeled gene
8 dsRNA products of an initiation assay (upper panel) and Page Blue-stained polyacrylamide gel showing input VP1 (lower panel). (D) Bar graph showing levels of dsRNA products from replication or initiation assays, relative to WT VP1. Error bars represent standard deviations.ⴱ,P⬍0.05 compared to set value of 1.0 (red dashed line) for WT VP1.
on November 7, 2019 by guest
http://jvi.asm.org/
the phosphate linkages (Ser398, Ser401, Lys419, Lys420, and Lys594) or riboses (Lys420 and Lys597) of the RNA backbone (Fig. 3A and Table 1). Hydrophobic residues of motif F that stack against A3 (Ile462 and Ile464) also were mutated. An I461A mutant was generated to serve as an internal control for changes near the catalytic site. Ile461 resides in motif F but faces away from the catalytic site, does not interact with RNA, and is not conserved among RV RdRps (Fig. 3A and Table 1) (18, 23). In contrast to results obtained with individual SD mutants, the levels of dsRNA synthesized by many of the SI mutants differed markedly from those of WT VP1 (Fig. 3B and D). In particular, dsRNA levels were reduced by at least 20-fold for the K420A, I462A, and I464A mutants and approxi-mately 10-fold for the K597A mutant. There also were reduc-tions in dsRNA synthesis of 2-fold or less for the S398A, S401A, I461A, and K594A mutants. These findings suggest that the majority of individual SI residues contribute impor-tantly to efficient dsRNA synthesis.
Initiation is impaired for VP1 SI point mutants. To gain insight into the steps of dsRNA synthesis affected by alanine substitution of VP1 SI residues, we assayed polymerase ac-tivity using initiation assays. Our results showed that levels of dsRNA product synthesized by the S398A, I461A, and K594A mutants were not statistically different from wild-type levels (Fig. 3C and D). In contrast, each of the VP1 SI mutants that exhibited a 10-fold or greater reduction in dsRNA product in replication assays (K420A, I462A, I464A, and K597A) also exhibited highly impaired dsRNA synthesis in initiation assays (Fig. 3C and D). For some VP1 SI mutants, including the I461A control, dsRNA synthesis was slightly reduced during replication assays yet equivalent during initiation assays (Fig. 3B to D). The time provided for initiation and elongation during initiation assays vastly exceeds that required for WT VP1 to complete these processes. Together, these observations suggest that some mutant forms of VP1 are capable of initiat-ing replication and elongatinitiat-ing dsRNA products, but small changes in RNA interactions or structure modestly impaired the efficiency of one or both processes. In contrast, for VP1 mutants that were unable to synthesize WT levels of dsRNA during initiation assays, there is likely a critical impairment in initiation complex formation or product elongation.
Lys419 moderates RNA replication by VP1.A remarkable finding of this study was that the K419A mutation enhanced VP1 polymerase activity, raising the possibility that Lys419 moderates the pace of dsRNA synthesis (Fig. 3B). Lys419 is located at the narrowest region of the template entry tunnel, a site that immediately precedes the hollow catalytic center of VP1 (Fig. 4A). The bulkiness of a side chain situated in this position and its attraction to the ribose-phosphate RNA back-bone could hinder the entry and passage of RNA through the tunnel. To identify characteristics of Lys419 that contribute to its function as a moderator of replication, we engineered additional substitution mutations at this position. A methi-onine substitution was made to replace Lys419 with a resi-due of similar size but lacking the basic properties of a lysine side chain. A tryptophan substitution was made to deter-mine whether the presence of a very bulky residue at a narrow region of the template entry tunnel might further restrict dsRNA synthesis. Finally, an arginine substitution was made to determine whether a residue with properties similar to those of
lysine could substitute for its function. The mutant proteins were assayed forin vitroreplication activity. The results of our experiments showed that, similar to the case for the K419A mutant, the K419M and K419R mutants synthesized⬃2- to 3-fold-greater levels of dsRNA than WT VP1 (Fig. 4B and C). In contrast, the K419W mutant demonstrated an
approxi-FIG. 4. Characterization of substitution mutants of VP1 Lys419. (A) Surface cutaway representation of VP1 showing the location of Lys419 (orange spheres) near a constriction in the template entry tunnel. VP1 and RNA are colored as in Fig. 1. P- and N-site NTPs (green sticks) of the3 initiation complex have been modeled in the VP1 structure based on RdRp superpositioning. A black box outlines the area in the upper image that has been magnified in the lower image. (B)32P-labeled gene 8 dsRNA products of a replication assay
(upper panel) and Page Blue-stained polyacrylamide gel showing input VP1 (lower panel). (C) Bar graph showing levels of dsRNA products of replication assays, relative to WT VP1. Error bars represent stan-dard deviations.ⴱ,P⬍0.05 compared to set value of 1.0 (red dashed line) for WT VP1.
