Copyright © 1997, American Society for Microbiology
Transcription of Hepatitis B Virus in Peripheral Blood Mononuclear
Cells from Persistently Infected Patients
SIMONE STOLL-BECKER,
1REINALD REPP,
1* DIETER GLEBE,
2STEPHAN SCHAEFER,
2JOACHIM KREUDER,
1MICHAEL KANN,
2FRITZ LAMPERT,
1AND
WOLFRAM H. GERLICH
2Departments of Pediatrics
1and Medical Virology,
2Justus-Liebig-University,
D-35392 Giessen, Germany
Received 4 November 1996/Accepted 26 March 1997
Hepatitis B virus (HBV) has been reported to exist in peripheral blood mononuclear cells (PBMC), but it
is not clear whether it replicates there. A precondition for replication should be the formation of covalently
closed viral DNA and transcription of all essential viral mRNAs. The mRNAs of HBV form a nested box with
common 3
*
ends. In order to detect even low levels of potential replication, we developed a quantitative reverse
transcription-PCR method for detection of a smaller HBV mRNA species in the presence of the larger ones. All
three highly viremic patients tested so far had mRNAs for the large and the small surface proteins and the X
protein of the virus within PBMC but not in the virus from their sera. Furthermore, we detected by PCR
covalently closed viral DNA in their PBMC. These data suggest that HBV may be not only taken up but also
replicated by mononuclear blood cells and that these cells may be an extrahepatic site of viral persistence. X
mRNA was detected in the largest amount. Possibly, X protein interferes with functions of the mononuclear
cells during the immune response against the virus.
Hepatitis B virus (HBV) and other hepadnaviruses are
gen-erally considered to be highly hepatotropic. Nevertheless,
small amounts of HBV-specific nucleic acids can be detected in
many extrahepatic tissues during acute and chronic infection
(3, 5, 8, 11–14, 21, 29, 32, 37, 39, 45, 46, 54, 55). Furthermore,
there is evidence of extrahepatic HBV persistence in HBV
carriers after liver transplantation (20, 21, 33, 35, 36, 38, 44, 56,
64). A better understanding of HBV latency after liver
trans-plantation is of high clinical relevance. Several authors have
used peripheral blood mononuclear cells (PBMC) to study
HBV infection in nonhepatic tissues because PBMC are easily
available. Moreover, infection of these cells by HBV could
interfere with the host’s immune defense against the virus and
support the establishment of HBV persistence (22, 23).
Ad-sorption of HBV to PBMC seems to be a receptor-mediated
process (23, 24, 43, 46). Whether further steps of HBV
repli-cation, such as internalization, uncoating, and genome
comple-mentation to a double-stranded covalently closed circular
DNA (cccDNA) molecule, can be supported by human
non-hepatocytes is still a subject of controversy (29). As the
expres-sion of viral genes in a host cell is a basic requirement for the
replication of any virus, it should be possible to detect HBV
mRNAs in those cells if, indeed, HBV replication takes place.
Detection and characterization of HBV gene expression in
nonhepatocytes, however, are difficult for several reasons.
First, the amount of HBV-specific nucleic acids and the
num-ber of infected cells to be expected are very low compared to
those for hepatocytes infected with the virus. Second, it is
difficult to discriminate between newly synthesized HBV DNA
or RNA and virus-specific nucleic acids simply originating
from viral particles adsorbed to the cell surface. To obtain a
sufficient sensitivity, PCR has been applied in several studies.
This technique allows detection of the HBV DNA genome or
its RNA transcripts in general (3, 5, 21, 39, 45). However, to
date knowledge about the transcriptional pattern of HBV in
nonhepatocytes is incomplete, because it is difficult to
distin-guish the four known mRNA species of HBV by conventional
reverse transcription-PCR (RT-PCR). Those studies are
com-plicated by replicative RNA containing intermediates
gener-ated during the replication cycle and by the coterminal nature
of the HBV RNA transcripts. The complete sequence of each
of the four HBV RNA transcripts designated X (0.65 kb), S
(2.1 kb), pre-S (2.4 kb), and C-E or pregenome (3.5 kb) is also
found at the 3
9
terminus of the next larger one (42, 59, 62). It
is well established that the C-E, pre-S, and S transcripts are
essential for HBV replication (42). The necessity for X mRNA
and X protein is not yet known. They may be dispensable in
HBV-transfected cells (9). In transgenic mice, the X gene
seems to be relevant for the expression of HBV genes in the
liver but not in other tissues (41). The HBV X gene product
may transactivate a broad variety of other genes, including
HLA genes (26) and genes coding for cytokines, possibly by
interacting with cellular transcription factors (57). Whatever
the function of X protein may be, it would be interesting to
know whether its mRNA is expressed in PBMC from HBV
carriers. We have devised a differential PCR protocol,
desig-nated paired comparative PCR (pcPCR), which allows
quan-titation and distinction of the four major HBV mRNAs in
PBMC from chronic HBV carriers, and we have confirmed its
validity by use of numerous controls. In addition, we applied a
highly sensitive PCR approach to discriminate between the
HBV relaxed circular DNA (rcDNA) genome present in
viri-ons and the cccDNA generated by the DNA repair machinery
of the host cell nucleus. The rcDNA form of the circular HBV
genome of about 3.2 kb is only partially double stranded, and
neither the plus strand nor the minus strand is covalently
closed. Due to its structure, it cannot directly serve as a matrix
for RNA transcription. Generation of cccDNA is essential for
HBV gene expression and replication. Therefore, detection of
cccDNA in a host cell indicates that the first steps of virus
replication took place (25, 29, 42, 63).
* Corresponding author. Mailing address: Department of Pediatrics,
Justus-Liebig-University, Feulgenstr. 12, D-35392 Giessen, Germany.
Phone: 49 641 99 43410. Fax: 49 641 99 43419.
5399
on November 9, 2019 by guest
http://jvi.asm.org/
MATERIALS AND METHODS
Clinical samples.PBMC and sera were obtained from three patients, age 12, 21, and 22 years. They all had been infected with HBV in an endemic outbreak at the oncology unit of the Children’s University Hospital, Giessen, Germany, from 1984 to 1986 while undergoing multidrug anticancer chemotherapy for leukemia or other malignant diseases (6). A patient-to-patient transmission of the virus had been demonstrated (51). All sera of the three patients included in the present study were positive for hepatitis B surface antigen, hepatitis B e antigen, and HBV DNA. HBV DNA titers were persistently higher than 109 genomes/ml of serum. Liver biopsies had revealed a normal histology or at most a minimal hepatitis with some ground-glass hepatocytes but no signs of inflam-mation. Furthermore, clinical signs of hepatitis or significant elevation of the liver enzymes were never detected in these patients, although they were exam-ined carefully in accordance with the guidelines of the cancer therapy protocols (52, 53).
Preparation of cells and HBV particles.PBMC were harvested from hepa-rinized whole blood by centrifugation over a Ficoll-Hypaque (Fresenius, Bad-Homburg, Germany) gradient. The mononuclear nonadherent cell fractions from two patients were further enriched for B cells or T cells by positive selection with magnetic beads (Dynabeads M-450; Dynal, Hamburg, Germany) coated with monoclonal mouse anti-CD 19 or mouse anti-CD 2, respectively, according to the manufacturer’s recommendations. For harvesting of HBV particles, 1 ml of the patients’ sera was diluted with 3 ml of phosphate-buffered saline and subjected to ultracentrifugation through a cushion of 0.5 ml of 10% sucrose (Beckman SW60Ti rotor; 2 h, 4°C, 50,000 rpm) (49). The pellets were dissolved in 20ml of sterile water. Prior to the purification of DNA or RNA, 10ml of the resuspended virus was added to 107PBMC from HBV-negative donors in order to use the cellular nucleic acids as a carrier during the purification and precip-itation steps. Pure PBMC from HBV-negative donors were included in each experiment as a negative control.
