• No results found

Localization and putative function of the UL20 membrane protein in cells infected with herpes simplex virus 1.

N/A
N/A
Protected

Academic year: 2019

Share "Localization and putative function of the UL20 membrane protein in cells infected with herpes simplex virus 1."

Copied!
12
0
0

Loading.... (view fulltext now)

Full text

(1)

JOURNAL OF VIROLOGY,Nov. 1994,p.7406-7417 0022-538X/94/$04.00+0

Copyright C 1994, American Society forMicrobiology

Localization and Putative Function of the

UL20

Membrane

Protein in Cells Infected with Herpes Simplex Virus

1

PATRICIAL.WARD,' GABRIELLA CAMPADELLI-FIUME,2 ELISAAVITABILE,2

ANDBERNARDROIZMANl*

TheMarjorieB. Kovler ViralOncology Laboratories, The Universityof Chicago, Chicago, Illinois 60637,1 and Sectionof Microbiology and Virology, Department of Experimental Pathology,

University of Bologna, Bologna, Italy2 Received 1 April 1994/Accepted 22 July 1994

TheUL20 proteinof herpessimplexvirus 1,anintrinsic membraneprotein,isrequiredininfected Vero cells

inwhichtheGolgiapparatusisfragmented forthetransportof virionsfrom thespacebetweenthe inner and outernuclearmembranesand for the transport offully processedcellmembrane-associatedglycoproteinsfrom thetrans-Golgitotheplasmamembrane.It isnotrequiredin the human 143TK- cellline,inwhich theGolgi apparatus remains intact. We report the following. (i) The UL20 protein was detected in infected cells beginning at 6 h postinfection and was regulated as a yl gene. (ii) Pulse-chase experiments revealed no detectablealteration inthemobilityoftheUL20 proteininpolyacrylamidegels. (iii)In bothinfected Vero and infected 143TK- cells, the UL20 protein was detected by immunofluorescence in association with nuclear membranes and in the cytoplasm. Some of the cytoplasmic fluorescence colocalized with "-COP, a protein

associated with Golgi-derived transport vesicles. UL20 protein was present in virions purified from the extracellular spacebut couldnotbe detected in theplasmamembrane.These resultsareconsistent with the hypothesis thatUL20 is acomponentof virion envelopesand membranes of virion transport vesicles and is selectivelyretained from the latter inaGolgicompartment.

The 152-kbp herpes simplexvirus 1 (HSV-1) genome

en-codes at least 15 membrane proteins. These include the glycoproteins gB, gC, gD, gE, gG, gH,gI,gJ, gK, gL, and gM,

thegeneproductsspecified bytheUL20, UL24,andUL34open reading frames, and the predicted gene product of open reading frame UL43 (1, 5, 6, 7, 14, 15, 17, 19, 20, 30, 33, 37, 45). Of theseproteins, morethanhalf, i.e., gC, gE, gG,gI,gJ, gM, UL20, UL24, and UL43,aredispensable for viral replication in at leastsome cells inculture (1, 4, 6, 16, 21, 26-29, 50). The function of thesedispensable membrane proteinsisof consid-erable interestinasmuch as their existence couldsuggestthat theyfunctiononlyincellsnotcultured in vitroorthatcultured

cellsexpressfunctions similartothoseof thedispensableviral proteins. Recent studies have shownthatatleastsome of the dispensableviralglycoproteins mayberequiredforapicalbut

notbasolateral entryinto polarized cells (43).Little is known about the functions of the UL24 and UL43 proteins. The function of the UL20 protein, however, has been studied in

somedetail and is ofconsiderable interest.Thus, viralmutants from which theUL20genehas been deletedmultiply and form small, at times syncytial plaques in some cell lines (e.g., 143TK-); they multiply but do notformplaques in other cell lines(e.g., Vero) (6).Adifferential featureof thetwocell lines is that the Golgi apparatus is fragmented and dispersed in infected Vero cells but not in infected 143TK- cells (8). Detailed studies of cells infectedwiththeUL20-virus revealed the following.

(i) In Vero cells infected with the UL20- virus, virions accumulatedbetweenthe inner andouternuclear membranes, and virus particles were absent from the space between

*Corresponding author. Mailing address: The Marjorie B. Kovler

ViralOncology Laboratories, The University of Chicago, 910 E. 58th St., Chicago,IL60637.Phone: (312) 702-1898. Fax:(312) 702-1631.

infected cells (6). In cells infected with wild-type virus, this

spaceisfilled with virions. The absence of extracellular virions

explained,atleast inpart,the absenceofplaqueformation in Vero cellmonolayer cultures.

(ii) The glycoprotein oligosaccharides of virions purified from infectedVero cellswereunprocessed. The oligosaccha-rides of the bulk of the viralglycoproteinsextracted from Vero cells infected with UL20- virus were fully processed in that theycontained terminal sialic acid residues. Nevertheless,the glycoproteinswerenottransportedtotheplasmamembranes. Incontrast,the glycoproteins associatedwith the membranes of 143TK- cells infected with the UL20- virus were fully processed and transported to the plasma membrane (3). In cells in which theGolgiapparatusisfragmentedanddispersed, UL20 protein appears to function at the point of entry of virions into the exocytic pathway from the outer nuclear membrane and in the egress of viral glycoproteins from the trans-Golgi.

In thisreportwe describe studiesdesignedto elucidate the distribution of theUL20 protein in the infected cellsas akey

steptowardanunderstandingof itsfunction. Asafirststepin the characterization of the protein, we constructed a fusion proteintoraise antiserumagainstUL20 protein.With the aid of this antiserumandanantibodytoaconstituent of theGolgi

aparatus, we determined the following: (i) theUL20 gene is regulated as a -Yl gene, and the protein can be detected in

infected-cell lysates by 6 h after infection; (ii) pulse-chase analysisofUL20revealednodiscerniblealterations inmobility in polyacrylamide gels; (iii) the proteinwas not expressedat

the cell surface but was present in virions purified from extracellular fluid and from the cytoplasm; and (iv) UL20 proteinwasfoundtobepresentinthe nuclearmembranes,in the Golgi apparatus, and dispersed in thecytoplasm butwas notdetected in theplasmamembranesof infected cells.

7406

Vol. 68, No. 11

on November 9, 2019 by guest

http://jvi.asm.org/

(2)

UL20 LOCALIZATION AND FUNCTION IN HSV-INFECTED CELLS

ab

I

M-11

L.

UL

FF

6 - F

-a

b' a' c'

.- --_

47 48 49

us HEp-2

ca

Mr 7- X =: =

pRB158

143TK-

I'-X

u1

> >

aipha-TIF

2 - B' F T ,_

/ 20 \ 21

I \

RVXHKPsBs \

___sH PRB4327

20

alpha 4p X

4

5

UL20 - ,

-IS K PS/H

\

\

I UL 20 alpha4P\

I No _

_ UL20

21-!pRB4335

FIG. 1. Schematicrepresentations of the sequence arrangements of HSV-1 DNA and of the variousplasmids used in these studies.

Lines 1 and2, locations within thegenomeofHSV-1(F) of the BamHI

B', F', and T fragments and theUL20 and UL21openreading frames. Line3,sequencearrangementof plasmidpRB4327;adouble-stranded

oligonucleotide containing multiple cloning sites and BsteII cohesive

endswasinserted into theunique BsteII site between the UL20 and UL21 openreading frames. Lines 4 and 5,sequence arrangementof pRB4335;a

KpnI

fragment containing 1.9 kb of the HSV-1 BamHI Z

fragment (containing the a4 promoter [alpha 4p] sequences) was

insertedinto the

KpnI

site ofpRB4327in the propertranscriptional

orientation to the UL20 gene. Line 6, sequence arrangement of pRB158,theBamHI Ffragment of HSV-1 containing the a-TIFgene

and its regulatory sequences. S, Sacl; RV, EcoRV; X, XbaI; H,

Hindlll;

&K,pknl;

PS,Pstl; Bs,BStell.