on November 7, 2019 by guest
http://jvi.asm.org/
[image:7.585.314.523.70.506.2]mately 3-fold decrease in dsRNA synthesis. These data imply that neither size nor charge alone of a residue at position 419 is sufficient to mediate function. Substitution with tryptophan at position 419 likely diminished VP1 replication activity by severely restricting RNA entry. Taken together, these findings suggest that only a lysine residue at position 419 has the spe-cific chemistry required to appropriately moderate dsRNA synthesis. This conclusion is supported by the observation that Lys419 is highly conserved among RV polymerases (18).
The K419A mutation stimulates initiation. The enhanced replication phenotype observed for the K419A mutant may have resulted from any of several altered capacities, including increased rates of initiation complex formation or minus-strand elongation. To evaluate whether the K419A mutation conferred an enhanced initiation capacity on VP1, we per-formed initiation assays. The experimental results showed that the K419A mutant made approximately 6-fold more dsRNA than WT VP1, suggesting that it had an enhanced capacity to form initiation complexes (Fig. 5A and B). This enhancement likely results from decreased steric hindrance and electrostatic
interactions with the template, allowing the 3⬘ end to more easily move into the catalytic pocket.
While the conditions used in the elongation phase of the initiation assay are known to prevent initiation for WT VP1, we wondered whether initiation for the K419A mutant was equally salt sensitive. To address this question, increasing concentra-tions of NaCl were added to replication assay mixtures prior to addition of NTPs, and salt sensitivity curves were constructed based on the amount of full-length dsRNA product synthe-sized. Our results showed that the K419A mutant, while capa-ble of synthesizing higher levels of dsRNA overall, was equally sensitive to the detrimental effects of salt (Fig. 5C and D). Specifically, in the presence of 200 mM NaCl, levels of dsRNA synthesis were reduced to less than 1% of those with the parental protein in the absence of NaCl. These findings con-firmed that the number of stable initiation complexes formed during preincubation was greater for the K419A mutant than for WT VP1.
The K419A mutant has faster elongation kinetics than WT VP1.Although Lys419 contributes just one of many H bonds between VP1 and the RNA backbone, perhaps this bond is broken and reformed with the next most 5⬘ residue, as a
⫹RNA template moves through the polymerase. These inter-actions could create “drag” on the template RNA molecule, which would be considerably reduced by alanine substitution, resulting in faster template movement through VP1. To deter-mine whether the elongation rate of the K419A mutant, in addition to its initiation efficiency, was higher than that of WT VP1, we performed elongation assays. In these assays, initia-tion of WT VP1 and the K419A mutant was synchronized by preincubation with GTP. The remaining NTPs then were added, and replication was halted at specific time points. The products of the reactions were resolved and visualized to iden-tify the first time point at which full-length dsRNA products could be detected. We found that for WT VP1, full-length gene 8 dsRNA was first detectable after 4 min (Fig. 6A). However, for the K419A mutant, full-length gene 8 dsRNA was observed after 3 min. Since gene 8 is 1,059 nucleotides long, the
maxi-mumin vitro incorporation rate for WT VP1 was 5.8 to 8.7
nucleotides per second, whereas it was 8.8 to 17.3 nucleotides per second for the K419A mutant. Our estimated nucleotide incorporation rate for WT VP1 is consistent with the previ-ously published rate and approximately 4-fold and 10-fold lower than those reported for the RdRps of6 and poliovirus, respectively (7, 38, 43). To compare the population kinetics of dsRNA synthesis by WT VP1 and the K419A mutant, the signals from radiolabeled products of the elongation assay were plotted against time. While levels of dsRNA product had peaked by 6 min for the K419A mutant, levels of dsRNA product were still increasing out to 8 min for WT VP1 (Fig. 6B). Thus, the population kinetics of elongation for K419A exceeded those of WT VP1. Together, these results indicate that, in addition to enhanced replication initiation, the K419A mutant has a higher elongation rate than WT VP1.