Purification of RNA and synthesis of cDNA.Poly(A)1RNA was purified by using the Quick Prep mRNA purification kit (Pharmacia, Freiburg, Germany) according to the manufacturer’s guidelines. The RNA pellet corresponding to 106cells (for B cells and T cells) or 107cells (for whole PBMC preparations) was dissolved in 15ml of sterile water containing RNasin (Promega, Madison, Wis.) at 1 U/ml. Seven microliters of different dilutions was subjected to RT. After denaturation of the RNA at 70°C for 5 min, the cDNA synthesis was carried out at 37°C for 60 min in a total volume of 20ml with 100 pmol of random hexamer primers (Boehringer, Mannheim, Germany) and 200 U of Moloney murine leukemia virus reverse transcriptase (Gibco/BRL, Paislay, United Kingdom) as described previously (10).
DNA extraction.Approximately 106B cells, 106T cells, or 107PBMC, as well as mixtures of 105sucrose-gradient purified HBV particles with PBMC from HBV-negative individuals, were suspended in 1 ml of 50 mM MOPS [3-(N-morpholino)-propanesulfonic acid] (Sigma, Deisenhofen, Germany) buffer, pH 7.0. The samples were treated with proteinase K in the presence of sodium dodecyl sulfate as previously described (49). HBV DNA was purified by ion-exchange chromatography with a Quiagen 20 column (Diagen, Du¨sseldorf, Ger-many) according to the manufacturer’s protocol (19). Magnetic beads were removed from B-cell or T-cell preparations by trapping them in a magnetic field. Before removal of sodium dodecyl sulfate by precipitation with potassium ace-tate and loading the samples onto the column, the chromosomal DNA was sheared by passing the sample fluid 20 times through a 20-gauge needle. Finally, the DNA pellet was dissolved in sterile water at a concentration of 80 ng/ml.
Digestion of DNA with mung bean nuclease for detection of cccDNA.Ten microliters of PBMC DNA (800 ng) was dissolved in sterile double-distilled water and added to 10ml of a reaction mixture containing 20 U of mung bean nuclease (Calbiochem, Bad-Soden, Germany) in 2 mM ZnCl2–100 mM Na acetate (pH 5.0)–60 mM NaCl according to a previously published procedure (34) with some modifications. After incubation at 37°C for 30 min, the reaction was stopped with 2.5ml of EGTA (100 mM, pH 7.4). Five microliters was used as the template during the first round of nested PCR as described below for detection of cccDNA.
PCR primer selection.PCR primers purified by reverse-phase high-perfor-mance liquid chromatography were purchased commercially (Roth, Karlsruhe, Germany). Primer sequences were chosen according to the sequence of the HBV isolate which had infected all three patients (EMBL accession number Y07587). Compared to this sequence, the HBV subtype ayw published by Bichko et al. (7) had the highest homology (98.7%) among all other HBV sequences published to date. The presence of an identical HBV nucleotide sequence in all patients was an important precondition of this study, because variations at the PCR primer binding regions could cause false-negative results or reduce amplification effi-ciencies. The primer sequences are shown in Table 1. Their positions in the HBV genome and in the four RNA transcripts are shown schematically in Fig. 1. Primers P1 to P16 were used to determine the expression of the different HBV RNA molecules. The sequence included in primers P1 to P4 is present in all four RNA transcripts of the virus. This primer set was designated X (Fig. 1 and Table 1) because it is the only one to anneal with sequences of the X mRNA of 0.65 kb. Primers P5 to P8 cannot anneal with the X mRNA but can anneal with any of the three larger ones. This set was designated S. Primers P9 to P12 (designated pre-S) should reveal a PCR product only if the two groups of largest HBV RNA
transcripts, of about 2.4 and 3.5 kb, are present in the sample. Finally, P13 to P16 are specific for the 3.5-kb HBV RNAs, which serve as an RNA pregenome during replication of the HBV genome, as mRNA for the hepatitis B core and the viral polymerase, and for synthesis of the e protein (42). This set of primers was named C-E. For pcPCR two primer pairs covering a different number of HBV mRNA classes were applied together in the same reaction tube. For example, set X (P1 to P4), covering all four mRNAs, was used together with set S (P5 to P9), covering three mRNAs. Primers P17 to P20 (designated S-39) were applied in a control reaction to detect possible artifacts due to different distances between the positions of the PCR primer sets and the ends of the mRNA molecules. Theoretically, longer distances between the RNA 39ends and the PCR primer positions might improve the efficacy of random priming by providing more space for random hexamer nucleotides to bind and initiate cDNA synthe-sis. The distance between the PCR primer positions and the mRNA 59ends might become relevant if partial digestion by exonucleases occurred. To check these possibilities, primers P5 to P8 (set S) were used together with primers P17 to P20 (set S-39). Both sets of primers are able to detect all HBV RNAs except the smallest one. However, primers of set S-39are located at a central region of the 2.1-kb RNA about 600 nucleotides closer to its 39end than primers of set S. Provided that pcPCR is not affected by the different locations of these primer sets, PCR products should be generated in a ratio of 1 to 1 if set S and set S-3 are used together.
Primers P23 to P26 were selected to discriminate between the rcDNA genome of HBV particles and HBV cccDNA present in the nuclei of infected host cells, as previously described (34). HBV rcDNA contains two regions sensitive to digestion with mung bean nuclease: the single-stranded area, which covers about 10 to 60% of the genome length, and a nick within the minus strand around position 1820. Sense primers P23 and P25 are located within the single-stranded region of HBV rcDNA. If they are used together with the antisense primers P24 and P26, amplification runs across the minus-strand nick of HBV rcDNA in both rounds of nested PCR. After digestion of the PCR templates with mung bean nuclease, a positive signal should be obtained only from HBV cccDNA present in cells supporting HBV replication and not from rcDNA originating from viral particles (Table 1 and Fig. 1).
PCR amplification.pcPCR was carried out with a nested PCR protocol to improve sensitivity and specificity. A hot start was not performed because HBV particles contain an incomplete DNA plus strand. During heating to 94°C at the first cycle, Taq polymerase elongates this strand. Variable lengths of single-stranded regions of the HBV genome otherwise might compromise pcPCR with DNA samples. During the first round of nested PCR, 30 amplification cycles of 105 s at 94°C, 90 s at 60°C, and 90 s at 72°C (with a 3-s extension per cycle, except for 10 min during the last cycle) were carried out in a 50-ml final volume containing 4 pmol of each primer. One microliter of the first-round product was subjected to the second round. It differed from the first round by the number of cycles, which was reduced to 20, and the amounts of primers (20 pmol each). PCR cycling was performed in a Bio-Med Thermocycler 60 (Bio-Med, Theres, Germany) with a GeneAmp kit (Perkin-Elmer, U¨ berlingen, Germany). The products of pcPCR were subjected to quantitative post-PCR analysis with the GENESCAN 672 software on an Applied Biosystems model 373A Automated DNA Sequencer (Perkin-Elmer/Applied Biosystems Division [PE/ABI], Foster City, Calif.).
For detection of cccDNA, a modified nested PCR assay was performed. Samples were overlaid with a drop of mineral oil (Sigma, St. Louis, Mo.) before addition of the templates. After an initial melting step of 3 min at 94°C, 35 cycles (first round) or 30 cycles (second round) of 1 min at 94°C, 1 min at 60°C, and 1 min at 73°C were carried out. During the final cycle, the extension step was prolonged to 5 min. Two microliters of the first-round product was used as the template for the second round of PCR. During the first PCR round, the MgCl2 concentration was increased from 1.5 to 4 mM. The amounts of PCR primers were 10 pmol each in both rounds. All other conditions remained as described for pcPCR.
GENESCAN analysis.One microliter of the second-round products of nested pcPCR was subjected to automatic fluorescence-based post-PCR analysis as described previously (48). Quantitative analysis by calculation of the peak area corresponding to each of the two products of a pcPCR was performed with an Apple MacIntosh IIci computer with the GENESCAN 672 software (ABI/PE). Analysis was carried out within the linear range of the system, which covers 3 orders of magnitude.
RESULTS
pcPCR.
