• No results found

Enhancement of feline immunodeficiency virus (FIV) infection after DNA vaccination with the FIV envelope.

N/A
N/A
Protected

Academic year: 2019

Share "Enhancement of feline immunodeficiency virus (FIV) infection after DNA vaccination with the FIV envelope."

Copied!
10
0
0

Loading.... (view fulltext now)

Full text

(1)

Copyright © 1997, American Society for Microbiology

Enhancement of Feline Immunodeficiency Virus (FIV) Infection

after DNA Vaccination with the FIV Envelope

J. RICHARDSON,

1

A. MORAILLON,

2

S. BAUD,

1

A.-M. CUISINIER,

3

P. SONIGO,

1AND

G. PANCINO

1

*

Ge´ne´tique des Virus et Immunopharmacologie Mole´culaire, ICGM-CNRS UPR415, Institut Cochin de Ge´ne´tique

Mole´culaire, 75014 Paris,

1

Ge´ne´tique Mole´culaire Ge´ne´tique Virale, Institut National de la Recherche

Agronomique, Ecole Nationale Ve´te´rinaire d’Alfort, 947094 Maisons-Alfort

Cedex,

2

and Virbac Laboratories, 06511 Carros Cedex,

3

France

Received 11 June 1997/Accepted 12 September 1997

Despite intensive experimentation to develop effective and safe vaccines against the human

immunodefi-ciency viruses and other pathogenic lentiviruses, it remains unclear whether an immune response that does not

afford protection may, on the contrary, produce adverse effects. In the present study, the effect of genetic

immunization with the env gene was examined in a natural animal model of lentivirus pathogenesis, infection

of cats by the feline immunodeficiency virus (FIV). Three groups of seven cats were immunized by

intramus-cular transfer of plasmid DNAs expressing either the wild-type envelope or two envelopes bearing mutations

in the principal immunodominant domain of the transmembrane glycoprotein. Upon homologous challenge,

determination of plasma virus load showed that the acute phase of viral infection occurred earlier in the three

groups of cats immunized with FIV envelopes than in the control cats. Genetic immunization, however, elicited

low or undetectable levels of antibodies directed against envelope glycoproteins. These results suggest that

immunization with the FIV env gene may result in enhancement of infection and that mechanisms unrelated

to enhancing antibodies underlay the observed acceleration.

Efforts to develop an effective vaccine against infections

caused by lentiviruses, including the human immunodeficiency

virus (HIV), are confounded by an insufficient understanding

of the role of host immunity in persistent infection. One of the

issues under debate is whether certain components of the

im-mune response developed against HIV, instead of protecting

against infection, may actually promote viral pathogenesis.

Such a possibility was recognized after the finding that sera

from HIV-infected individuals can enhance HIV type 1

(HIV-1) infection in vitro (30, 59). Two of the factors involved

in serum-mediated enhancement of HIV-1 infectivity were

shown to be anti-HIV-1 antibodies and complement (25, 58,

70). In some studies, a correlation between in vitro

enhance-ment of HIV infection by sera from HIV-1-infected individuals

and progression to disease has been described (19, 24).

In clinical trials, most of the vaccines for human AIDS

un-dergoing evaluation have been based on the viral envelope,

which is the principal target for neutralizing antibodies (39, 41,

53). However, among concerns raised about the efficacy of

HIV recombinant envelope protein gp120 (rgp120) in

preven-tion of infecpreven-tion (9, 36), the possibility that such a vaccine

might enhance infection has been evoked (35, 66). Although

evidence for a deleterious role of the antienvelope immune

response in vivo is lacking, human monoclonal antibodies

di-rected to epitopes contained within the HIV-1 gp120 and to a

conserved region of the HIV-1 transmembrane glycoprotein,

the principal immunodominant domain (PID), were shown

to enhance HIV infection of different cell types (15, 56, 57,

62, 69). Furthermore, vaccination with envelope preparations

from different animal lentiviruses, including the feline

immu-nodeficiency virus (FIV) and equine infectious anemia virus,

has resulted in acceleration or clinical aggravation of infection

(28, 64, 74). In infection of goats by caprine

arthritis-enceph-alitis virus (CAEV), an association between progressive

arthri-tis and the humoral response to the CAEV envelope

glycopro-teins or to peptides corresponding to immunogenic domains of

the CAEV transmembrane glycoprotein, including the PID,

has been observed (7, 29, 37).