DISCUSSION
[image:8.585.77.247.67.370.2]In this study, we have identified multiple functional classes of VP1 template entry tunnel and catalytic center residues that interact with⫹RNAs. The interactions of VP1 SD residues
FIG. 5. Replication initiation by the K419A mutant. (A)32
P-la-beled gene 8 dsRNA products of an initiation assay (upper panel) and Page Blue-stained polyacrylamide gel showing input VP1 (lower panel). (B) Bar graph showing levels of dsRNA products from repli-cation or initiation assays, relative to WT VP1. Error bars represent standard deviations.ⴱ,P ⬍0.05 compared to set value of 1.0 (red dashed line) for WT VP1. (C and D) Salt sensitivity curve for repli-cation initiation. (C)32P-labeled gene 8 dsRNA products from a salt
sensitivity assay. Concentrations of NaCl included in reaction mixtures are indicated. (D) Graph showing levels of dsRNA synthesis, relative to the parental VP1 protein in the absence of NaCl, determined by phosphorimager analysis of the results shown in panel C.
on November 7, 2019 by guest
http://jvi.asm.org/
promote template recognition, which is likely important for RNA packaging and prerequisite for replication. However, these interactions also may regulate the timing of replication, to some degree, through their role in overshot positioning of
⫹RNAs in the catalytic center. Interactions of many VP1 SI residues with ⫹RNA templates enhance dsRNA synthesis. The SI residue Lys419 moderates replication, through its ef-fects on both initiation complex formation and the rate of minus-strand elongation. The combined interactions of these different functional classes of VP1 residues with⫹RNAs may contribute to the coordination of packaging and viral replica-tion and promote dsRNA synthesis at appropriate times and with ideal kinetics.
Role of sequence-dependent interactions in RNA synthesis.
The results of gel shift assays and structural studies of VP1 have shown that interactions with the UGUG bases of the 3⬘CS⫹ are important for specific RNA recognition (18, 43). The results of our experiments using VP1 SD point mutants are consistent with this finding and further suggest that these residues do not directly enhance the efficiency of catalysis. Rather, by anchoring the 3⬘ ends of⫹RNA templates in an overshot position in the catalytic site, SD residues appear to set the stage for downstream events. One caveat to the interpre-tation of our results with single point mutants is that while the side chains of Phe416 and Arg190 stack against RNA bases, their main-chain atoms, as well as the main-chain atoms of Arg701 and Gly702, are the primary participants in H-bond interactions with RNA bases and nearby VP1 residues (Fig. 2A and Table 1). Thus, it is possible that alanine substitutions at these positions did not significantly alter interactions with the UGUG bases. However, interestingly, residues for which
mu-tation resulted in a slight enhancement in dsRNA synthetic activity cluster in a single region of VP1, proximal to G6 (Fig. 2). The side-chain amides of Asn186 and Lys188 form H bonds directly with G6, and Asp127, Asn186, and Lys188 interact with one another extensively (Fig. 2A and Table 1). The slightly enhanced replication observed for the D127A, N186A, and K188A mutants suggests that some sequence-dependent interactions, particularly with G6, tend to moderate or dampen genome replication by holding templates in an overshot posi-tion in the catalytic pocket. One possible explanaposi-tion is that while overall RNA recognition is not negatively impacted, the energy threshold for appropriately positioning the⫹RNA 3⬘ terminus for replication initiation is lower for these mutants, due to the disruption of a small number base-specific contacts. For the multipoint mutants of VP1 SD residues, the ob-served decrease in dsRNA synthesis was most probably due to reduced template recognition, a prerequisite for replication. The results of initiation assays suggest that during the prein-cubation, WT VP1 is capable of forming greater numbers of stable initiation complexes than the double or triple mutants. A likely explanation is that base-specific interactions with the UGUG residues help anchor the 3⬘CS⫹in the VP1 template entry tunnel and catalytic site, increasing the likelihood of initiation complex formation. The N186A mutant exhibited slightly enhanced dsRNA synthesis during replication assays but synthesized amounts of dsRNA indistinguishable from those with WT VP1 during initiation assays (Fig. 2D to F). If, as we hypothesized, the energy threshold for appropriate po-sitioning of the 3⬘CS⫹in the catalytic site were lower for this mutant, we might anticipate a higher initiation rate. However, in our initiation assays, the incubation time allowed for initia-tion complexes to form vastly exceeds that required. Thus, differences between VP1 and the N186A mutant in the rates of initiation, but not the number of stable initiation complexes formed, may have been masked. In such a case, an enhance-ment in the rate of initiation complex formation conferred by the N186A mutation would be detected only in assays in which the polymerase was allowed to support multiple rounds of replication.