Only the largest transcript, which encodes hepatitis
B core or e protein and the viral polymerase, can be
deter-mined directly by RT-PCR because it contains a sequence at its
5
9
end which is not present in the smaller HBV mRNAs (50).
To study the presence of the smaller HBV RNAs, we have
developed a quantitative assay based on comparative RT-PCR.
Assuming that all four HBV mRNAs are transcribed in an
infected cell, the nucleotide sequence of the smallest
on November 9, 2019 by guest
http://jvi.asm.org/
script, which is also present at the 3
9
terminus of all of the
other ones, should give rise to the largest amount of
amplifi-cation product. The nucleotide sequence present in only three
of the mRNAs should lead to the second-highest amount of
PCR product, and so on. Based on these considerations, a
primer set covering n classes of HBV mRNAs and another
primer set covering n
1
1 classes of mRNAs were applied
together in a single pcPCR tube. For example, set S was used
together with set X (Fig. 1 and Table 1). The amount of PCR
product generated by each set of primers was calculated
quan-titatively by integration of the fluorescent light signal for the
amplification product in the GENESCAN evaluation. Figure 2
shows a graphical display of the pcPCR results from PBMC
from patient 1. The value obtained with the primer set covering
the RNA of interest and, implicitly, all of the larger HBV RNA
species (n
1
1), was divided by the value obtained with the
simultaneously applied primer set covering only the larger
HBV mRNAs (n) (Table 2), and the results were displayed on
a semilogarithmic scale (Fig. 3). A ratio significantly greater
than 1 indicates that the RNA of interest was present in the
reaction tube.
However, variations of this ratio due to methodological
in-stabilities also have to be considered. Thus, we first examined
which ratios were generated by pcPCR if preparations
contain-ing only PBMC DNA were tested. Furthermore, HBV DNA or
HBV RNA from virus particles was analyzed. The 15
determi-nations with primer sets X-S, S–pre-S, and pre-S–C-E with
PBMC DNA as a template yielded values of between 0.72 and
1.27 (Table 2). The arithmetic mean value
6
standard
devia-tion (SD) was 1.01
6
0.14. The mean values for HBV DNA
from cell extracts (1.01) and from virus particles (1.05) were
not significantly different, suggesting that the cells did not
contain large proportions of 5
9
- or 3
9
-terminal subgenomic
DNA fragments. Furthermore, the data showed that pcPCR is
a relatively precise method. The highest value for the upper
limit of the 95% confidence interval for a ratio generated by
samples which should contain all PCR target sequences in
equal amounts (PBMC DNA, virion DNA, virion RNA, or
pcPCR with primer set S–S-3
9
) was 1.43. Thus, ratios higher
than 1.43 are indicative of the existence of a smaller mRNA
detected by only one pair of pcPCR primers together with
larger ones detected by both sets of primers (Fig. 3).
[image:3.612.59.556.82.392.2]Validation by analysis of HBV poly(A)
1RNA preparations
derived from viral particles from the same patients is of further
relevance for discrimination between intracellular de novo
syn-thesis of HBV nucleic acids and specific nucleic acids derived
TABLE 1. Sequences of PCR primers
aPrimer characteristics
Primer set designation
Second-round product size
(bp)
Sense primers Antisense primers
Name Nucleotide sequence Position Name Nucleotide sequence Position
P1 59GCTAGGCTGTGCTGCCAACTGG 1382–1403 P2 59 GGGGAGTCCGCGTAAAGAGAGG 1552–1531 X 111
P3 59 CGCGGGACGTCCTTTGTTTACG 1410–1431 P4 59 GGTCGGTCGAAACGGTAGACGG 1520–1499
P5 59 AGAACATCACATCAGGATTCCTAGG 161–185 P6 59 GAGGACAGGAGGTTGGTGAGTG 355–334 S 142
P7 59 CCCCTGCTCGTGTTACAGGCG 187–207 P8 59 AGGTTGGGGACTGCGAATTTTGG 328–306
P9 59 AATCTTTCCACCAGCAATCCTCTG 2859–2882 P10 59 GGAGGCGGATTTGCTGGCAACG 3097–3076 pre-S 181
P11 59 CCCGACCACCAGTTGGATCCAG 2892–2913 P12 59 CTAGTATGCCCTGAGCCTGAGG 3072–3051
P13 59 TCAATCTCGGGAATCTCAATGTTA 2430–2454 P14 59 CCTAGCAGGCATAATCAATTGCAG 2650–2627 C-E 157
P15 59 TATTCCTTGGACTCATAAGGTGGG 2455–2478 P16 59 GACTGTGAGTGGGCCTACAAATTG 2611–2588
P17 59 TATTGGGGGCCAAGTCTGTACAG 754–776 P18 CTTTGATTTTTTGTATGATGTGATCTTG 942–915 S-39 136
P19 59 ATCTTGAGTCCCTTTTTACCGCTG 778–801 P20 59 GGCAATGACCCATAACATCCAATG 913–890
P1 59 GCTAGGCTGTGCTGCCAACTGG P21 59 AGAGCTGAGGCGTGATCTAGAAG 2012–1990 Multimer 574
P3 59 CGCGGGACGTCCTTTGTTACG P22 59 TACTGAAGGAAAGAAGTCAGAAGG 1983–1960
P23 59 CTGAATCCCGCGGACGACCC 1443–1462 P24 59 ACCCAAGGCACAGCTTGGAGG 1891–1871 cccDNA 297
P25 59 GTCTGTGCCTTCTCATCTGCC 1553–1573 P26 59 AGATGATTAGGCAGAGGTGAAAAA 1846–1823
P27 59-Biotin-GCACATACGATTTAGGTGAC ACTATAGAATACAGCCTCCTGCCTC TACCAATCGCAAGTCAG
3092–3120 P28 59 TTTTTTTTTTTTTTTTTGCGCAGA CAATTTATGCCTACAGCCTCCTA
1806–1776 sS 1,914
P29 59-Biotin-GCACATACGATTTAGGTGAC ACTATAGAATACAGTATTCAGTCGA AGCAGGCTTTTACTTTCTCG
1072–1103 P28 59 TTTTTTTTTTTTTTTTTGCGCAGA CCAATTTATGCCTACAGCCTCCTA
1806–1776 sX 752
aPrimers of the same polarity as HBV mRNAs are sense primers. Nucleotide positions are numbered in the sense direction according to the sequence with EMBL accession number Y07587. As the unique EcoRI restriction site found in most HBV subtypes is not present in this sequence, numbering starts at the homologous site. In the last column the size of the second-round product of each nested PCR set is given. Primers carrying the fluorescent dye FAM (6-carboxy-fluorescein) at their 59ends to generate labelled fragments for quantitative post-PCR analysis are in boldface. Primers P1 to P16 were used to determine the expression of the four different HBV-RNA transcripts. P1-P2, P5-P6, P9-P10, and P13-P14 were applied in the first round, and the other ones were applied in the nested PCR. Primers P17 to P20 were applied in a control reaction. Primers P21 and P22 were combined with P1 and P3, respectively, in order to detect any multimers of the pregenomic HBV RNA. Primers P23 to P26 were applied in a nested PCR to detect cccDNA of HBV. Primer combinations P27-P28 and P29-P28 were applied in a long-PCR protocol to generate DNA templates for construction of the two RNA standards sS (1,914 bp) and sX (752 bp) by in vitro transcription (47). The SP6 promoter sequences are underlined. At the 59end of P28 there is an oligod(T) 17-mer to create a poly(A) tail at the 39ends of the RNA standards.
on November 9, 2019 by guest
http://jvi.asm.org/
from adsorbed or phagocytosed virions. Because the
encapsi-dation signal of the RNA pregenome is at its 5
9
end (28) and
poly(A)
1RNA was analyzed, only full-length or spliced RNA
molecules should be in the virion extracts. The mean value (
6
SD) of the GENESCAN assay (Table 2) was 1.15
6
0.14. This
result shows that smaller RNAs were not present in detectable
amounts. Spliced pregenomes or DNA derived from them
would lead to values different from 1 if a primer binding site
was affected. A mean value of 1.15 is not significantly higher
than the one for HBV DNA. Except for two determinations, all
pcPCR ratios obtained for mRNAs from PBMC, B cells, or T
cells were significantly higher (P
.