Whereas the viral envelope is naturally expressed in an

oli-gomeric form, in most vaccination trials the envelope (Env)

glycoproteins have been introduced as monomers. Broadly

neutralizing antibodies, however, appear to be principally

di-rected against conformational epitopes of HIV envelope

gly-coproteins (23, 67). Most of such epitopes are dependent on

the oligomeric structure of the viral envelope and are not

present on monomeric envelope glycoproteins (8, 38, 61, 68).

The development of DNA vaccination, whereby the

immuno-gen is expressed endoimmuno-genously and therefore retains

higher-order structure, permits the presentation of envelope to the

immune system in a natural oligomeric form. Such

presenta-tion could improve the response to conformapresenta-tional epitopes

and potentially improve the degree of protection achieved (49,

77). Humoral and cellular responses against Env glycoproteins

have been obtained after inoculation of mice and monkeys

with vectors expressing HIV and simian immunodeficiency

vi-rus envelope glycoproteins, respectively (18, 32, 43, 72, 73).

Nevertheless, antibody responses were often weak and

tran-sient, and protection from infection was not achieved in

ma-caques vaccinated with SIV env DNA (31).

In this study, we undertook an evaluation of the effect of

vaccination with the FIV env gene on the development of

infection in cats after challenge. Three groups of seven cats

were vaccinated with wild-type env or two env genes containing

mutations in the sequence coding for the PID, in an attempt to

modify the humoral response to this domain, which has been

postulated to be involved in the induction of enhancing

anti-* Corresponding author. Mailing address: Ge´ne´tique des Virus et

Immunopharmacologie Mole´culaire (ICGM-CNRS UPR0415),

Insti-tut Cochin de Ge´ne´tique Mole´culaire, 22 rue Me´chain, 75014 Paris,

France. Phone: (331) 40.51.64.31. Fax: (331) 40.51.72.10. E-mail:

pancino@cochin.inserm.fr.

9640

on November 9, 2019 by guest

http://jvi.asm.org/

(2)

bodies (48). Upon viral challenge, the kinetics of infection was

assessed by measurement of plasma viral load by quantitative

competitive reverse transcription-PCR (QC-PCR). According

to these analyses, the acute phase of viral infection occurred

earlier in cats immunized with the envelope glycoproteins than

in control cats, suggesting that immunization with the env gene

accelerated viral dissemination.

MATERIALS AND METHODS

FIV Env expression vectors.For the expression of wild-type and mutated env genes, gag, pol, and vif genes were deleted from the FIV 34TF10 provirus (45). The vector thus obtained expresses functional envelope glycoproteins upon transfection of feline fibroblasts (CrFK cells) (45). A truncated matrix protein (MA) (first 99 amino acids) is also expressed at low levels (not shown). Three plasmids were used as vaccines; pTD20ds contains the env gene from the 34TF10 molecular clone (71), while pn14 and pn92 contain env genes derived from 34TF10 and bearing mutations in the sequence coding for the four amino-terminal amino acids of the PID loop (48). These mutations modified the anti-genic properties of this domain, strongly reducing its reactivity with sera from FIV-infected cats (48). Wild-type and mutated sequences of PID were as follows: CNQNQFFC (34TF10), CEHQHFFC (n14), and CRPAAFFC (n92). Plasmids pn14 and pn92 were grown in Escherichia coli DH5a, and plasmid pTD20ds was grown in E. coli HB101. Plasmids were purified by using the Wizard Megaprep system (Promega), followed by two phenol-chloroform extractions and ethanol precipitation. In vitro expression of vaccine DNAs was tested by enzyme-linked immunosorbent assay (ELISA) or by syncytium-forming assay after transfection of CrFK cells as previously described (45). Plasmid pUC18 (Gibco BRL) was used as a control.