Role of sequence-independent interactions in RNA synthe-sis.In this study, all VP1 residues for which individual muta-tion resulted in severe impairments of dsRNA synthesis during replication assays and initiation assays (Lys420, Ile462, Ile464, and Lys597) are located close to the catalytic site of VP1 and interact with the RNA backbone of 3⬘-terminal ACC nucleo-tides of the 3⬘CS⫹(Fig. 3 and Table 1). Substitution of alanine for lysine at position 420 or 597 is anticipated to disrupt strong H bonds between the electropositive side chains and electro-negative RNA ribose-phosphate backbone. Alanine substitu-tion for the isoleucine residue at posisubstitu-tion 462 or 464 likely disrupts hydrophobic stacking interactions with RNA. In either case, a “hole” would be introduced, destabilizing protein-RNA interactions. The alanine side chain and solvent water mole-cules would likely be unable to compensate for lost interac-tions.
[image:9.585.71.255.67.288.2]For WT VP1, SI interactions with the ACC nucleotides appear to keep the phosphate backbone close to the finger wall and the bases flagging outward in a three-way stack that sits directly across from the P and N sites (Fig. 3A). Therefore, it is tempting to speculate that SI interactions are required for
FIG. 6. RNA elongation by the K419A mutant. (A) Signal from
32P-labeled gene 8 dsRNA products of an elongation time course.
Time points (in minutes) at which dsRNA synthesis was stopped are indicated. Short (12-h) and long (21-day) exposures of the same gel are shown. (B) Graph of signal from radiolabeled dsRNA, collected by phosphorimager analysis of the results shown in panel A, versus time, for WT VP1 and the K419A mutant.
on November 7, 2019 by guest
http://jvi.asm.org/
proper alignment of RNA templates for catalysis. Unlike SD interactions, which are thought to function only early during replication, SI interactions between VP1 and RNA likely func-tion to guide and align templates throughout initiafunc-tion and elongation, positioning a new template base across from the N site after each phosphodiester bond is formed in the nascent strand. Based on the highly conserved nature of these residues and their sequence-independent interactions with RNA, it is probable that they serve a similar function for RVs during transcription, as well as replication.
Role of Lys419 in RNA synthesis.In contrast to the case for other VP1 SI residues, our analysis supports a moderating role for Lys419, affecting both replication initiation and elongation. The charged nature of the Lys419 side chain and its location in a narrow region of the template entry tunnel probably limit template access to the hollow catalytic center of VP1 (18). While a lowered replication rate might seem unfavorable for enhancing production of progeny virions, during infection Lys419 may actually streamline genome replication by limiting entry of RNAs into the VP1 catalytic site. In combination with sequence-dependent recognition of the UGUG bases in the 3⬘CS⫹, this limitation of RNA entry could enhance template specificity, shifting the equilibrium toward VP1 association with viral versus nonviral RNAs during assembly and replica-tion. It is also possible that Lys419 enhances VP1 fidelity by moderating the rate of RNA passage through VP1. While, to date, reported mutations or polymorphisms associated with RdRp fidelity are of residues directly or indirectly involved in interactions with incoming nucleotides (1, 2, 7, 14, 15, 17), one can imagine that faster template passage through an RdRp could result in a detrimental increase of misincorporation
events. Although this hypothesis remains to be tested, the highly conserved Lys419 residue seems to have been evolution-arily favored.