95%). However, the
exis-tence of X mRNA in T cells from patient 3 and the exisexis-tence
of pre-S RNA in T cells from patient 2 could not be proven.
Figure 3 shows a graphical display of the results of pcPCR. The
poly(A)
1RNA extract from serum-derived viral particles and
all cellular poly(A)
1RNA extracts contained C-E sequences.
The ratio of pre-S RNA to C-E RNA was relatively high in B
cells and total PBMC (4.4 to 5.1) and lower in T cells (1.4 and
2.6). While the C-E RNA could be derived from adherent or
ingested virions, the pre-S RNA had to be generated by de
novo transcription. The ratio for pre-S to S RNA was again
very high in total PBMC from patient 1 (11.1) and in B cells
(6.0 and 3.5) and was lower but still well above 1 in T cells (4.1
and 2.9). The lowest ratios were found for the X to S RNAs.
The PBMC from patient 1 and the B cells from patients 2 and
3 had still easily detectable amounts of short X RNA, while the
result was borderline with T cells from patient 2 and was not
significantly higher than 1 for T cells from patient 3. This does
not mean that X mRNA is present at the lowest
concentra-tions, because the fractions multiply from the largest RNA pair
to the smaller pairs. One molecule of C-E RNA from PBMC
from patient 1 would theoretically be accompanied by about 4
molecules of pre-S RNA, 44 molecules of S RNA, and 123
molecules of X RNA (Table 2).
[image:4.612.317.556.69.239.2]Absence of multimeric molecules of the HBV RNA
prege-nome.
HBV RNA molecules of 7.5 kb, possibly transcribed
from multimeric HBV DNA molecules, have been observed in
PBMC from experimentally infected chimpanzees (31). In
or-der to detect this species of molecules, a different nested PCR
was carried out. During the first round, primers P1 and P21
were applied, and P3 and P22 were used during the second
round. However, no PCR product could be obtained with these
FIG. 1. Schematic diagram of the positions of the PCR primers. The shaded [image:4.612.60.298.74.301.2]areas indicate the regions spanned by the PCR primer sets X, S, pre-S, C-E, and S-39, in accordance with the different kinds of HBV RNA transcripts. The scattered area represents the part of the circular HBV genome spanned by primers P23 to P26. These primers were applied in a nested PCR protocol after digestion of the sample DNA with mung bean nuclease to discriminate between the relaxed circular form (rcDNA) and the covalently closed circular form (cccDNA) of the HBV genome. The sequences of the PCR primers grouped in these six sets are shown in Table 1.
TABLE 2. Results of pcPCR
aPatient Sample
Ratiobwith the following primer set applied in pcPCR:
X-S S–pre-S pre-S–C-E S–S-39
RNA DNA RNA DNA RNA DNA RNA DNA
1
PBMC 2.84 0.99 11.08 1.05 3.94 0.72 0.86 1.29
HBV
1.16 0.96
1.27 1.02 1.33 1.28 0.96 0.88
2
B cells 2.25 0.98
5.99 1.11 4.18 0.85 1.08 1.15
T cells 1.43 0.9
4.15 0.98 1.4
1.27 1.26 1.07
3
B cells 1.85 0.99
3.52 0.90 5.13 1.25 0.92 1.02
T cells 1.16 1.14
2.84 0.94 2.59 1.06 0.85 1.0
HBV
1.07 0.99
1.18 0.96 0.9
1.09 1.0
1.0
apcPCR was carried out with four different combinations of PCR primer sets. The samples containing nucleic acid preparations from total PBMC, B cells, T cells, or HBV particles were obtained from three patients. For each sample, preparations of poly(A)1RNA as well as total DNA were analyzed. The amount of PCR product generated by each of the two PCR primer sets applied simul-taneously for comparative PCR was calculated quantitatively by using the GE-NESCAN 672 software (PE/ABI).
bRatio of the amounts of the two different PCR products generated by each comparative PCR.
FIG. 2. Graphic display of pcPCR results from PBMC from patient 1. The three graphs on the left show the results obtained from mRNA preparations. Results for the corresponding DNA controls are displayed on the right. Peak designations (X, S, PreS, and C-E) indicate the PCR primer sets used. Peaks without designations (fragment sizes of 20 to 40 nucleotides) correspond to nonincorporated primers or primer dimers. Peak heights are shown on a relative scale of the computer software used (GENESCAN 672; purchased from PE/ ABI). The amounts of PCR product were calculated on the basis of peak areas, which is more reliable than the use of peak heights. The peak heights, however, represent the results as displayed on the computer screen. The ratios of product generated by each of the two primer sets applied in a pcPCR are clearly different from 1:1 in the case of mRNA templates but not in the case of DNA templates from the patient’s PBMC.
on November 9, 2019 by guest
http://jvi.asm.org/
[image:4.612.316.555.521.653.2]primer combinations, suggesting that multimers of the HBV
pregenome did not serve as templates in our pcPCR assays
(data not shown).
Assessing the sensitivity of nested pcPCR.
The sensitivity of
our nested PCR protocol for detection of cccDNA was
deter-mined by endpoint dilution series with DNA preparations of
plasmids containing a full-length HBV genome (pKSVHBV1)
(61). The sensitivity was higher than six target molecules per
sample. In the case of covalently closed plasmid DNA, there
was no change in the level of sensitivity if the samples were
treated with mung bean nuclease prior to PCR (Fig. 4B).
In order to determine the sensitivity of HBV RT-pcPCR, we
constructed two RNA standards of 1,914 and 752 bp by
solid-phase in vitro transcription (47). Additionally, the transcripts
were purified by oligo(dT) affinity chromatography in order to
obtain highly pure RNA standards of full length. By using a
template of cloned HBV DNA, primers P27 and P28 were
applied in a long-PCR protocol (GeneAmp XL PCR kit;
Per-kin-Elmer) to amplify a DNA fragment for transcription of a
752-kb RNA. This RNA was designated sX. It provided a
target sequence for the X pcPCR primer set only, similar to the
X mRNA of HBV. In the same way, a 1,914-bp synthetic RNA,
designated sS, was transcribed from a long-PCR product
ob-tained with primers P29 and P28. It provided target sequences
for the X primer set and for the S primer set, similar to the
2.1-kb mRNA of HBV. It was not possible to copy the sizes of
both HBV mRNAs exactly. The 3
9
ends of the PCR primers
used to create templates for in vitro transcription had to be
placed in nonrepetitive regions of the HBV genome because
they otherwise generated additional smaller fragments due to
their large size caused by non-HBV sequences at their 5
9
ends
[SP6 promoter and oligo(dT) 17-mer]. Both standard RNAs
were serially diluted over 14 log steps and put together in a
molar ratio of 5 (sX) to 1 (sS). As a template for RT-pcPCR,
we used an aliquot from each dilution step together with
car-rier mRNA from 10
6HBV-negative PBMC. Over 11 log steps,
both templates revealed a positive PCR result. The mean ratio
of sS to sX RNA was 4.3. The SD of
6
3.3 was higher than was
observed in the other control experiments mentioned above.
This might be due to additional pipetting steps and a high
susceptibility to RNA degradation before the diluted RNA
[image:5.612.62.290.73.291.2]FIG. 3. Results of pcPCR. The results of pcPCR (Table 2) are shown on a semilogarithmic scale. Squares, single pcPCR values from poly(A)1RNA prep-arations from HBV carriers’ total PBMC; triangles, poly(A)1RNA from T cells; circles, poly(A)1RNA from B cells. The primer combinations applied in pcPCR are shown above each column (X/S, S/PreS, and PreS/C-E). Rectangles on the bottom of the diagram show the SDs for control reactions as designated on the top. The bars above and below these rectangles represent 2 SDs. In the case of the control reactions designated PBMC DNA, virion RNA, and virion DNA, all three combinations of pcPCR primers were used, but these are not shown separately (Table 2). RNA:S/S-39represents a control reaction done to ensure that the results of pcPCR were not affected by different distances between the primer positions and the 59or 39 ends of the HBV mRNAs (Fig. 1).