MATERUILSANDMETHODS

Cells andviruses. The isolation andpropertiesofHSV-1(F) andHSV-2(G), theprototype HSV-1 andHSV-2 strainsused inourlaboratories,havebeen described elsewhere(13).Viral

stocks ofwild-typevirusesweremadeinHEp-2cells,andtiters were determined in Vero cells. The genetically engineered mutantsused in these studieswere asfollows.R7032 lacks the

entire

Us8

gene, which encodes glycoprotein E (32); it was

used inexperimentsinwhichitwasdesirabletoavoid reactivity ofimmunoglobulin G (IgG)with the viral Fc receptor (e.g., blackplaqueassaysandpulse-chaseexperiments). R7405(49) contains an epitope derived from glycoprotein B of human cytomegalovirus(CMV) (6)inserted into theUL20geneanda portionof theUL26.5genepromotersequences(25) oriented such that thispromoteris inthepropertranscriptional orien-tationtotheUL20gene.R7225 lacks355bpfrom the5' end of the coding domain of the UL20 gene. (6). All recombinants exceptR7225weregrown,andtitersweredetermined,in Vero

cells. Inasmuch asrecombinant R7225 doesnotformplaques inVerocells,itwasgrown,and titerswere determined,in143 thymidine kinase-minus (143TK-) cells originally obtained from Carlo Croce. Purified virionpreparationswereprepared

from infected BHK cells. The cell lines were maintained in

Dulbecco's modified Eagle's medium supplemented with

ei-

14-FIG. 2. Photograph of immunoblot of electrophoretically

sepa-ratedlysates of HEp-2 and 143TK- cells infected with the indicated viruses.The blotswereprobed with rabbitantiserum raised against the

UL20--p-galactosidase

fusionprotein. Mrsareinthousands.

ther5% newborn calfserum(VeroorHEp-2 cells)or5%fetal calfserum (143TK- cells).

Plasmids. Figure 1 illustrates the construction of pRB4335 and pRB158; line 1 shows the sequence arrangement of the HSV-1genome,andline 2 shows thesequencearrangementof the HSV-1 BamHI B', F', and Tfragments and the orienta-tions of the UL20 and UL21 genes. A 1.99-kb PstI-SacI fragmentofpRB451 containing DNAsequencesspanningmap

units0.256to0.294(6)wascloned into thePstI andSacl sites of pGEM3Z (Promega). This plasmid was designated pRB4324. ThePstI andHindlll sites in the polylinker of this plasmid were destroyed by cleavage with PstI and HindlIl

restriction enzymes (New England Biolabs, Inc., Beverly,

Mass.) andtreatmentwith T4polymerase (U.S. Biochemical, Cleveland, Ohio) and the Klenow fragment of DNA poly-merase (Boehringer Mannheim Biochemicals, Indianapolis, Ind.). This cleaved plasmid was religated by using T4 ligase (NewEngland Biolabs),andadouble-strandedDNA

oligonu-cleotidecontaining multiple cloningsites and BsteII-compati-ble cohesive ends (5'GTAACGATATCTAGAAGCTTGGT ACCTGCAG3' and its complement 5'GTTACCTGCAGGG TACCAAGCTTCTAGATATC3')wasligatedinto theunique

BsteII site(Fig. 1,line3).Restrictionenzymecleavagesites in this polylinker wereEcoRV, XbaI, HindIII, KpnI, PstI, and BsteII. Insertion of this oligonucleotide destroyed the BsteII site at the 5' end, creatinganEcoRV site, butpreserved the BsteII siteatthe 3' end. Thisplasmidwasdesignated pRB4327 (Fig. 1, line 3). The 1.9-kb KpnI fragment from pRB178 (HSV-1 BamHI Z fragment cloned into pUC18) containing the x4promotersequencesandportionsofthe 5' transcribed noncoding sequencesof the (4 genestartingwith nucleotide

IS r

94-

67-

43-

30-VOL.68, 1994 7407

I

on November 9, 2019 by guest

http://jvi.asm.org/

(3)

7408 WARD ET AL.

Size

Mr markers

-200

- 97 - 69

1 2 3 4 5 6

'-w _ _.

,

.-....INi.

- 46 - 30

Ig

Ig

- 21 - 14

w

N.l 3 6 6 9 12 12 15 15 18 18 24 h.post infection

-_ + + + - + - + - PAA

FIG. 3. Photograph of immunoblot of electrophoretically

sepa-rated lysates of Vero cells infected with 10 PFU of HSV-1(F)percell

in thepresence (+)orabsence (-) of 300 ,ugofphosphonoacetate

(PAA)perml. Replicate cultures of infectedcellswere harvestedat the indicated times after infection, the solubilized proteins derived

from equal numbers ofcells were separatedby electrophoresis and

transferred to nitrocellulose, and the blots were probed with the

polyclonal rabbit antiserum to UL20 protein. Mrs are in thousands.

N.I.,notinfected.

+33wasinserted into the KpnIsiteofpRB4327 such that the

ao4promoterwould bein thepropertranscriptional orientation totheUL20gene.Thisplasmidwasdesignated pRB4335 (Fig. 1, line 5).Inotherexperimentsweusedapromoterconsisting ofthe5' nontranscribed domain of the o4 genefused to the transcribed noncoding domain of the transcription initiation site and the5' transcribed noncoding domain of the

-Y1UL19

gene encoding the major capsid protein. This promoter is expressed throughoutthereproductive cycle of the virus and allows the accumulation oflarge amountsofprotein (23).

Productionof the

UL20-0-galactosidase

fusionproteinand polyclonalrabbit antiserumtotheUL20 protein.The BamHI F' fragment of HSV-1(F) DNA was cloned into pUC18 as pGCF1053. The 670-bp BglII-BamHI fragment from pGCF 1053 was filled inwith the Klenow fragment of DNA poly-merase,ligatedwith12-mer EcoRIlinkers,and cloned into the EcoRI site ofpGEMtoyield plasmid pGCF1057. The EcoRI fragment from pGCF1057containing95% oftheUL20 coding

sequencewascloned into the EcoRI site of thepEX-2vector

(Biochemia, Mannheim, Germany), which contains a

cro-Escherichia coli lacZ gene fusion. The recombinant plasmid pGCF1136wasintroducedintoPOP2136cells. Topreparethe

UL20-1-galactosidase fusionprotein, anovernightculturewas

diluted 1:100 and allowedtogrowat30°Ctoanopticaldensity

at600nmof0.1. The culturewasthenshiftedto42°C for 3 h. Pelleted cells from a 2-liter culture were sonicated, and the inclusionbodieswerepelleted, washedtwotimes in phosphate-buffered saline (PBS) containing 1% deoxycholate and 1%

Nonidet P-40, and subjected to preparative denaturing poly-acrylamide gel electrophoresis. The protein corresponding

totheUL20-1-galactosidase fusion proteinwas electroeluted

in electrophoresis buffer containing 0.01% sodium dodecyl sulfate (SDS). New Zealand White rabbits were inoculated subcutaneously with 200 jgof fusion protein emulsifiedwith complete Freund's adjuvant. The rabbits were boosted five

times at 2-week intervals with the same amount of fusion proteininincomplete Freund's adjuvant.Serumsampleswere

FIG. 4. Photographs of [35S]methionine-labeled proteins immuno-precipitatedwith the UL20 rabbit serum (lanes 1 to 3) and ofan

immunoblotof the identical immunoprecipitatesreacted with

UL20-,B-galactosidase antiserum (lanes 4 to 6). HEp-2 cells were mock

infectedorexposedto10 PFUofR7032(gE-)viruspercell. At 8 h

after infection, the mediumwasreplaced with 1 ml of mediumlacking methionine andserum.The cellswerelabeledfor 1 h with 50 iLCiof [35S]methionineat9or16h after infection. In the cultures labeled at

9 h afterinfection, the radiolabeled methioninewaschasedwithcold

methionine at37°Cfor anadditional 12 h. The cells labeledat 16h

afterinfectionwere harvestedimmediately after thelabeling period. Lanes1and 4cellspulse-labeled at9h;lanes 2 and5,cellspulsedat

9 handchasedfor 12h; lanes 3and6,cellspulsedat16 h.Celllysates

wereimmunoprecipitatedwiththeUL20 antiserum,heatedat37°Cfor 30min, separated by electrophoresisonadenaturing polyacrylamide

gel,transferredtonitrocellulose,andexposedtoX-rayfilm(lanes1 to

3). The identical nitrocelluloseblotwasthenprobedwith the UL20

antiserum(lanes4to6). Thesecondary antibodyused in the

immu-noblotreactswiththerabbitUL20antiserumused in the immunopre-cipitation (bandslabeledIg).SinceUL20 proteinaggregatesonboiling

inSDSand doesnot entergels (6),theimmunoprecipitated samples

werenotboiled. Asaconsequence,IgGpresentin thesampleswasnot completelysolubilized and appearsasmultiple speciesin the immu-noblot.

collected andanalyzed forreactivitywiththeUL20 protein in lysatesofcellselectrophoretically separatedindenaturing gels and transferred toanitrocellulose sheet.