[image:10.585.111.473.69.273.2]Model of RVⴙRNA interactions with VP1 during packaging and replication. The results from our study, combined with structural studies of VP1 and biochemical analyses using mu-tagenized⫹RNAs, suggest a model for entry of the 3⬘end of RV⫹RNA into the VP1 catalytic site and replication initiation (Fig. 7) (9, 13, 18, 43). In the model, the electropositive surface near and within the VP1 template entry tunnel attracts the RNA backbone of the 3⬘CS⫹of an RV⫹RNA (Fig. 7A) (23). Sequence-independent interactions between residues of the finger wall of the template entry tunnel and the RNA back-bone likely form and break, permitting the template to slide partially in and out (Fig. 7B). However, the narrowness of the tunnel near Lys419 and its interactions with the RNA back-bone regulate RNA entry into the catalytic site. Eventually, the template moves into a position where VP1 can bind the UGUG bases of the 3⬘CS⫹. SD interactions help to anchor the 3⬘CS⫹in the entry tunnel, with the 3⬘terminal ACC residues protruding into the catalytic center, and are probably impor-tant for RNA packaging (Fig. 7C) (13, 18, 43). However, in this orientation, the template has overshot the register for initia-tion by a single nucleotide, such that C2 and A3 are aligned with the P and N sites, respectively. Holding the template in an overshot position might help to prevent replication from oc-curring prior to packaging the 11 different ⫹RNAs into an assembling core. Upon interaction with VP2, there is a rear-rangement in the catalytic center of VP1 that permits nucleo-tides to be stabilized in the P and N sites and aligned appro-priately with the template (Fig. 7C and D) (9). Replication is
FIG. 7. Model of RV⫹RNA interactions with VP1 during packaging and replication. (A) Attraction of the RNA backbone to the surface near the mouth of the VP1 template entry tunnel. (B) Sequence-independent interactions of the⫹RNA 3⬘end with residues in the entry tunnel and moderation of entry by Lys419. (C) Anchoring and overshot alignment of the 3⬘CS⫹via SD and SI interactions. (D) Induction by VP2 of VP1 conformational rearrangements that permit stabilization of NTPs in the P and N sites, alignment with the template, and phosphodiester bond formation. (E) Minus-strand elongation. The dsRNA products exit VP1 through the dsRNA/⫺RNA exit tunnel (Fig. 1B). For all panels, VP1 is depicted in gray and oriented as in Fig. 4A, the⫹RNA backbone and bases are shown in green, sequence-independent H bonds are blue dashes, and base-specific H bonds are red dashes. Arrows between panels indicate hypothesized kinetics, which have not been experimentally elucidated. The unoccupied P and N sites and the location of Lys419 are indicated. Steps represented by panels A to C are salt sensitive, and those in panels D and E are salt resistant.
on November 7, 2019 by guest
http://jvi.asm.org/
initiated by formation of the first phosphodiester bond of the nascent minus strand (Fig. 7D). Then, sequence-independent interactions of VP1 with RNA guide its passage and alignment in the catalytic site during elongation, and Lys419 moderates this process (Fig. 7E).
Our current findings enhance an understanding of VP1 in-teractions with RNA templates and steps in genome replica-tion, yet several questions and concerns remain. When engi-neering mutations, there is a possibility that an observed loss of function is due to misfolding. Many mutations were of sur-face-exposed residues with side chains that do not interact with other VP1 residues. Furthermore, all mutant proteins were similarly soluble (data not shown), purified to similar levels, and retained at least some activity, suggesting that they are not globally misfolded. While our in vitro findings correlate well with previous biochemical and structural data, the technology to permit determination of the effects of mutations in the template entry tunnel and catalytic site on viral RNA synthesis in the infected host does not exist (8, 9, 34, 43). We also have neither a structure of VP1 actively initiating RNA synthesis or elongating a nascent strand nor the capability to determine the dynamic movements that occur during RNA entry and repli-cation initiation. Future molecular modeling studies and mo-lecular dynamics simulations may provide insight into these processes. In the meantime, an improved understanding of RdRp interactions with RNA templates may provide insight into mechanisms and limitations of RV reassortment, ideas for novel RV reverse genetics strategies, or suggestions regarding the template entry and alignment strategies of other viral poly-merases.