FIG. 4. Determination of the sensitivity of RT-pcPCR (A) and of nested PCR for detection of cccDNA (B). (A) To determine the sensitivity of RT-pcPCR, two RNA standards were constructed (47). Standard RNA sX of 752 bp provided a target sequence for the X primer set (Table 1), similar to the 0.65-kb mRNA of HBV. The other standard RNA, designated sS, provided target se-quences for two primer sets applied in pcPCR (X and S), similar to the 2.1-kb mRNA of HBV. After preparation of a serial dilution over 14 log steps from both standard RNAs, they were mixed in a ratio of 5 (sX) to 1 (sS), as shown at the bottom. An aliquot of each dilution step was added to carrier mRNA from 106 HBV-negative PBMC, and RT-pcPCR was performed. The ratios between the peak areas of the two pcPCR products were determined, as shown at the top. It was still possible to detect 200 molecules of standard RNA. (B) The sensitivity of the PCR assay for detection of cccDNA was determined with a serial dilution series of plasmid DNA containing a full-length HBV genome added to 800 ng of carrier DNA from HBV-negative PBMC. The sensitivity of nested PCR was higher than 6 genomes per assay. Addition of mung bean nuclease did not alter the sensitivity, suggesting that cccDNA was not affected by this enzyme under the conditions we used. Comparison of these results to the ones obtained for viral particles (Fig. 5B, lane V1) indicates a difference of at least 5 log steps between viral particle-derived DNA and cccDNA with regard to sensitivity of nested PCR after incubation with mung bean nuclease.
on November 9, 2019 by guest
http://jvi.asm.org/
standards were added to carrier mRNA. However, the amount
of template generated by the sX RNA was always significantly
larger than that generated by the sS RNA, even at very high
template concentrations, when the PCR was driven extensively
into the plateau phase. The sensitivity of RT-pcPCR was
higher than 200 RNA molecules per PCR sample,
correspond-ing to 1 mRNA molecule per 1,000 cells (Fig. 4A).
Further validation of pcPCR.
In addition to the control
experiments described above, the poly(A)
1RNA preparations
from our patients’ PBMC were subjected to pcPCR with two
beta-actin-specific nested primer sets. In order to rule out any
impairment by possible DNA contaminations, both sets of
primers were chosen to be intron spanning, which was not
possible in the case of HBV. Similar to the HBV primers for
pcPCR, the positions of the sets were about 800 bp apart from
each other. In six pcPCR assays the ratios of PCR products
generated by the two sets of primers were in the range of 0.8 to
1.3 (data not shown). These results fit well to the ratio of 1 to
be expected theoretically, as both sets of beta-actin primers
should bind to each molecule of beta-actin mRNA or cDNA.
Detection of cccDNA in PBMC.
PBMC from two patients
were assayed for the presence of cccDNA (Fig. 5). In samples
from patient 2, there was a positive signal in six of six repeated
tests. For the PBMC from patient 3, a positive signal was
obtained in only three of six tests, suggesting that the amount
of cccDNA was close to the detection limit of the assay. To rule
out possible artifacts, several controls were included. PBMC
from HBV-negative persons were always negative in six tests.
DNA from HBV particles gave a faint signal at 297 bp in six
tests performed, which corresponds to the expected length of a
PCR fragment primed by P25 and P26 during the second
round of nested PCR, but no signal at all was seen after
treatment with mung bean nuclease (Fig. 5B). After the first
round of nested PCR, a positive signal at the expected length
of 449 bp was seen only in the positive control with 10 ng of a
plasmid preparation (pKSVHBV1) containing a full-length
HBV genome (Fig. 5A) (61). Southern blotting of the
first-round PCR products and hybridization with a
32P-labelled
HBV DNA fragment (positions 1553 to 1846 of the HBV
genome) revealed the following results (Fig. 5C). The PBMC
samples from patient 2, which had revealed strong signals after
the second round of PCR, also showed a positive although
faint signal at the expected length of 449 bp. In contrast, DNA
from HBV particles showed two very strong signals below 449
bp. Very likely they are due to a linear DNA amplification
initiated by the two PCR primers but stopping at the 3
9
ends of
both strands after opening of HBV rcDNA at 94°C during the
PCR melting step. These templates can give rise to product
sizes of about 390 and 300 bp, respectively (Fig. 5C).
DISCUSSION
This report describes the detection of different HBV mRNA
transcripts in PBMC from highly viremic carriers. The validity
of the data relies on a new, sensitive approach designated
pcPCR. pcPCR may be considered a modification of
compet-itive multiplex fluorescent PCR, which already has been
suc-cessfully used to determine the relative levels of multiple
mRNA species simultaneously (67). Application of such an
approach to quantitation of HBV transcripts required further
validation, due to the coterminal structures of the different
mRNAs and the generation of DNA-RNA hybrids by the
unique replication cycle of hepadnaviruses. An undesirable
selection of 3
9
-terminal RNA fragments by oligo(dT)
separa-tion and loss of the 5
9
-terminal fragments, or variable
efficien-cies of cDNA priming with regard to the positions of the
pcPCR primers on the target RNA molecules, had to be
con-sidered as a possible source of artifacts. The validity of our
pcPCR assay relies on the following control experiments. First,
DNA templates derived from PBMC or HBV particles
re-vealed identical ratios of PCR products, close to 1, irrespective
of which primer sets were used for pcPCR. Thus, the efficiency
of PCR amplification did not significantly differ between the
sets of primers applied. Second, poly(A)
1RNA preparations
from HBV particles gave pcPCR results very similar to those
for DNA templates, again without significant differences in the
amounts of product generated by the different primer sets.
This result suggests that some viral particles contain
nontran-scribed RNA pregenomes, as reported by other authors (29).
However, our experiments do not definitively confirm this
con-FIG. 5. Detection of HBV cccDNA in PBMC from persistently infected patients. Nested PCR was performed with primers P23 to P26 (Table 1 and Fig. 1). All DNA samples used as PCR templates had been treated with mung bean nuclease prior to PCR, except for those in lanes V2. (A and B) A 2% agarose gel stained with ethidium bromide, showing analysis of the first-round PCR products (A) and the second-round products of nested PCR (B). (C) Southern blot of panel A. HBV-specific PCR fragments were hybridized to a32P-labelled fragment of the HBV genome. Sample PL, a plasmid containing the whole HBV genome, had been taken off prior to Southern blotting because its strong signal otherwise had eclipsed all other lanes. Lanes: MW, molecular weight marker VIII obtained from Boehringer; P2 and P3, DNA preparations from patients’ PBMC; NE, DNA preparations from HBV-negative persons; V2, virion DNA not treated with mung bean nuclease; V1, virion DNA treated with mung bean nuclease; PL, a plasmid containing a complete HBV genome; and H2O, a PCR-negative control without any DNA template.
on November 9, 2019 by guest
http://jvi.asm.org/
[image:6.612.318.556.71.439.2]clusion, because positive PCR results may have been caused by
traces of virion DNA. We did not perform a DNase digestion
step and priming of cDNA synthesis with a 3
9
-oligo(dT) PCR
anchor primer, as suggested by Sallie (58). The relevance of
our control experiment, however, is not abolished by these
considerations, as poly(A)
1RNA from HBV carrier PBMC
and poly(A)
1RNA from virions were prepared in the same
manner. If present at all, DNA contaminations should be
present in both RNA preparations, and this therefore cannot
explain the different results of pcPCR for subgenomic mRNAs.
Third, two PCR primer sets, both able to detect the three
largest HBV mRNA transcripts but located about 600 bp apart
from each other, did not give rise to different amounts of
pcPCR products. None of these control experiments gave any
evidence that pcPCR generated artifacts due to the procedures
used for RNA preparation, cDNA synthesis, or pcPCR itself.