Antibodies. The polyclonal rabbit antiserum to UL20was

usedatdilutions of1:1,000forimmunofluorescence, 1:100,000 forimmunoblotting,and 1:200 forimmunoprecipitations. The

mousemonoclonalantibodyto 1-COP,theGolgicoatprotein ofnon-clathrin-coated vesicles (2), wasprovidedbyT. Kreis. The CH-28 monoclonal antibody to glycoprotein B ofCMV andthe monoclonal antibodiesspecificforHSV-1glycoprotein D (H170) and for LCP4 (H640)wereprovided byL. Pereira. UL20

J. VIROL.

.4.-Aw. -dOP 100,mow wW. ::t- 1:

on November 9, 2019 by guest

http://jvi.asm.org/

(4)

UL20 LOCALIZATION AND FUNCTION IN HSV-INFECTED CELLS 7409

A

B

c

,I

V~~~~~~~~~~~Uel

FIG. 5. Photomicrographofmethanol-fixed andunfixed gE- virus (R7032)-infected Vero cells probed with rabbit

anti-UL20-4-galactosidase

serum orrabbitanti-gM serum. Forty-eight hours after infection, the cells were probed with rabbit antisera. The bound antibody was detected with

abiotinylatedgoatanti-rabbitantibodyfollowedby biotinylated horseradish peroxidase bound to avidin and by4-chloro-1-naphtholsubstrate. (A) Fixedcells; aviralplaquereactedwitha1:200 dilution of rabbitanti-UL20serum. (B) Unfixed cells; a viral plaque reacted with a 1:200 dilution ofrabbitanti-UL20serum. (C) Unfixedcells; a viralplaque reacted with a 1:200 dilution of rabbit anti-gM serum.

The rabbit anti-UL53 antibody was obtained from David Johnson. The goat anti-rabbit IgG fluorescein isothiocyanate

(FITC)-conjugated antibody was purchased from Sigma

Chemical Co., (St. Louis, Mo.). The goat anti-mouse IgG Texasred-conjugated antibody was purchased from Molecular Probes, Inc. (Eugene, Oreg.). Commercial antibodies were usedasrecommendedby the manufacturers.

Transfections. Vero or143TK- cells were seeded onto glass

coverslips and allowed to adhere. Transfections were done

essentially as previously described (31) except that 20 ,ug of

each plasmidwas used and cells were fixed for immunofluo-rescenceanalysis 30 h after transfection.

Polyacrylamide gel electrophoresis and immunoblotting. Infected-cell lysates wereseparated indenaturing gels

consist-ing of 12.5 or 15% polyacrylamide and 0.1% SDS, and the proteins were electrically transferredto nitrocellulose sheets. Thesheets were soakedat roomtemperaturefor 10 to 30 min in PBS containing 5% skim milk (Carnation) andthen were reacted at room temperature for 90 min with the UL20

polyclonal rabbit antiserum (1:100,000 dilution) in PBS

con-taining 1% bovine serum albumin (BSA). The blots were washedonceinPBS-5%milkfor 15 min, rinsed four times in

PBS, and reacted for 1 h in a 1:3,000 dilution of goat anti-rabbit orgoat anti-mouse antiserum conjugated to alka-line phosphatase. The blotswere washed as described above

and developed byusingreagents and protocols supplied in a

Bio-Rad Laboratories(Richmond, Calif.) kit.

Black plaque assay. The procedures for the black plaque assaywereessentially as previously described (24). Verocell

monolayercultures were exposed to 10to 50 PFU of R7032

(gE-)virus per

25-cm2

cellculture flask and incubatedat34°C

for 48 h. The monolayers were either fixed in methanol to

permeabilize the cells or left intact. The monolayers were

incubated at roomtemperatureinblocking mediumconsisting

of medium 199supplementedwith 1% heat-inactivated horse serum(199v) for 1 h. Cellswere then incubated in asolution

containingtheappropriate primary antibodyat room temper-aturefor90 min. Foranalysis of UL20 expressionattheplasma membrane, infected cellswerereacted with eitherUL20 poly-clonal rabbit antiserumor anti-gM(ULlO protein) polyclonal rabbit antiserum (1:200 dilution). The monolayers were washed three times with medium 199supplemented with 1% fetal calfserum (199v), and incubated in a 1:500 dilution of biotinylated goat anti-mouse or goat anti-rabbit antibody at room temperature for 1 h. Monolayers were again washed three times and reacted with avidin boundtobiotin-conjugated

horseradish peroxidase (Vector Laboratories), and the color reaction wasdevelopedby using 1-chloro-4 napthol substrate aspreviously described (24).

Immunoprecipitations.Forpulse-chase experiments, radio-labeled, infected HEp-2 cell lysateswere solubilized in 200pul

ofimmunoprecipitation buffer(consisting ofamixtureof1% Nonidet P-40, 1% sodium deoxycholate, 10 p.M TPCK

[tolyl-sulfonyl phenylalanyl choromethyl ketone], 10 p.M TLCK

[cx-tosyl L-lysine chloromethyl ketone] in PBS), sonicated

briefly, andclarifiedby centrifugation for 20 min at4°Cin an

Eppendorfmicrocentrifuge. Fifty microliters ofa50%slurry of protein A-conjugated Sepharose beads (Sigma)was addedto theclarifiedlysatesonice and left for1htoremovematerials whichmightreactnonspecifically.The beadswereremovedby

centrifugation, andthe supernatantfluidswerereactedwith 1

p.l of UL20 antiserum overnight at 4°C. The immune com-plexeswererecoveredby addition of50 p.lofa50% slurry of protein A-Sepharose beads and incubationonicefor1h. The beadswerewashed four times withimmunoprecipitationbuffer and oncewith 100 mM NaCl-10 mM Tris-HCl, pH 7.4. The

immunoprecipitated proteinswere eluted from the beads by

addition of50p.l ofsamplebuffercontaining2% SDS and 5%

3-mercaptoethanol

andheating of the samples for 30 min at 37°C,electrophoretically separatedon a

denaturing

polyacryl-amide gel, transferred to a nitrocellulose sheet, reacted with theUL20 antiserum,andexposed toX-ray film.

VOL.68, 1994

on November 9, 2019 by guest

http://jvi.asm.org/

(5)

7410 WARD ET AL.

a

| < 9

X&zcw

X. O E

D ;

sn

6 uW

co o

200 _f

94

---g

116 67 _..WI > g 94 ;"ll-.^,

637

,

:A I,

43

* .0

_0 o

A C

V

.

.06

.0 .0

06s

o > n

Om 40 gE

43

30 V

IC 30 ^_

21

A. 7h. B. 16h C. HEp-2Cells D. 143TK-Cells

FIG. 6. Photographs ofbiotinylated, immunoprecipitated proteins. (AandB)Vero cellmonolayerswereinfected withHSV-1(F)virus(10PFU

percell), andthemonolayerswere exposedtoNHS-LC-biotinat7or16 hpostinfection. (CandD)HEp-2or143TK-cellswereinfected with

HSV-1(F)orR7405(UL20-CMV tagged,used with CMVantibody)virus(10PFUpercell),and themonolayerswereexposedtoNHS-LC-biotin

at16hpostinfection.All cellsweremaintainedat34°C. Surface-biotinylatedcellswerewashed, harvested,andlysedinimmunoprecipitationbuffer.

The celllysateswerereactedwith eitherUL20rabbitantibody (lanesUL20pol. Ab.),monoclonalantibodytothe CMVepitope (lanesCMVmon.