Template recognition by other viral RdRps.While many vi-ruses with segmented dsRNA genomes have conserved 3⬘- and 5⬘-terminal sequences, to date RV VP1 is the only RdRp for which a stretch of sequence-specific interactions between res-idues of the polymerase and a viral RNA template has been observed. Unlike VP1, reovirus3 binds oligonucleotides rep-resenting the 3⬘ends of RNA in the template entry tunnel and catalytic site such that they are in register for initiation (41). Although the3 structure is strikingly similar to that of RV VP1,3 alone is capable of initiating dsRNA synthesis using viral or nonviral templates, and its only clear RNA preference is for the alignment of a C residue across from the P site and a G or U residue in the penultimate position of the template (24, 41). Similar to3, the RdRps ofReoviridaefamily member bluetongue virus andCystoviridaefamily member6 are active
in vitroin the absence of other viral proteins, use ade novo
mechanism of initiation, and prefer to replicate templates with a 3⬘-terminal C residue (4, 6, 20, 21, 39, 40, 45). Taken to-gether, these observations suggest that for segmented dsRNA viruses, template selection and alignment mediated by se-quence-specific interactions of RdRp entry tunnel residues may be a strategy unique to RVs. Alternatively, the available structures of these RdRps may simply have failed to capture the polymerase interacting specifically with a template. Inter-estingly, the templates of many unrelated viruses with seg-mented RNA genomes, including influenza virus, Lassa virus, and lymphocytic choriomeningitis virus, encode highly con-served 3⬘termini that serve as promoters, mutation of which results in diminished RNA synthesis or RdRp binding (3, 10– 12, 16, 19, 28, 35, 42). While it is unclear whether this sequence
specificity is a direct result of sequence-dependent interactions between the RdRp and the promoter, it is possible that these unrelated viruses use a sequence-dependent RNA recognition mechanism similar to that of RV VP1, and the different func-tional classes of VP1 residues involved in interactions with RNA templates may represent a general model for viral RdRp/ RNA interactions. Future studies of RdRp/RNA interactions for a variety of RNA viruses will enhance our understanding of how these enzymes mediate their multiple functions.
ACKNOWLEDGMENTS
We thank Sarah McDonald, Michelle Arnold, and Shane Trask for helpful discussions and critical reading of the manuscript. We thank Tamara Bar-Magen for technical assistance.
This work was supported by the Intramural Research Program of the National Institute of Allergy and Infectious Diseases at the National Institutes of Health.
REFERENCES
1.Arnold, J. J., D. W. Gohara, and C. E. Cameron.2004. Poliovirus RNA-dependent RNA polymerase (3Dpol): pre-steady-state kinetic analysis of ribonucleotide incorporation in the presence of Mn2⫹. Biochemistry 43: 5138–5148.
2.Arnold, J. J., M. Vignuzzi, J. K. Stone, R. Andino, and C. E. Cameron.2005. Remote site control of an active site fidelity checkpoint in a viral RNA-dependent RNA polymerase. J. Biol. Chem.280:25706–25716.
3.Bae, S. H., et al.2001. Structural features of an influenza virus promoter and their implications for viral RNA synthesis. Proc. Natl. Acad. Sci. U. S. A. 98:10602–10607.
4.Boyce, M., J. Wehrfritz, R. Noad, and P. Roy.2004. Purified recombinant bluetongue virus VP1 exhibits RNA replicase activity. J. Virol.78:3994–4002. 5.Bruenn, J. A.2003. A structural and primary sequence comparison of the viral RNA-dependent RNA polymerases. Nucleic Acids Res.31:1821–1829. 6.Butcher, S. J., J. M. Grimes, E. V. Makeyev, D. H. Bamford, and D. I. Stuart. 2001. A mechanism for initiating RNA-dependent RNA polymerization. Nature410:235–240.
7.Castro, C., J. J. Arnold, and C. E. Cameron.2005. Incorporation fidelity of the viral RNA-dependent RNA polymerase: a kinetic, thermodynamic and structural perspective. Virus Res.107:141–149.