Thus, the data obtained by pcPCR prove that the 0.65-, 2.1-,
and 2.4-kb HBV mRNAs are present in our patients’ PBMC.
The data do not allow for conclusions about the origin of the
C-E RNA, which may be derived from adsorbed or ingested
virions or expressed by cccDNA (29). Our data also cannot
definitely prove the integrity of the HBV RNA molecules
de-tected in PBMC, but there was no evidence that they were
defective. Due to the RNA purification procedure, a poly(A)
tail must have been present at the 3
9
ends of these molecules,
and at least the regions spanned by the different primer sets
used for pcPCR, which together cover about 20% of the HBV
genome, were amplified with a normal product size.
Transcription of HBV genes in nonhepatocytes has already
been studied in transgenic mice and by vitro transfection, but
these data do not represent the situation in a human HBV
carrier, because additional heterologous promoters or
enhanc-ers were used or transcription came from integrated DNA (2,
15, 16, 18, 30, 41, 66). In contrast, our findings show that HBV
genes are transcribed in PBMC in vivo. The detection of
sig-nificant amounts of X mRNA in the PBMC or B cells is
remarkable. Only small or undetectable amounts of X mRNA
have been observed in liver samples from woodchuck hepatitis
virus-infected woodchucks or HBV-infected chimpanzees (40,
65). This observation suggests that certain effects described for
X-transfected cells may indeed occur in vivo, e.g., induction of
HLA antigens (26) or intracellular adhesion molecule I (27).
In cell culture, X mRNA may be dispensable for hepadnavirus
production, but X-deficient woodchuck hepatitis virus
ge-nomes are not viable in woodchucks (9, 68). Besides X mRNA,
larger HBV mRNAs could also be unequivocally detected in
PBMC or B cells. Our data are particularly relevant for the in
vivo situation because the PBMC were not stimulated by
arti-ficial reagents but were analyzed in the state in which they were
obtained from circulation. It is known that transcription under
the control of the C-E and pre-S promoters is highly liver
specific, whereas the S and X promoters are ubiquitously active
(1, 60). Thus, the comparatively smaller amounts of C-E and
pre-S RNA are in accordance with the in vitro studies on
promoter specificity.
The question of whether HBV replication or at least gene
expression takes place in nonhepatocytes has been discussed in
numerous reports, without a general agreement. Recently,
se-rious doubts on the biological activity of HBV genes in PBMC
were raised by the application of a new PCR approach to
discriminate between rcDNA present in HBV particles and
cccDNA of HBV, which can be generated only in the nucleus
of an infected host cell (29). Our data support the contrary
conclusion, as we were able to detect HBV mRNA sequences
as well as cccDNA in PBMC from our patients. A possible
explanation for the conflicting results may be the different
methodological approaches used. Ko¨ck et al. (29) did not use
a nested PCR primer set to detect HBV cccDNA, and they did
not treat the samples with mung bean nuclease before the
assay. Their PCR assay for discrimination between HBV
rcDNA and cccDNA was based only on dependence of the
amplification on the kind of template present if the PCR
prim-ers span the nick within the minus strand of HBV rcDNA,
similar to our primers P23 to P26 (Fig. 1). In such an approach,
DNA synthesis will stop at the 3
9
end of each template strand
before reaching the binding site of the opposite primer. Linear
amplification of two incomplete DNA strands will result, as is
visible in lane V
2
of Fig. 5C. Exponential DNA amplification
will take place only after reannealing of both incompletely
synthesized DNA strands. If the template concentration is kept
low, reannealing of both PCR strands will rarely happen. A
significantly different PCR amplication efficacy will result
ac-cording to what kind of template is present, i.e., rcDNA or
cccDNA. This approach, however, bears two fundamental
lim-itations as shown by Ko¨ck et al. (29). The amount of template
added to the PCR mixture is critical. If it exceeds 10
5genomes
per 100
m
l of PCR mixture, discrimination between rcDNA
and cccDNA is gradually lost. If it is lower than 10
3genomes
per PCR set, the sensitivity of the assay might be too low to
detect the HBV sequences. Due to the relatively small range of
possible template concentrations, the assay is probably not able
to detect cccDNA if the ratio of rcDNA to cccDNA clearly
exceeds 10
2. The control experiments that we performed with
purified virions showed that the experimental approaches we
used to detect cccDNA and mRNA of HBV in PBMC were not
affected by the presence of a large excess of adsorbed or
phagocytosed virions.
Apart from these methodological aspects, there may be two
biological reasons why HBV-specific mRNA and cccDNA
were detected in PBMC from our patients but not in the study
of Ko¨ck et al. (29). As stated by those authors, the amount of
PBMC-associated HBV DNA directly correlated with the
virion titer in the patient’s serum. Uptake of HBV and HBV
gene expression by PBMC are probably a very inefficient
pro-cess. Thus, the chance of detecting HBV mRNA and cccDNA
should increase if the number of virions binding to the cell
surface is higher (29). The patients in our study had very high
titers, more than 10
9HBV genomes/ml of serum (51).
Unfor-tunately, Ko¨ck et al. (29) did not report the virion titers in their
patients’ sera. Even more important may be that none of our
patients had any signs of a cellular immune reaction against
HBV-infected liver cells. Liver biopsies revealed a normal
his-tology or at most a minimal hepatitis with some ground-glass
hepatocytes, despite the presence of hepatitis B surface
anti-gen and core antianti-gen in 50 to 90% of hepatocytes. There were
no significant elevations of liver enzymes or any other signs of
liver cell dysfunction during a period of more than 5 years
when the patients had already been monitored carefully (52).
The absence of a cytotoxic immune response against
HBV-infected cells may be an important prerequisite for the
accu-mulation of infected nonhepatocytes. PBMC would most likely
present T-cell epitopes of HBV much more efficiently than
noninflammatory liver cells, which express very small amounts
of HLA class I molecules (4). HBV-reactive cytotoxic T cells
would either destroy such cells or suppress HBV gene
expres-sion (17).
In summary, pcPCR might be a useful tool to study HBV
gene expression in PBMC and other nonhepatocytes which
contain small amounts of HBV-specific nucleic acids. The
as-say system described in this paper provides information about
the presence or absence of the different HBV transcripts in a
sample. In addition, it enables a clear distinction between
on November 9, 2019 by guest
http://jvi.asm.org/
adherent or phagocytosed virions and intracellular HBV gene
expression. Our findings with PBMC suggest that these cells
are able to express mRNAs of HBV in vivo, and therefore, they
might be able to generate small amounts of progeny virus.
ACKNOWLEDGMENTS
We are indebted to Claudia Keller for excellent technical assistance.
This work was supported by DFG grant SFB 272/C4 to W.H.G., by
the Forschungshilfe Station Peiper foundation, and by a Research
Award of the Justus-Liebig-University to R.R.
REFERENCES
1. Antonucci, T. K., and W. J. Rutter. 1989. Hepatitis B virus (HBV) promoters are regulated by the HBV enhancer in a tissue-specific manner. J. Virol. 63:579–583.
2. Aragona, E., R. D. Burk, M. Ott, D. A. Shafritz, and S. Gupta. 1996. Cell type-specific mechanisms regulate hepatitis B virus transgene expression in liver and other organs. J. Pathol. 180:441–449.
3. Baginski, I., I. Chemin, P. Bouffard, O. Hantz, and C. Trepo. 1991. Detection of polyadenylated RNA in hepatitis B virus-infected peripheral blood mono-nuclear cells by polymerase chain reaction. J. Infect. Dis. 163:996–1000. 4. Barnaba, V., A. Franco, A. Alberti, R. Benvenuto, and F. Balsano. 1990.
Selective killing of hepatitis B envelope antigen-specific B cells by class I-restricted, exogenous antigen-specific T lymphocytes. Nature 345:258–260. 5. Bartolome´, J., G. Moraleda, J. Molina, F. Dominguez, J. C. Porres, and V. Carren˜o.1990. Hepatitis B virus DNA in liver and peripheral blood mono-nuclear cells during reduction in virus replication. Gastroenterology 99: 1745–1750.