DNA immunization and virus challenge.Twenty-eight 3-month-old specific-pathogen-free cats (IFFA-CREDO, St. Germain sur l’Arbrefle, France) were randomly assigned to three vaccine groups and one control group. Animals received two intramuscular injections of 200mg of DNA in sodium phosphate-buffered saline in each gastrocnemius muscle. Three inoculations at 2-week intervals were administered. To reduce the variability of DNA uptake and gene expression, 300ml of 25% sucrose in phosphate-buffered saline were injected in the muscle 15 min before DNA injections (10, 43). Challenge was performed 2 weeks after the third DNA inoculation by intraperitoneal injection of 10 50% cat infectious doses of an FIV Petaluma stock (gift of M. Hosie, University of Glasgow).

Assays for anti-Env and anti-p24 antibodies.Humoral responses induced in cats by DNA injection and viral challenge were monitored by ELISA. The anti-Env response was assessed against continuous epitopes comprised in pep-tides corresponding to the immunogenic SU2 and TM2 domains of the surface (SU) and transmembrane (TM) glycoproteins of the FIV envelope (46). The peptide sequences were RAISSWKQRNRWEWRPD (SU2) and QELGCNQN QNFFCKV (TM2), the latter cyclized by creation of a disulfide bond between the two cysteines to enhance the sensitivity of the test; shorter peptides corre-sponded to the wild-type and mutated sequences of the cysteine loop of the PID (48). The anti-Env response to the entire SU glycoprotein was evaluated on purified rgp100 expressed in E. coli and derived from the FIV Bangston isolate (34), since rgp100 from the Petaluma strain was unavailable. The anti-Gag response was assessed by using Gag-p24 and Gag-p17 expressed as glutathione

S-transferase fusion proteins (54) (gift of O. Jarrett, University of Glasgow).

Each well of microplates (Immunolon II; Dynatech) was coated with 0.5mg of antigen for peptides, rgp100, and p17 and with 0.1mg for p24. ELISAs were performed as previously described (2), with minor modifications. Assays were performed in duplicate, and results were expressed as means. In each microplate, wells coated with the TM2 peptide and treated with a reference pool of FIV-positive cat sera diluted to 1/4,000 were included. Normalization of the results to the reference serum allowed direct comparison of ELISA results obtained at different times and on separate plates. Moreover, values of optical density (OD) obtained with FIV antigens were corrected by subtraction of the background level observed in assays using an irrelevant peptide. Sera collected on the day of challenge were also tested for the ability to immunoprecipitate envelope glyco-proteins from the FL-4 cell line, chronically infected with the Petaluma strain of FIV (78), after metabolic labeling as previously described (45). Finally, binding of selected sera to the oligomeric form of the FIV envelope was assessed by flow cytometry using the FL-4 cell line, according to an established procedure (55).

Viral infectivity assay.To determine whether sera from vaccinated cats could modify infection, serial dilutions (1/5, 1/25, and 1/125) of a stock of the Petaluma isolate and a single dilution of sera (1/5) were prepared in RPMI 1640 containing 10% heat-inactivated fetal calf serum, 100 IU of penicillin and 100mg of strep-tomycin per ml, 50mM 2-mercaptoethanol (2-ME), and 10 mM HEPES. Feline serum was combined with an equal volume of neat and serially diluted virus and incubated in a final volume of 100ml for 1 h at 37°C in quadruplicate in eight-strip cluster tubes (Costar). Following activation for 3 days in the presence of 5mg of concanavalin A per ml, feline peripheral blood mononuclear cells (PBMC) were adjusted to 43106/ml in complete RPMI with 2-ME, HEPES, and 200 U of recombinant human interleukin 2 (IL-2) per ml, and 0.1 ml of the

suspension (43105cells) was added to the tubes. Infection was allowed to proceed overnight. Virus inoculum was removed by washing cells twice with 0.5 ml of complete RPMI. Cells were then resuspended in 0.2 ml of feline serum diluted in complete RPMI with 2-ME, HEPES, and 100 U of IL-2 per ml and transferrred to wells of 96-well microtiter plates. Half the medium was replaced 4 days after infection. Aliquots of 10ml were removed 7 days after infection for analysis of reverse transcriptase activity (20).

Virus isolation.Virus isolation was performed by whole-blood culture (21) or, in some cases, by PBMC culture as already described (40).