8.Chen, D., M. Barros, E. Spencer, and J. T. Patton.2001. Features of the 3⬘-consensus sequence of rotavirus mRNAs critical to minus strand synthe-sis. Virology282:221–229.
9.Chen, D., and J. T. Patton.2000. De novo synthesis of minus strand RNA by the rotavirus RNA polymerase in a cell-free system involves a novel mech-anism of initiation. RNA6:1455–1467.
10.Crow, M., T. Deng, M. Addley, and G. G. Brownlee.2004. Mutational anal-ysis of the influenza virus cRNA promoter and identification of nucleotides critical for replication. J. Virol.78:6263–6270.
11.Fodor, E., and G. G. Brownlee.2002. Influenza virus replication, p. 1–30.In C. W. Potter (ed.), Influenza. Elsevier Science, Amsterdam, Netherlands. 12.Fodor, E., B. L. Seong, and G. G. Brownlee.1993. Photochemical
cross-linking of influenza A polymerase to its virion RNA promoter defines a polymerase binding site at residues 9 to 12 of the promoter. J. Gen. Virol. 74:1327–1333.
13.Gallegos, C. O., and J. T. Patton.1989. Characterization of rotavirus repli-cation intermediates: a model for the assembly of single-shelled particles. Virology172:616–627.
14.Gohara, D. W., J. J. Arnold, and C. E. Cameron.2004. Poliovirus RNA-dependent RNA polymerase (3Dpol): kinetic, thermodynamic, and struc-tural analysis of ribonucleotide selection. Biochemistry43:5149–5158. 15.Gohara, D. W., et al.2000. Poliovirus RNA-dependent RNA polymerase
(3Dpol): structural, biochemical, and biological analysis of conserved struc-tural motifs A and B. J. Biol. Chem.275:25523–25532.
16.Hass, M., et al.2006. Mutational analysis of the Lassa virus promoter. J. Virol.80:12414–12419.
17.Korneeva, V. S., and C. E. Cameron.2007. Structure-function relationships of the viral RNA-dependent RNA polymerase: fidelity, replication speed, and initiation mechanism determined by a residue in the ribose-binding pocket. J. Biol. Chem.282:16135–16145.
18.Lu, X., et al.2008. Mechanism for coordinated RNA packaging and genome replication by rotavirus polymerase VP1. Structure16:1678–1688. 19.Luytjes, W., M. Krystal, M. Enami, J. D. Parvin, and P. Palese.1989.
Amplification, expression, and packaging of foreign gene by influenza virus. Cell59:1107–1113.
20.Makeyev, E. V., and D. H. Bamford.2000. Replicase activity of purified recombinant protein P2 of double-stranded RNA bacteriophage phi6. EMBO J.19:124–133.
on November 7, 2019 by guest
http://jvi.asm.org/
21.Makeyev, E. V., and D. H. Bamford.2000. The polymerase subunit of a dsRNA virus plays a central role in the regulation of viral RNA metabolism. EMBO J.19:6275–6284.
22.McClain, B., E. Settembre, B. R. Temple, A. R. Bellamy, and S. C. Harrison. 2010. X-ray crystal structure of the rotavirus inner capsid particle at 3.8 A resolution. J. Mol. Biol.397:587–599.
23.McDonald, S. M., D. Aguayo, F. D. Gonzalez-Nilo, and J. T. Patton.2009. Shared and group-specific features of the rotavirus RNA polymerase reveal potential determinants of gene reassortment restriction. J. Virol.83:6135– 6148.
24.McDonald, S. M., Y. J. Tao, and J. T. Patton.2009. The ins and outs of four-tunneled Reoviridae RNA-dependent RNA polymerases. Curr. Opin. Struct. Biol.19:775–782.
25.Ng, K. K., J. J. Arnold, and C. E. Cameron.2008. Structure-function rela-tionships among RNA-dependent RNA polymerases. Curr. Top. Microbiol. Immunol.320:137–156.