6. Bertram, U., R. Repp, H.-P. Fischer, W. R. Willems, and F. Lampert. 1990. Hepatitis-B-Endemie bei zytostatisch behandelten Kindern. Dtsch. Med. Wochenschr. 115:1253–1254.
7. Bichko, V., D. Dreilina, P. Pushko, P. Pumpen, and E. Gren. 1985. Subtype ayw variant of hepatitis B virus. FEBS Lett. 185:208–212.
8. Blum, H. E., E. Walter, K. Teuber, W. B. Offensperger, S. Offensperger, and W. Gerok.1989. Hepatitis B virus in non-hepatocytes, p. 169–183. In P. Bannasch, D. Keppler, and G. Weber (ed.), Liver cell carcinoma. Kluwer Academic Publishers, Dordrecht, The Netherlands.
9. Blum, H. E., Z.-S. Zhang, E. Galun, F. Von Weizsa¨cker, B. Garner, T. J. Liang, and J. R. Wands.1992. Hepatitis B virus X protein is not central to the viral life cycle in vitro. J. Virol. 66:1223–1227.
10. Borkhardt, A., R. Repp, E. Haupt, S. Brettreich, U. Buchen, R. Gossen, and F. Lampert.1994. Molecular analysis of MLL1/AF4 recombination in infant acute lymphoblastic leukemia. Leukemia 8:549–553.
11. Bouffard, P., J.-P. Lamelin, F. Zoulim, D. Lepot, and C. Trepo. 1992. Phy-tohemagglutinin and concanavalin A activate hepatitis B virus in peripheral blood mononuclear cells of patients with chronic hepatitis B virus infection. J. Med. Virol. 37:255–262.
12. Bouffard, P., J.-P. Lamelin, F. Zoulim, C. Pichoud, and C. Trepo. 1990. Different forms of hepatitis B virus DNA and expression of HBV antigens in peripheral blood mononuclear cells in chronic hepatitis B. J. Med. Virol. 31:312–317.
13. Calmus, Y., P. Marcellin, G. Beaurain, L. Chatenoud, and C. Bre´chot. 1994. Distribution of hepatitis B virus DNA sequences in different peripheral blood mononuclear cell subsets in HBs antigen-positive and negative pa-tients. Eur. J. Clin. Invest. 24:548–552.
14. Catterall, A. P., I. M. Murray-Lyon, A. J. Zuckerman, and T. J. Harrison. 1994. Southern hybridisation analysis of HBV DNA in peripheral blood leucocytes and of different cell types: changes during the natural history and with interferon-atherapy in patients with hepatitis B virus infection. J. Med. Virol. 43:269–275.
15. Chisari, F. V. 1995. Hepatitis B virus transgenic mice: insights into the virus and the disease. Hepatology 22:1316–1325.
16. Chisari, F. V. 1996. Hepatitis B virus transgenic mice: models of viral im-munobiology and pathogenesis. Curr. Top. Microbiol. Immunol. 206:149– 173.
17. Chisari, F. V., and C. Ferrari. 1995. Hepatitis B virus immunopathology. Springer Semin. Immunopathol. 17:261–281.
18. Choo, K.-B., L.-N. Liew, K. Y. Chong, R. Lu, and W. T. K. Cheng. 1991. Transgenome transcription and replication in the liver and extrahepatic tissues of a human hepatitis B virus transgenic mouse. Virology 182:785–792. 19. Diagen GmbH. 1991. The Quiagenologist, 3rd ed. Diagen GmbH,
Du¨ssel-dorf, Germany.
20. Douglas, D. D., J. Rakela, H. F. Taswell, R. A. F. Krom, and R. H. Wiesner. 1993. Hepatitis B virus replication patterns after orthotopic liver transplan-tation: de novo versus recurrent infection. Transplant. Proc. 25:1755–1757. 21. Fe´ray, C., A. L. Zignego, D. Samuel, A. Bismuth, M. Reynes, P. Tiollais, H. Bismuth, and C. Brechot.1990. Persistent hepatitis B virus infection of mononuclear blood cells without concomitant liver infection: the liver trans-plantation model. Transtrans-plantation 49:1155–1158.
22. Ferrari, C., A. Penna, A. Bertoletti, A. Valli, A. D. Antoni, T. Giuberti, A. Cavalli, M.-A. Petit, and F. Fiaccadori.1990. Cellular immune response to hepatitis B virus-encoded antigens in acute and chronic hepatitis B virus infection. J. Immunol. 145:3442–3449.
23. Ferrari, C., M. Pilli, A. Penna, A. Bertoletti, A. Valli, A. Cavalli, G. Pasetti, and F. Fiaccadori.1992. Autopresentation of hepatitis B virus envelope antigens by T cells. J. Virol. 66:2536–2540.
24. Franco, A., M. Paroli, U. Testa, R. Benvenuto, C. Peschle, F. Balsano, and V. Barnaba.1992. Transferrin receptor mediates uptake and presentation of hepatitis B envelope antigen by T lymphocytes. J. Exp. Med. 175:1195–1205. 25. Galibert, F., E. Mandart, F. Fitoussi, and P. Tiollais. 1979. Nucleotide sequence of the hepatitis B virus genome (subtype ayw) cloned in E. coli. Nature 281:646–650.
26. Hu, K.-Q., J. M. Vierling, and A. Siddiqui. 1990. Trans-activation of HLA-DR gene by hepatitis B virus X gene product. Proc. Natl. Acad. Sci. USA 87:7140–7144.
27. Hu, K.-Q., C.-H. Yu, and J. M. Vierling. 1992. Up-regulation of intercellular adhesion molecule 1 transcription by hepatitis B virus X protein. Proc. Natl. Acad. Sci. USA 89:11441–11445.
28. Junker-Niepmann, M., R. Bartenschlager, and H. Schaller. 1990. A short
cis-acting sequence is required for hepatitis B virus pregenome
encapsida-tion and sufficient for packaging of foreign RNA. EMBO J. 9:3389–3396. 29. Ko¨ck, J., L. Theilmann, P. Galle, and H. J. Schlicht. 1996. Hepatitis B virus
nucleic acids associated with human peripheral blood mononuclear cells do not originate from replicating virus. Hepatology 23:405–413.
30. Koike, K., K. Moriya, S. Iino, H. Yotsuyanagi, Y. Endo, T. Miyamura, and K. Kurokawa.1994. High-level expression of hepatitis B virus HBx gene and hepatocarcinogenesis in transgenic mice. Hepatology 19:810–819. 31. Korba, B. E., F. Wells, B. C. Tennant, G. H. Yoakum, R. H. Purcell, and J. L.
Gerin.1986. Hepadnavirus infection of peripheral blood lymphocytes in vivo: woodchuck and chimpanzee models of viral hepatitis. J. Virol. 58:1–8. 32. Lamelin, J.-P., and C. Tre´po. 1990. The hepatitis B virus and the peripheral
blood mononuclear cells: a brief review. J. Hepatol. 10:120–124. 33. Lavine, J. E., J. R. Lake, N. L. Ascher, L. D. Ferrell, D. Ganem, and T. L.
Wright.1991. Persistent hepatitis B virus following interferon alfa therapy and liver transplantation. Gastroenterology 100:263–267.
34. Lu, X. Y., T. M. Block, and W. H. Gerlich. 1996. Protease-induced infectivity of hepatitis B virus for a human hepatoblastoma cell line. J. Virol. 70:2277– 2285.
35. Lucey, M. R. 1994. Hepatitis B infection and liver transplantation: the art of the possible. Hepatology 19:245–247.
36. Lucey, M. R., D. M. Graham, P. Martin, A. Di Bisceglie, S. Rosenthal, J. G. Waggoner, R. M. Merion, D. A. Campbell, T. T. Nostrant, and H. D. Appel-man.1992. Recurrence of hepatitis B and delta hepatitis after orthotropic liver transplantation. Gut 33:1390–1396.