Ab.), monoclonal antibodytogD (lanes gDmon.Ab.),rabbitantibodytoUL53(lanesUL53pol. Ab.),ormonoclonalantibodytoICP4(lanesICP4 mon.Ab.). Allimmunoprecipitated samplesother thanUL20orUL53wereboiled beforeelectrophoresis.Theprecipitates containingUL20or

UL53 rabbitantiserumwereheatedat37°Cfor 30min priortoelectrophoresis.Theimmunoprecipitated proteinswereseparatedondenaturing

polyacrylamidegels(panelsA andB,12.5%gel; panelsC andD,11%gel),transferredtonitrocellulosesheets,and reacted withstreptavidin-horseradish peroxidase conjugate.Theprecipitated proteinswerevisualizedby usingthe ECLchemiluminescence detectionsystemfrom Amersham. Thearrowhead

inpanelB indicatesthepositionofUL20 migrationasdetectedbyimmunoblots(not shown). M.W.,molecularweight.

Forimmunoprecipitation of cell surfaceproteins, infected-cellmonolayerswerewashed withPBS andincubatedatroom

temperature in asolution of 75 jig of NHS-LC-biotin (Pierce Chemical Co., Rockford, Ill.)perml of PBS for 30min. The cells were rinsed with PBS, harvested, and lysed in immuno-precipitation buffer. Immunoprecipitations, electrophoresis, and transfer of the precipitated proteins were done as de-scribed above exceptthatgoatanti-mouseIgG-coatedagarose

beads (Sigma ChemicalCo.)wereusedtoimmunoprecipitate samplesincubated withmonoclonal antibodies and allsamples exceptthoseprecipitatedwithantibodies toUL20ortoUL53 wereboiledbeforebeing loadedonSDS-polyacrylamide gels.

Thenitrocellulosesheetswerethenblocked overnightat40C in asolution of5% milk inPBS, rinsed in PBS containing 0.1%

Tween 20, and reacted with streptavidin-horseradish peroxi-dase conjugate (1:1,500 dilution in PBS-0.1% Tween 20) (Amersham Life Sciences) for 1 h. The membranes were

washedextensivelyinPBS-0.1% Tween20 and developed by usingreagentsandprotocolsforchemiluminescence obtained from Amersham Life Sciences. The developed blots were

exposed toX-rayfilmtovisualize theprecipitated proteins. Immunofluorescence. Approximately

10'

Veroor

143TK-cells were seeded onto sterilized glass coverslips in 24-well tissue cultureplates (Costar)and allowedtoattachovernight.

The cellswereexposedto5 PFU of R7032(gE-)viruspercell andfixed in ice-cold methanolat14to16hafter infection. The coverslipswerefirstblocked for 30minatroomtemperaturein PBS containing 1% BSA and then reacted with primary antibody for 1 h at room temperature, washed in PBS, and reacted with the appropriate fluorescein-orTexas red-conju-gated secondary antibody for 1 h atroom temperature. The coverslipcultureswererinsedagaininPBS, mountedonglass

microscope slideson adropof90%glycerolin PBScontaining 1 mgofp-phenylenediamineperml. and examinedin aZeiss confocal fluorescence microscope. Digital images of the fluo-rescentprofileswereacquired by usingsoftwareprovidedwith theZeiss confocalmicroscopeandprinted byaCP210 Codon-icsdigital printer.

Virion preparation. Virions were purified essentially as

describedby Szilagyi and Cunningham (47). Briefly, medium containing virions was centrifuged at 1,000 x g for 30 min. Virionswerethenpelleted by centrifugationfor 2 hat80,000

x g, resuspended in Dulbecco's modified Eagle's medium

lacking phenol red,andlayeredontoa5to15%Ficollgradient made in the same medium. Bands containing the virion particleswerecollectedbysidepuncture,diluted with medium lacking phenol red, pelleted by centrifugation (80,000 xgfor 2 hat4°C), gently resuspendedin 200

RI

ofPBS,and storedat 21

`.-J. VIROL.

on November 9, 2019 by guest

http://jvi.asm.org/

(6)

UL20 LOCALIZATION AND FUNCTION IN HSV-INFECTED CELLS

ILL

~p N

CO) ro%

I cc

aw.. Iftow

qrl

U)

x

N N

1

2

3

4

FIG. 7. Photographs ofbiotinylated,immunoprecipitatedproteins. HEp-2 cells were infected with HSV-1(F) (lanes 1 and 3) or with UL20- virus R7225 (lanes 2 and4) and reacted with biotin at 16h postinfection. Lanes 1 and 2, infected cell monolayerswerewashed and exposedtoNHS-LC-biotinas described in the legendtoFig. 6. The surface-biotinylated cellswerewashed, harvested, and lysed in immunoprecipitation buffer. The cell lysates were reactedwith anti-UL20 rabbit serum. Lanes 3 and 4, infected cells were harvested, washed,and disrupted in0.4%Nonidet P-40. The cytoplasmic extracts werethenexposed to 300 ,ug of NHS-LC-biotin per ml for15min at roomtemperature.Thereaction was quenched by the addition of100 mMTris-HCl,pH7.5,and thecell lysateswerereacted withanti-UL20 antiserum.Immunoprecipitated, biotinylated proteins wereseparated by electrophoresis and transferred to nitrocellulose blots, and the proteinswerevisualized as described inthelegend toFig.6.

Co )

cn Cj) cJ

WCL

d

1:,.j.

..

Aiafia_

92 69

47

cn u)

a

3 -j

5 7-8 11-12 13-14 15-16

18 19

C)

_a-0

Cu

92 69

47

30

21

... 21

_ ~~22

-80°C.Afraction of thevirionpreparationwasprocessed for electron microscopic observation in order to monitor the extent ofpurification.

RESULTS

Production of UL20 antiserum. NewZealand White rabbits were inoculated subcutaneously with

UL20-3-galactosidase

fusion protein that had been electroeluted from denaturing

polyacrylamide gels as described in Materials and Methods.

The resulting antiserum was reacted with electrophoretically

separated infected-cell proteins that hadbeen transferred to

nitrocellulose sheets. The results are shown in Fig. 2. The antiserum reacted withasingle proteinband withanapparent Mr of approximately 24,000 in lysates of HEp-2 or 143TK-cells infected with HSV-1(F). An identical pattern was ob-served forlysatesof infected Vero cells(datanotshown).The

specificityofthe antiserumwasdemonstratedby itsreactivity

with a single protein band with lysatesof HSV-1(F)-infected

cells butnotwithlysates of mock-orR7225(UL20-)-infected

cells (Fig. 2). The antiserum did not react with infected-cell

polypeptidesfromlysatesof cellsinfected withHSV-2(G)(Fig.

2).

Requirements and timing ofexpression of the UL20 gene. Verocellswereexposedto 10 PFUofHSV-1(F)percell and incubated at37°Cinmedium199vinthe presenceorabsence

ofphosphonoacetate (300

jig/ml;

Sigma). At this

concentra-tion, phosphonoacetate totallyabolishes viral DNAsynthesis.

Atintervals the cellswere harvested, solubilized indisruption

buffer containing 2% SDS and 1% ,-mercaptoethanol, incu-bated at 37°C for 20 min, subjected to electrophoresis in a

denaturing polyacrylamide gel,transferred to anitrocellulose

sheet,andreacted with theanti-UL20rabbitserum.The results

(Fig. 3) indicate that theUL20 protein accumulated inreadily

detectable amounts by 6 h postinfection, andno appreciable

change in the amounts ofprotein was detected beyond 9 h

postinfection. The observation that the synthesis of UL20

proteinwasdiminished butnotabolishedbyphosphonoacetate

suggests thattheUL20 genewasregulated as a

yl

gene.

1 2 3 4 5

FIG. 8. Photographs of silver-stained or immunoblotted electro-phoretically separated virion polypeptides. Virions were prepared from the extracellular fluidofHSV-1(F)-infected BHKcells. Virion polypeptideswere denatured inabuffer containingSDS and 1-mer-captoethanolandwereseparatedon adenaturing polyacrylamide gel. Theproteinswereeither silver stained(lanes1, 2,and3)ortransferred

to nitrocellulose sheets and reacted with the anti-UL20rabbit

anti-serum (lanes 4 and 5). Virion protein designations (center) and molecularweightsize markers(in thousands)(sides)areindicated.H., heavy; L.,light.