26.O’Reilly, E. K., and C. C. Kao.1998. Analysis of RNA-dependent RNA polymerase structure and function as guided by known polymerase structures and computer predictions of secondary structure. Virology252:287–303. 27.Parashar, U. D., et al. 2009. Global mortality associated with rotavirus
disease among children in 2004. J. Infect. Dis.200(Suppl. 1):S9–S15. 28.Park, C. J., S. H. Bae, M. K. Lee, G. Varani, and B. S. Choi.2003. Solution
structure of the influenza A virus cRNA promoter: implications for differ-ential recognition of viral promoter structures by RNA-dependent RNA polymerase. Nucleic Acids Res.31:2824–2832.
29.Patton, J. T.1996. Rotavirus VP1 alone specifically binds to the 3⬘end of viral mRNA, but the interaction is not sufficient to initiate minus-strand synthesis. J. Virol.70:7940–7947.
30.Patton, J. T., M. T. Jones, A. N. Kalbach, Y. W. He, and J. Xiaobo.1997. Rotavirus RNA polymerase requires the core shell protein to synthesize the double-stranded RNA genome. J. Virol.71:9618–9626.
31.Patton, J. T., L. S. Silvestri, M. A. Tortorici, R. Vasquez-Del Carpio, and Z. F. Taraporewala.2006. Rotavirus genome replication and morphogenesis: role of the viroplasm. Curr. Top. Microbiol. Immunol.309:169–187. 32.Patton, J. T., R. Vasquez-Del Carpio, and E. Spencer.2004. Replication and
transcription of the rotavirus genome. Curr. Pharm. Design.10:3769–3777. 33.Patton, J. T., R. Vasquez-Del Carpio, M. A. Tortorici, and Z. F.
Tarapore-wala.2007. Coupling of rotavirus genome replication and capsid assembly. Adv. Virus Res.69:167–201.
34.Patton, J. T., M. Wentz, J. Xiaobo, and R. F. Ramig.1996.cis-acting signals that promote genome replication in rotavirus mRNA. J. Virol.70:3961–3971. 35.Perez, M., and J. C. de la Torre.2003. Characterization of the genomic promoter of the prototypic arenavirus lymphocytic choriomeningitis virus. J. Virol.77:1184–9114.
36.Pesavento, J. B., S. E. Crawford, M. K. Estes, and B. V. Prasad.2006. Rotavirus proteins: structure and assembly. Curr. Top. Microbiol. Immunol. 309:189–219.
37.Pettersen, E. F., et al.2004. UCSF Chimera—a visualization system for exploratory research and analysis. J. Comput. Chem.25:1605–1612. 38.Poranen, M. M., et al.2008. Structural explanation for the role of Mn2⫹in
the activity of phi6 RNA-dependent RNA polymerase. Nucleic Acids Res. 36:6633–6644.
39.Salgado, P. S., et al.2004. The structural basis for RNA specificity and Ca2⫹ inhibition of an RNA-dependent RNA polymerase. Structure12:307–316. 40.Sarin, L. P., et al.2009. Insights into the pre-initiation events of
bacterio-phage phi 6 RNA-dependent RNA polymerase: towards the assembly of a productive binary complex. Nucleic Acids Res.37:1182–1192.
41.Tao, Y., D. L. Farsetta, M. L. Nibert, and S. C. Harrison. 2002. RNA synthesis in a cage—structural studies of reovirus polymerase lambda3. Cell 111:733–745.
42.Tiley, L. S., M. Hagen, J. T. Matthews, and M. Krystal.1994. Sequence-specific binding of the influenza virus RNA polymerase to sequences located at the 5⬘ends of the viral RNAs. J. Virol.68:5108–5116.
43.Tortorici, M. A., T. J. Broering, M. L. Nibert, and J. T. Patton.2003. Template recognition and formation of initiation complexes by the replicase of a segmented double-stranded RNA virus. J. Biol. Chem. 278:32673– 32682.
44.Trojnar, E., P. Otto, B. Roth, J. Reetz, and R. Johne.2010. The genome segments of group D rotavirus possess group A-like conserved termini but encode group-specific proteins. J. Virol.84:10254–10265.
45.Wehrfritz, J. M., M. Boyce, S. Mirza, and P. Roy.2007. Reconstitution of bluetongue virus polymerase activity from isolated domains based on a three-dimensional structural model. Biopolymers86:83–94.