37. Malave´ Lara, C., M. T. Gorrin˜o, C. Campelo, P. Lardelli, and R. Cisterna. 1994. Detection of hepatitis B virus DNA and determination of surface antigen expression in peripheral blood mononuclear cells from patients with AIDS. Eur. J. Clin. Microbiol. Infect. Dis. 13:267–271.
38. Marcellin, P., D. Samuel, J. Areias, M.-A. Loriot, J.-L. Arulnaden, M. Gigou, M.-F. David, A. Bismuth, M. Reynes, C. Bre´chot, J.-P. Benhamou, and H. Bismuth.1994. Pretransplantation interferon treatment and recurrence of hepatitis B virus infection after liver transplantation for hepatitis B-related end-stage liver disease. Hepatology 19:6–12.
39. Mason, A., B. Yoffe, C. Noonan, M. Mearns, C. Campbell, A. Kelley, and R. P. Perrillo.1992. Hepatitis B virus DNA in peripheral-blood mononuclear cells in chronic hepatitis B after HBsAg clearance. Hepatology 16:36–41. 40. Miller, R. H., S. Kaneko, C. T. Chung, R. Girones, and R. H. Purcell. 1989.
Compact organization of the hepatitis B virus genome. Hepatology 9:322– 327.
41. Nagashima, H., M. Imai, and Y. Iwakura. 1993. Aberrant tissue specific expression of the transgene in transgenic mice that carry the hepatitis B virus genome defective in the X gene. Arch. Virol. 132:381–397.
42. Nassal, M., and H. Schaller. 1993. Hepatitis B virus replication. Trends Microbiol. 6:221–228.
43. Neurath, A. R., N. Strick, P. Sproul, H. E. Ralph, and J. Valinsky. 1990. Detection of receptors for hepatitis B virus on cells of extrahepatic origin. Virology 176:448–457.
44. O’Grady, J. G., H. M. Smith, S. E. Davies, H. M. Daniels, P. T. Donaldson, K. C. Tan, B. Portmann, G. J. M. Alexander, and R. Williams.1992. Hep-atitis B virus reinfection after orthotopic liver transplantation. Serological and clinical implications. J. Hepatol. 14:104–111.
45. Pasquinelli, C., M. Melegari, E. Villa, P. P. Scaglioni, M. Seidenari, N. Mongiardo, B. De Rienzo, and F. Manenti.1990. Hepatitis B virus infection of peripheral blood mononuclear cells is common in acute and chronic hepatitis. J. Med. Virol. 31:135–140.
46. Pontisso, P., G. Morsica, M. G. Ruvoletto, R. Zambello, C. Colletta, L. Chemello, and A. Alberti.1991. Hepatitis B virus binds to peripheral blood mononuclear cells via the pre S1 protein. J. Hepatol. 12:203–206. 47. Repp, R., A. Borkhardt, R. Gossen, J. Kreuder, J. Hammermann, and F.
Lampert.1995. Construction of RNA standards for high-resolution
on November 9, 2019 by guest
http://jvi.asm.org/
matic product analysis in quantitative competitive RT-PCR. BioTechniques 19:84–90.
48. Repp, R., A. Borkhardt, E. Haupt, J. Kreuder, S. Brettreich, J. Hammer-mann, K. Nishida, J. Harbott, and F. Lampert.1995. Detection of four different 11q23 chromosomal abnormalities by multiplex-PCR and fluores-cence-based automatic DNA-fragment analysis. Leukemia 9:210–215. 49. Repp, R., C. Keller, A. Borkhardt, A. Cseke, S. Schaefer, W. H. Gerlich, and
F. Lampert.1992. Detection of a hepatitis B virus variant with a truncated X gene and enhancer II. Arch. Virol. 125:299–304.
50. Repp, R., A. Mance, C. Keller, S. Rhiel, W. H. Gerlich, and F. Lampert. 1992. Detection of transcriptionally active hepatitis B virus DNA in peripheral mononuclear blood cells after infection during immunosuppressive chemo-therapy using the polymerase chain reaction. Arch. Virol. Suppl. 4:50–53. 51. Repp, R., S. Rhiel, K. H. Heermann, S. Schaefer, C. Keller, P. Ndumbe, F.
Lampert, and W. H. Gerlich.1993. Genotyping by multiplex polymerase chain reaction for detection of endemic hepatitis B virus transmission. J. Clin. Microbiol. 31:1095–1102.
52. Repp, R., B. von Ho¨rsten, A. Cseke, J. Kreuder, A. Borkhardt, W. R. Wil-lems, F. Lampert, and W. H. Gerlich.1993. Clinical and immunological aspects of hepatitis B virus infection in children receiving multidrug cancer chemotherapy. Arch. Virol. Suppl. 8:103–111.
53. Repp, R., B. von Ho¨rsten, H.-P. Fischer, W. H. Gerlich, and F. Lampert. 1993. Hepatitis B virus infection in children with cancer. Pediatr. Infect. Dis. J. 12:620–621.
54. Roisman, F. R., A. Castello, H. Fainboim, A. Morelli, and L. Fainboim. 1994. Hepatitis B virus antigens in peripheral blood mononuclear cells during the course of viral infection. Clin. Immunol. Immunopathol. 70:99–103. 55. Romet-Lemonne, J. L., M. Frances-McLane, E. Elfassi, W. A. Haseltine, J.
Azocar, and M. Essex.1983. Hepatitis B virus infection in cultured human lymphoblastoid cells. Science 221:667–669.
56. Rossi, G., M. Grendele, M. Colledan, B. Gridelli, L. R. Fassati, U. Maggi, P. Reggiani, S. Gatti, A. Piazzini, G. Lunghi, R. Cardone, and D. Galmarini. 1991. Prevention of hepatitis B virus reinfection after liver transplantation.
Transplant. Proc. 23:1969.
57. Rossner, M. T. 1992. Review: hepatitis B virus X-gene product: a promiscu-ous transcriptional activator. J. Med. Virol. 36:101–117.
58. Sallie, R. 1994. Selective detection of hepatitis B virus RNA by PCR. PCR Methods Appl. 3:376–377.
59. Seeger, C., D. Ganem, and H. E. Varmus. 1986. Biochemical and genetic evidence for the hepatitis B virus replication strategy. Science 232:477. 60. Seifer, M., K. H. Heermann, and W. H. Gerlich. 1990. Expression pattern of
the hepatitis B virus genome in transfected mouse fibroblasts. Virology 179:287–299.
61. Seifer, M., M. Ho¨hne, S. Schaefer, and W. H. Gerlich. 1991. In vitro tumor-igenicity of hepatitis B virus DNA and HBx protein. J. Hepatol. 13(Suppl. 4):S61–S65.
62. Summers, J., and W. S. Mason. 1982. Replication of the genome of a hepatitis B-like virus by reverse transcription of an RNA intermediate. Cell 29:403–415.
63. Summers, J. A., A. O’Connell, and I. Millman. 1975. Genome of hepatitis B virus: restriction enzyme cleavage and structure of DNA extracted from Dane particles. Proc. Natl. Acad. Sci. USA 72:4597–4601.
64. Walker, N., R. Apel, P. Kerlin, M. Horn, R. Tinniswood, S. Lynch, and R. Strong.1993. Hepatitis B virus infection in liver allografts. Am. J. Surg. Pathol. 17:666–677.
65. Will, H., W. Reiser, and T. Weimer. 1987. Replication strategy of human hepatitis B virus. J. Virol. 61:904–911.
66. Wirth, S., L. G. Guidotti, K. Ando, H.-J. Schlicht, and F. V. Chisari. 1995. Breaking tolerance leads to autoantibody production but not autoimmune liver disease in hepatitis B virus envelope transgenic mice. J. Immunol. 154:2504–2515.
67. Zhou, J., and E. P. Hoffman. 1994. Pathophysiology of sodium channelopa-thies. Studies of sodium channel expression by quantitative multiplex fluo-rescence polymerase chain reaction. J. Biol. Chem. 269:18563–18571. 68. Zoulim, F., J. Saputelli, and C. Seeger. 1994. Woodchuck hepatitis virus X
protein is required for viral infection in vivo. J. Virol. 68:2026–2030.