Theelectrophoretic mobilityofpulse-labeled UL20 protein is not altered after a chase. The majority of membrane-associatedproteinsencoded in the HSV-1 genome have been showntobemodifiedbyglycosylation.Althoughthepredicted

amino acid sequence of theUL20openreadingframe present in HSV-1 strain 17 does not contain consensus sites for N-linkedglycosylation(30),we wereinterestedto seewhether there was any change in the electrophoretic mobility of the UL20 protein in a pulse-chase experiment. In this series of

experimentswe usedHEp-2cells inasmuch asearlier studies

have shown that Vero cells contain an endogenous protease which may alter the electrophoretic mobilityof viralproteins

duringachase(35). HEp-2cells grownin 25-cm2 tissue culture flaskswere exposedto 10 PFU of R7032

(gE-)

per cell. At8 or15 h after infection,themediumwasreplacedwith 1mlof thesame mixture butwithout methionine or the serum sup-plement. The cellswere pulse-labeledateither 9or 16 h after infection with50,uCiof

[35S]methionine

for1hat37°C.Inthe cultures labeledat9h,thelabelingmediumwasthen

replaced

VOL.68, 1994 7411

on November 9, 2019 by guest

http://jvi.asm.org/

(7)

7412 WARD ET AL.

FIG. 9. Confocal,digitalimagesofinfected Vero(a, b,andc)or143TK-(d,e,andf)cells reacted with antibodiestoUL20(green fluorescence)

andj-COP(redfluorescence).Cellsweregrownonglass coverslips, infectedwith 3 to 5 PFU of R7032(gE-)virus percell,andfixedin ice-cold

methanolat14 to16h after infection. Thecoverslipswerereacted with theprimary antibodiesfor 1.5 hat roomtemperature, washed inPBS,and subsequentlyreacted with theappropriate fluoresceinorTexasred-conjugated secondary antibodyfor 1 hat roomtemperature.(aandb) Split imagesof Vero cells double stained with antibodies to

3-COP

(a;Texasredfluorescence) andtoUL20(b;FITCfluorescence). (c) Overlayof imagesinpanels a and b.(dande) Split imageof 143TK- cells double stained with antibodiesto,B-COP(d;Texasredfluorescence)andtoUL20 (e;FITCfluorescence). (f) Overlayofimagesinpanelsd ande.Theimageswerecapturedwith softwareprovidedbyZeiss with theinstrument andprintedbyaCodonics CP210printer.Theimageinpanelc wasattenuatedtoreduce theintensityoffluorescence.

with medium containing normal levels of unlabeled methio-nine, andthe cells were reincubatedat37°Cfor an additional 12 h. The cells labeled at 16 hafterinfectionwere harvested

immediately after the labelinginterval. The

[35S]methionine-labeledimmunoprecipitated proteinsareshown in Fig. 4, lanes 1to3.Therelative migration of UL20 protein was not altered at 12h after the

[35S]methionine

pulse(lane2),norwasthere evidence ofanyalteration when cells were pulse-labeled at 16 hafterinfection (lane 3). Furthermore, the migration of UL20 protein was also unaltered in pulse-chase experiments done with cells treated with monensin from the time of infection

(data not shown), suggesting that UL20 is not modified by

0-linkedglycosylation (22). The identification of the

[35S]me-thionine-labeled species as UL20 was verified by reacting the nitrocellulose sheet with the UL20 polyclonal serum (Fig. 4, lanes4 to6).The two moreslowly migrating species in lanes4 to6represent reactivity of the UL20 antiserum presentin the

immunoprecipitationreactionwith the alkaline

phosphatase-conjugated anti-rabbit antibody used in the immunoblot. We shouldnotethat (i) theduration of thepulsewas notexcessive giventhe slow rate ofglycosylationof viralproteinsininfected cells and (ii) the anti-rabbit alkaline phosphatase-conjugated secondary antibody used in the immunoblot does not detect the light chain of IgG present in the immunoprecipitation reactions (data notshown).

UL20 is not detected at the plasma membrane. Earlier studies have shown that the UL20 protein is associated with cellular membranes. To determinewhetherUL20was present intheplasmamembrane,two series ofexperimentsweredone. In thefirst,unfixed Vero cells infected withgE- (R7032) virus wereexposedtorabbitanti-UL20 polyclonal antibodyandthen to biotinylated goat anti-rabbit immunoglobulin followed by avidinbound tobiotinylated peroxidase (ABCcomplex). Ina parallel experiment, a replicate infected-cell culture was ex-posed to rabbit anti-gM polyclonal antibody (5). The proce-dure, designatedthe blackplaquetechnique (24),detectedthe J.VIROL.

on November 9, 2019 by guest

http://jvi.asm.org/

(8)

UL20 LOCALIZATION AND FUNCTION IN HSV-INFECTED CELLS 7413

FIG. 10. Digital, unprocessedimages ofanR7032-infected Vero cell reacted with antibody to UL20 and anti-rabbit IgG conjugated to FITC. Cellswereinfected,fixed, and stainedasdescribedinthe legend to Fig. 8. Twelve0.5-jimsectionsthrough the z axis werecaptured and printed by a Codonics CP210 printer. The section in the top left panel is from the basolateral side of the cell.

presence of abundant amounts of gM (Fig. 5C) but not of UL20 proteins on the surface of infected cells (Fig. 5B). The UL20 protein does react with the antibody in the same system butonly after fixation of the cells with methanol, which renders the cells permeabletothe antibody(Fig. 5A).

Inthe second series of experiments, surface proteins from cells infected with wild-type virus were biotinylated at 16 h after infection as described in Materials and Methods. The cellswereharvested andlysed,and the celllysateswerereacted with the rabbitanti-UL20polyclonal antibodyorantibodies to CMVepitope for detection of CMV-tagged UL20. Antibodies totheviralglycoproteinDwereincluded as apositive control for surfaceprotein expression. The anti-UL53 rabbit polyclonal serum or anti-ICP4 monoclonal antibody was included as a

negative control,since these proteinsare notexpressedatthe

cell surface. Theimmunoprecipitated proteinswereseparated

ondenaturingpolyacrylamide gelsandtransferredto

nitrocel-lulose sheets. The sheets were reacted with streptavidin-horseradish peroxidase conjugate and developed by chemilu-minescence (ECL).TraceamountsofUL20weredetectedby chemiluminescence in immunoprecipitates from the surfaces of infected 143TK- and

HEp-2,

butnotVero, cells maintained

at37°C(datanotshown).Arepeatof thisexperimentat34°C

failed to yield detectable amounts of UL20 protein on the surfaceof infected Vero,143TK-,orHEp-2cells(Fig.6, lanes

UL20 pol. Ab.), whereas large amounts of gD were readily

detectable at both 7 and 16 h postinfection (Fig. 6A and B, lanes gDmon.Ab.). Furthermore, UL20 couldbebiotinylated ifinfected cellswerefirstdisrupted with NonidetP-40(Fig. 7, lane 3), while UL20 was not detected on the surface of wild-type or UL20 virus-infected cells or on UL20 virus-infected cells that had beendisrupted(Fig.7,lanes1, 2, and4).

Two comments regarding these experiments are

appropri-ate.First,weusedagE-virus in the first series ofexperiments to avoidnonspecific interaction of gE with the Fc portion of the IgG molecule. Since the absence of UL20proteinon the surface of infected cells could be due to the absence of gE,

wild-type virus (gE+) was used in the second series. As

expected, gEwas immunoprecipitated nonspecifically to vari-ousdegrees,dependingoncell type and rabbit serum (Fig.6).

Inthis instance, discrimination between specificand nonspe-cificbindingwas feasible and in fact reinforcedourconcerns regarding the interaction of gE with the Fc domain of IgG. Second,wesuspect that thetraceamountsofUL20detectedon the surface of 143TK-orHEp-2 cells incubatedat37°C(data

notshown)wasdue to the presence of virionsatthecellsuface, sincewecouldnotdetect anyUL20proteinatthecell surface of cells maintainedat34°C. Theegress of virionsfrom cells is delayed at 34°C (18). We cannot exclude leakage of the infected cells incubated at 37°C, however, neither ICP4 nor

UL53 (both internal proteins) was labeled with biotin and

precipitated from the surface of infected HEp-2 or 143TK-cells maintained at34°C (Fig. 6C andD). We conclude from these studies that the plasma membrane of infected cells containsatmostsmallornegligibleamountsofUL20protein.

UL20ispresentin extracellularvirions. Inasmuch asUL20 is required to facilitate transport of virions from the space between the inner and outer nuclear membranes to the extracellular space, it was of interest to determine whether UL20isphysically associatedwith virions. Intheseexperiments

virionswere collected from extracellular fluid and banded in FicollgradientsasdescribedbySzilagyiandCunningham(47).

Thisprocedure allowed the differentiation between noninfec-tious (light) particles and infectious (heavy) particles. The

electrophoretically separated virion proteins obtained as

de-scribedinMaterials and Methodswereeither silver stainedor VOL.68, 1994

on November 9, 2019 by guest

http://jvi.asm.org/

(9)

7414 WARD ET AL.

FIG. 11. Digital, unprocessed imagesof Vero cellstransfectedwithplasmids containingtheUL20openreadingframeasdescribedinMaterials and Methods. The cellswerereacted withantibodytoUL20and anti-rabbitIgG conjugatedtoFITC.Cellswerefixedinmethanolandstained30 hafter transfection.

transferred tonitrocellulose sheets and stained with the anti-UL20 polyclonalrabbit antiserum. The results shown inFig.8 indicate that UL20 was present in extracellular virions. We should note that the electrophoretic profile of the virions presentedinFig.8 (lanes2and3)differs from thatpublished previously by this laboratory. The problem stems from the observation that while boiling in SDS is essential for the solubilization ofmanyvirionproteins,itcausestheaggregation

of integralmembrane proteins with multiple transmembrane domains (see reference 44 and references therein; 46). As a

consequence,UL20 proteininpreparationsboiled in SDS does not enterthegel. Conversely, failuretoboil results in electro-phoretic profilesof virionproteins in whichsomeproteinsare underrepresented.

Localization ofUL20 proteinin infected cells.Theobjective of theseexperimentswastodetermine the sites oflocalization of UL20 in the infected cells by immunofluorescence with selectedreagents. Two series ofexperimentsweredone.

In the first series, the cells were infected with gE- virus (R7032)topreclude nonspecificfluorescencecaused by inter-actionofIgGwithFcreceptors.The infected cellswerestained

withthe rabbitanti-UL20 serumaloneordouble stained with

theUL20antiserum andamonoclonalantibodytothe Golgi-derived vesicle coat protein 1-COP. Since in the course of

thesestudies it becameapparentthat UL20 protein colocalizes in partwiththeGolgi-and intermediate compartment-associ-atedprotein 1-COP,the studies focusedprimarilyoninfected Vero andhuman143TK- cells. The selection of thesecellsfor

our studies was based on the observation that the Golgi

apparatusis fragmentedand dispersedin infected Vero cells but notin infected 143TK- cells(8).

The results are shown in Fig. 9 and 10. In Fig. 9 the photographs show individual Vero (a) and 143TK- (d) cells reacted with the anti-,-COP monoclonal antibody and anti-mouseIgG conjugatedtoTexasred. Figure9b andeshow the same cells reacted withantibodytoUL20 and anti-rabbit IgG

conjugated toFITC. Figure 9c and f show the twoimagesof each cellsuperimposed.These results indicate that thatUL20

is present in nuclear membranes and that the strongestsignals

in the cytoplasmic domains of both Vero and 143TK- cells were colocalized with

p-COP.

Moreover, the distribution of

p-COP

wasconsistent with thefragmentation oftheGolgi in Verocells butnotin 143TK-cells. To make thecoincidenceof

the n-COP and UL20 colocalization more visible, the UL20

antibody fluorescence in Vero cellswas diminished (Fig. 9b

andc). Figure 10shows sections of another infected Vero cell

reacted withUL20antibodyandanti-rabbit IgGconjugatedto FITC. The results showastrongly fluorescentringaround the nucleus which extends into but doesnotfill thecytoplasm.

On the basis of the association ofUL20with membranes(6)

and its localization in infected cells, we conclude that this protein is present in nuclear membranes and in various cyto-plasmic structures, including all or portions of the Golgi

apparatus. Asnoted above, UL20 is notpresent in detectable amounts ontheinfected-cell surface.

In asecond series ofexperiments, Vero cellswere cotrans-fected withaplasmid containingthe entirecodingsequenceof UL20 driven by either the (4 or the ot-y promoter (see

MaterialsandMethods)and withasecondplasmid containing

the ao-TIF gene and itsregulatory sequences.Figure 11 shows that in the absence of viral infection,the fluorescence due to the UL20 protein was diffused thoughout the cytoplasm and J.VIROL.

on November 9, 2019 by guest

http://jvi.asm.org/

(10)

UL20 LOCALIZATION AND FUNCTION IN HSV-INFECTED CELLS

Extracellular

S

ae

Golgi

c,Q

UL20% N f

Extracellular Space

Procesed

~~Uu_ eqoligosaccharides

Golgi

Cytoplasm ,.: -, Q..

Cvtoplasm

Unprocessed

oligosaccharides

Nucleus

FIG. 12. Schematic representation of the distributionofUL20, virions, and cellular membrane-associated glycoproteins in Vero and 143TK-cellsinfectedwithwild-type and UL20- virus. The right panel shows the events occurring in UL20- virus-infected Vero cells. From the bottom of thediagramup,capsidsbecome envelopedattheouternuclear membrane and accumulate in the space between the nuclear membranes. The oligosaccharidesonthe glycoproteins in virions and those contained in the nuclear membranes are not processed (3). However, the glycoproteins associated withmembranesdo reachtheGolgi apparatus and are fully processed, but they are retained in the trans-Golgi compartment (i.e., in a compartment after addition of the terminal sialic acid) and are not transported to the plasma membrane. The thin dashed lines represent unprocessed oligosaccharides, the Golgi stacks are shorter to emphasize that they are fragmented and dispersed, and the thicker dashed lines representprocessedoligosaccharides.Theleftpanel represents 143TK- cells infected with wild-type virus. In these instances the glycoproteins associated with cellular membranes transit from the trans-Golgi to the plasma membrane, and the virions enter the exocytic pathway through transportvesicles formed at the outer nuclear membranes. The dots lining all membranes except theplasma membrane represent UL20 protein, which does notreach the plasma membrane. The Golgi here is shown to be intact, as would be expected in infected 143TK- cells. Note that the samegeneralpatternofproteinand virion distribution would occur in 143TK-cells infected with UL20- virus, except that UL20 protein would beabsent, or in Vero cells infected with wild-type virus, except that the Golgi apparatus would be fragmented and dispersed.

included the perinuclear space. It is noteworthy that the amountofUL20 fluorescence detected in the transfected cells was ashighorhigher than thatseenin infectedcells, possibly because the promoters fused to the UL20 coding sequences were strongerthan the natural promoter of the gene.

DISCUSSION

The studiespresented in this report show the following.

(i)Antiserum raisedagainstachimeric protein consisting of the,-galactosidase gene fusedto95%of thecoding squences of theUL20protein reacted withapolypeptidewithanMrof approximately 24,000. This is consistent with the predicted molecular weight of the protein and with the results of previous studies with epitopically tagged proteinaswellaswith antipeptide antisera usedto immunoprecipitate UL20 (Mr

21,000)from infected cells (6, 29).

(ii) Addition of phosphonoacetate to cells infected with

HSV-1(F) did not block synthesis of UL20. The protein

accumulatedand wasdetectedby immunoblotting beginningat 6 hafter infection.Weconclude thatUL20,aprotein dispens-able for viralreplicationin cells inculture,isregulatedas aY1 gene. Our studiesare atvariance withaprevious report which suggested that the UL20 protein is encoded by an essential gene and isexpressed asearlyas2 to 4hpostinfection (29).

(iii) The predicted amino acid sequence of the UL20 protein encodedby HSV-1 strain 17 (30) doesnotcontain consensus

sites associated with N-linked glycosylation, and pulse-chase analysis of UL20 didnotreveal anysignificant alterations in the relative electrophoretic mobility of the protein in either the presence (Fig. 4) or absence(datanotshown) of monensin.

(iV) UL20 could not be detected at the cell surface as measured either by antibody staining of unfixed cells by the blackplaque assay(Fig. 5) orby immunoprecipitation of cell surfaceproteins (Fig. 6 and7). These results were surprising

since all of the membraneproteins that have been showntobe virion associated have also been detected in the plasma

membrane (5, 17, 19, 37,39). WhetherUL20 containsspecific

retentionsignals topreventit fromreachingthe cell surface is unknown.

(V) UL20was present in virions isolated from extracellular medium.

(vi) Immunofluorescence analyses of infected cells double stained with antibodies toUL20 and

a-COP

proteinrevealed thatUL20ispresentin acytoplasmiccompartmentinvolved in the exocytic pathway. In addition, UL20 was detected in a

perinuclear ring, possibly the nuclear membrane. Of

signifi-canceis thefinding thatincertain cell types(VeroandHEp-2)

infected with HSV-1, the Golgi becomes fragmented and dispersed, and there is aconcomitant redistribution of

Golgi-resident enzymes and ofa Golgicoatprotein (8).This redis-tribution is a late event in the viral replicative cycle and

possibly reflects a disequilibrium between anterograde and

VOL. 68,1994 7415

on November 9, 2019 by guest

http://jvi.asm.org/

(11)

7416 WARD ET AL.

retrogradetransportcaused byanoverwhelminginflux of viral

glycoproteins and virions into the exocytic pathway (8). Our results showed that regardless of cell type, the distribution of UL20 closely approximated that ofthe Golgi-associated

pro-tein.

The results reported here raise several key issues with

respect to viral egress and the role of UL20 in this process. While it is generally agreed that capsids assemble in the nucleus andareenvelopedattheinnernuclear membrane (38, 39), theprecise events whichgovernviriontransportbetween thesite ofenvelopment and theextracellularspace have been

the subject of much debate (reviewed in reference 40). The results obtained from several studies support the model, proposed on the basis of electron microscopic studies by Schwartz and Roizman (42), that virions are transported throughthecytoplasminmembrane-boundvesicles (9,22, 38, 40, 48) as would be expected for macromolecules that are

destined for export from the cell. Vesicularly transported proteinsfollowadefault pathway from the endoplasmic

retic-ulum through the Golgi to the plasma membrane unless the proteins contain specific retention signals (reviewed in

refer-ences 34, 36, and 41). That virions and viral glycoproteins utilizethenormal cellular exocytic pathwayhas been suggested by the observations that viral glycoprotein processing and maturationaswellasvirionexocytosisare impaired inmutant

cells defective in Golgi enzymatic activities or in competent

cellsexposedtoagentswhich disruptthis pathway (10, 11, 22). Although in cells infectedwith theUL20- virus, virion

exocy-tosis wasblocked inapre-Golgicompartment,viral glycopro-teinswere transportedatleastto the trans-Golgi inasmuchas

they contained terminal sialic acid residues (3). These obser-vations suggest that the vesicles which transport virions may

have anorigin different from that of vesicles which transport

viralglycoproteins (3, 6). The apparent presence ofUL20 in

the nuclear membrane is consistent with the requirementfor UL20- to facilitate the exocytosis of virions from the space

betweenthe innerandouternuclearmembranes. The

pheno-type of the UL20- virus, aswell as that ofavirus carrying a

temperature-sensitive mutation in the gHgene and

character-ized byretention of infectiousvirus containinggHin infected cells maintained at the nonpermissive temperature (12),

sug-gests that viral egress may not occur by default, as would

normally be expected for vesicularly transported macromole-cules, but ratheras a directedseries ofevents.

Theresults ofourstudies andthe considerations cited above lead ustoproposethe model illustratedin Fig. 12. According

to this model, UL20 is present in the nuclear membranes, possibly in theendoplasmic reticulum (although this remains tobeproven), in the Golgiapparatus,and,as a consequenceof envelopment, also in virion envelopes. The UL20 present in transportvesiclesisretained insome Golgicompartment and does not reach the plasma membrane. Finally, the UL20 protein present in virions remains associated with the virion envelope throughout its transit through the cytoplasm. The UL20 protein is required for exocytosis of virions in infected

VeroandHEp-2cellsand, mostprobably, in infected cellsin

which the Golgi apparatus is fragmented and dispersed throughout thecytoplasm. Conceivably thegeneencodingthe

UL20 proteins may have evolved to compensate for the fragmentation of the Golgiapparatus.

ACKNOWLEDGMENTS

We thank L. Pereira, D. Johnson, and T. Kreis for the gifts of invaluableimmunologicreagents.

Thestudiesatthe Universityof Chicagowereaided bygrantsfrom the National Cancer Institute (CA47451) and the National Institute

for Allergy and Infectious Diseases (AI24009), by the U.S. Public

Health Service, and by an unrestricted grant from Bristol-Myers

Squibb Program inInfectious Diseases.The studies attheUniversity of Bologna were aided by grants from Consiglio Nazionale delle Ricerche, Target Project in Genetic Engineering, Target Project on Biotechnology, Associazione Italiana per la Ricerca sul Cancro

(AIRC), and ProgettoAIDS-Istituto Superiore diSanita.

REFERENCES

1. Ackermann, M., R.Longnecker, B. Roizman, and L. Pereira. 1986. Identification and gene location of anovelglycoprotein specified byherpes simplex virus 1. Virology150:207-220.

2. Allan, V. J., and T. E. Kreis. 1986. Amicrotubule-binding protein associated with membranes of the golgi apparatus. J. Cell Biol. 103:2229-2239.

3. Avitabile, E., P. L. Ward, C. Di Lazzaro, M. R. Torrisi, B. Roizman, and G. Campadelli-Fiume. 1994. The herpes simplex virusUL20 protein compensates for the differential disruption of exocytosis of virions and viral membraneglycoproteinsassociated withfragmentation of the Golgi apparatus. J. Virol. 68:7397-7405. 4. Baines, J. D., and B. Roizman. 1991. The open reading frames UL3, UL4, UL10, and UL16 are dispensable for the growth of herpessimplex virus 1 in cell culture. J. Virol.65:938-944. 5. Baines, J. D., and B. Roizman. 1993. The ULlO gene of herpes

simplex virus 1 encodes a novelglycoprotein, gM, which is present in the virion and in the plasma membrane of infected cells. J. Virol. 67:1441-1452.

6. Baines, J. D., P. L. Ward, G. Campadelli-Fiume, and B. Roizman. 1991. TheUL20 gene of herpes simplex virus 1 encodes a function necessary for viral egress. J. Virol. 65:6414-6424.

7. Buckmaster, E. A., U. Gompels, and A. Minson. 1984. Characteri-sation andphysical mapping of an HSV-1glycoprotein of approx-imately 115 x 103 molecular weight. Virology139:408-413. 8. Campadelli, G., R.Brandimarti, C. Di Lazzaro, P. L. Ward, B.

Roizman, and M. R.Torrisi.1993.Fragmentation and dispersal of golgi proteins and redistribution of glycoproteins and glycolipids processedthrough the golgi apparatus after infection with herpes simplex virus 1. Proc. Natl. Acad. Sci. USA90:2798-2802. 9. Campadelli-Fiume, G., F. Farabegoli, S. D. Gaeta, and B.

Roiz-man. 1991. Origin ofunenveloped capsids in the cytoplasm of cells infected with herpes simplex virus 1. J. Virol. 65:1589-1595. 10. Campadelli-Fiume, G., L. Poletti, F. Dall'olio, and F.

Serafini-Cessi. 1982. Infectivity and glycoprotein processing of herpes simplex virus-1 grown in a ricin-resistant cell line deficient in N-acetylglucosaminyl transferase. J. Virol. 43:1061-1071. 11. Cheung, P., B. W. Banfield, and F. Tufaro. 1991. Brefeldin A

arrests thematuration and egress of herpes simplex virus particles duringinfection. J. Virol. 65:1893-1904.

12. Desai, P. J., P. A.Schaffer,and A. C.Minson. 1988. Excretion of noninfectious virus particles lacking glycoprotein H by a temper-ature-sensitive mutant of herpes simplex virus type 1: evidence that gH isessential for virioninfectivity. J. Gen. Virol. 69:1147-1156.

13. Ejercito,P. M., E. D.Kieff, and B. Roizman. 1968. Characteriza-tion of herpes simplex virus strains differing in their effects on socialbehavior of infected cells. J. Gen. Virol. 2:357-364. 14. Frame, M. C., H. S. Marsden, and D. J. McGeoch. 1986. Novel

herpes simplex virus type 1glycoproteins identified by antiserum against a synthetic oligopeptide from the predicted product of geneUS4. J. Gen. Virol. 67:745-751.

15. Gompels, U., and A. Minson. 1986. The properties and sequence ofglycoprotein H of herpes simplex virus type 1. Virology 153: 230-247.

16. Heine, J. W., R. W. Honess, E.Cassai, and B. Roizman. 1974. Proteins specified by herpes simplex virus. XII. The virion polypeptides of type 1 strains. J. Virol. 14:640-651.

17. Heine, J. W., P. G. Spear, and B. Roizman. 1972. Proteins specified by herpes simplex virus. VI. Viral proteins in the plasma mem-brane. J. Virol. 9:431-439.

18. Hoggan, M. D., and B. Roizman. 1959. The effect oftemperature of incubation on theformation and release of herpes simplex virus ininfected FL cells. Virology8:508-524.

19. Hutchinson, L., H. Browne, V. Wargent, N. Davis-Poynter, S. J. VIROL.

on November 9, 2019 by guest

http://jvi.asm.org/

(12)

UL20 LOCALIZATION AND FUNCTION IN HSV-INFECTED CELLS 7417 Primorac,K. Goldsmith, A. C. Minson, and D. C. Johnson. 1992.

Anovel herpes simplex virus glycoprotein, gL, forms a complex withglycoprotein H (gH) and affects normal folding and surface expression of gH. J. Virol. 66:2240-2250.

20. Hutchinson, L., K. Goldsmith, D. Snoddy, H. Ghosh, F. L. Graham, and D. C. Johnson. 1992. Identification and character-ization of a novel herpes simplex virus glycoprotein, gK, involved incell fusion. J. Virol. 66:5603-5609.

21. Jacobson, J. G.,S. L. Martin, and D. M. Cohen. 1989. A conserved openreading frame thatoverlaps the herpessimplex virus thymi-dine kinase gene isimportant for viral growth in cell culture. J. Virol. 63:1839-1843.

22. Johnson, D. C., and P. G. Spear. 1982. Monensin inhibits the processing ofherpessimplex virus glycoproteins, their transport to the cellsurface, and the egress of virions from infected cells. J. Virol. 43:1101-1112.

23. King, R. W., D. E. Barker, and B. Roizman. Unpublished data. 24. Kousalas, K. G., P. E. Pellett, L.Pereira, and B. Roizman. 1984.

Mutations affecting conformation or sequence neutralizing epitopesidentified by reactivityofviable plaquessegregatefrom synand ts domains.Virology135:379-394.

25. Liu, F., and B.Roizman. 1991. The promoter, transcriptional unit, andcodingsequencesofherpes simplex virus 1 family 35 proteins

are contained withinand in frame with the UL26 open reading frame. J. Virol. 65:206-212.

26. Longnecker,R.,S. Chatterjee, R. Whitley, and B. Roizman. 1987. Identificationof aherpes simplexvirus 1glycoproteingenewithin

ageneclusterdispensableforgrowthintissueculture. Proc. Natl. Acad. Sci. USA 84:4303-4307.

27. Longnecker, R., and B. Roizman. 1986.Generationof aninverting herpes simplex virus 1 mutant lacking the L-S junction a se-quences, anorigin of DNAsynthesis, andseveral genes,including those specifying glycoprotein E and the cx47 gene. J. Virol. 58: 583-591.

28. Longnecker, R., and B. Roizman. 1987. Clustering of genes dispensableforgrowthincultureinthe S component of the HSV-1 genome.Science 236:573-576.

29. MacLean, C. A., S.Efstathiou,M.L.Elliott,F. E.Jamieson, and D.J. McGeoch. 1991.Investigationofherpes simplexvirus type 1 genes encoding multiply inserted membrane proteins. J. Gen. Virol. 72:897-906.

30. McGeoch,D.J., M. A.Dalrymple,A.J.Davison,A.Dolan,M. C. Frame, D.McNab, L. J. Perry, J. E. Scott, and P.Taylor. 1988. The completeDNA sequence of thelongunique regionin the genome ofherpes simplexvirus type 1. J. Gen. Virol. 69:1531-1574. 31. McKnight, J. L.C.,P. E.Pellett, F. J.Jenkins,and B. Roizman.

1987. Characterization and nucleotide sequence of two herpes simplexvirus 1 genes whoseproducts modulate a-trans-inducing factor-dependentactivation of a genes. J. Virol. 61:992-1001. 32. Meignier, B., R.Longnecker, P.Mavromara-Nazos,A.Sears,and

B. Roizman. 1988. Virulence of and establishment oflatencyby engineered deletion mutantsofherpes simplexvirus 1.Virology 162:251-254.

33. Para, M. F., K. M. Zezulak,A. J. Conley, M. Weinberger, K.

Snitzer, and P. G. Spear. 1983. Use of monoclonal antibodies against two 75,000-molecular-weight glycoproteins specified by herpes simplex virus type 2 in glycoprotein identification and gene mapping. J. Virol. 45:1223-1227.

34. Pelham, H. R. B. 1989. Control of proteinexit from the endoplas-mic reticulum. Annu. Rev. Cell Biol. 5:1-23.

35. Pereira, L., D. Dondero, B. Norrild, and B. Roizman. 1981. Differential immunologic reactivity and processing of glycopro-teins gA and gB of herpes simplex virus types 1 and 2 made in Veroand HEp 2cells. Proc. Natl. Acad. Sci. USA 78:5202-5206. 36. Pryer, N. K., L. J. Wuestehube, and R. Schekman. 1992.

Vesicle-mediated proteinsorting. Annu. Rev. Biochem. 61:471-516. 37. Purves, F. C., D. Spector, and B. Roizman. 1992. UL34, the target

gene of theherpes simplex virus Us3protein kinase, is a mem-braneprotein which in itsunphosphorylatedstateassociates with novelphosphoproteins. J. Virol. 66:4295-4303.

38. Roizman, B., and D. Furlong. 1974. Thereplication of herpesvi-ruses, p. 229-403. In H.Fraenkel-Conrat and R. R. Wagner (ed.), Comprehensive virology, vol. 3. PlenumPress, New York. 39. Roizman, B.,and A. Sears. 1990. Herpessimplex viruses and their

replication, p. 1795-1841. In B. N. Fields and D. M.Knipe (ed.), Virology.RavenPress, New York.

40. Roizman, B., and A. Sears. 1993.Herpessimplexviruses and their replication, p. 11-68. In B.Roizman, R. J.Whitley,and C.Lopez (ed.),The humanherpesviruses. RavenPress, New York. 41. Rothman, J.E., and L. Orci. 1992. Molecular dissection of the

secretorypathway. Nature (London) 355:409-415.

42. Schwartz, J., and B. Roizman. 1969. Concerning the egress of herpes simplexvirus from infected cells: electron andlight micro-scope observations. Virology 38:42-49.

43. Sears, A. E., B. S. McGuire, and B. Roizman. 1991. Infection of polarizedMDCK cells withherpessimplexvirus 1:two asymmetri-callydistributed cell receptors interact with different viralproteins. Proc.Natl. Acad. Sci. USA 88:5087-5091.

44. Semenza, J.C.,K.G. Hardwick, N. Dean, and H. R. B. Pelham. 1990. ERD2, a yeast gene required for the receptor-mediated retrieval of luminal ERproteinsfrom the secretorypathway. Cell 61:1349-1357.

45. Spear, P. G. 1976. Membraneproteinsspecified by herpes simplex virus. I. Identification of fourglycoprotein precursors and their products in type 1-infected cells. J. Virol. 17:991-1008.

46. Spear, P. G., and B. Roizman. 1972. Proteinsspecified by herpes simplex virus. V. Purification and structural proteins of the herpesvirion. J.Virol. 9:143-159.

47. Szilagyi, J. F., and C. Cunningham. 1991. Identification and characterization of a novel non-infectious herpes simplex virus-relatedparticle.J.Gen. Virol. 72:661-668.

48. Torrisi, M. R, C. Di Lazzaro, A. Pavan, L. Pereira, and G. Campadelli-Fiume. 1992.Herpessimplexvirusenvelopmentand maturation studiesbyfracturelabel.J.Virol. 66:554-561. 49. Ward,P.L.,andB. Roizman.Unpublisheddata.

50. Weber, P. C.,M.Levine,andJ. C. Glorioso. 1987.Rapid identi-ficationofnonessentialgenesofherpessimplexvirus type1by TnS mutagenesis.Science 236:576-579.

VOL. 68, 1994

on November 9, 2019 by guest

http://jvi.asm.org/

References

Related documents