Quantification of viral burden.Plasma viral load was measured by QC-PCR. Amplification of wild-type template yielded an initial product of 312 bp and a nested product of 165 bp, corresponding to nucleotides 1059 to 1370 and 1157 to 1321 of the 34TF10 molecular clone (71).

Molecular constructions. A conserved region of the gag gene of FIV was selected as the target sequence for reverse transcription and nested PCR ampli-fication. The 312-bp target sequence was amplified from a plasmid (pKSgag) containing the entire gag gene of the Wo strain of FIV (47), using a 59primer comprising the 59sequence of the target template and a KpnI restriction endo-nuclease site and a 39primer comprising the 39sequence of the target template and an XbaI site. The amplification product was subcloned into the correspond-ing sites of pBluescript KS1, yielding pBSQCgag.

To prepare a template for the synthesis of competitor RNA, a deletion of 31 nucleotides was introduced into the gag sequence by PCR. The 39portion of the wild-type sequence was amplified by using a 59primer, SHDWoG128, comple-mentary to the natural HindIII site (nucleotides 1241 to 1246) and bearing a 31-nucleotide discontinuity, and a 39primer, RXWoG139, comprising the 39

sequence of the target template and an XbaI site. Competitor templates have been prepared in similar fashion by Pistello et al. (52) and Diehl et al. (12). The sequences of primers were as follows: SHDWoG128, GGATGAAAGCTTAAA G/CCCCTGATGGTCCTAGAC (1235 to 1250/1282 to 1299) and RXWoG139, GCTCTAGATCTTGCTTCTGCTTGTTGTTCTTGAG (1345 to 1370). The amplification product was purified, digested with HindIII and XbaI, and substi-tuted for the corresponding fragment of pBSQCgag, yielding pBSQCDgag.

Synthesis of competitor RNA.Competitor RNA was synthesized by using T3 RNA polymerase (Promega) as the runoff transcription product of pBSQCDgag

linearized with XbaI. DNA template was hydrolyzed with RQ1 RNase-free DNase (Promega). Competitor RNA was purified by absorption to silica (RNeasy; Qiagen) and quantified by measurement of absorbance at 260 nm. RNA was aliquoted and stored at280°C.

Preparation of plasma RNA.Plasma was filtered (0.45-mm-pore-size filter), and cell-free RNA was extracted from 140ml of filtered plasma in duplicate by using a viral RNA kit (Qiagen) and eluted in 50ml of water according to the manufacturer’s instructions. Aliquots of RNA were stored at280°C.

Competitive reverse transcription-PCR (RT-PCR).For synthesis of comple-mentary DNA, 2.5ml of viral RNA was combined with 2.5 ml of different numbers of copies of RNA competitor. RNA was denatured at 65°C for 5 min and immediately placed on ice. Reagents for reverse transcription (15ml) were added as a master mix. Final reaction mixtures contained 0.3 U of random hexanucleotides (Pharmacia) ml21, 0.5 mM deoxynucleoside triphosphate (dNTP), 10 mM dithiothreitol, 13commercial buffer, and 100 U of Superscript II (both Gibco BRL) in a volume of 20ml. Reaction mixtures were held at 25°C for 10 min to promote primer annealing and then incubated at 42°C for 50 min. Reverse transcriptase was inactivated by incubation at 95°C for 5 min.

Highly conserved sequences were selected for primer sites. External primers were SWoG107 (59-CAATATGTAGCACTTGACCCAAAAAT-39[1059 to 1084]) and RWoG139 (59-TCTTGCTTCTGCTTGTTGTTCTTGAG-39[1345 to 1370]). Nested primers were SWoG116 (59-CTCTGCAAATTTAACACCTAC GACA-39[1157 to 1182]) and RWoG133 (59-GCTGCAGTAAAATAGGGTA ATGGTCT-39[1296 to 1321]). Complementary DNA was amplified by nested PCR using external primers SWoG107 and RWoG139 and internal primers SWoG116 and RWoG133. For the first amplification, PCR reagents (80ml) were added as a mix to 20ml of complementary DNA. Complete reactions contained 200mM dNTP, 1.5 mM MgCl2, 0.1mM each external primer, 0.83commercial buffer, and 0.25 U of Taq polymerase (both from Gibco BRL). DNA was denatured at 94°C for 3 min, subjected to 28 cycles (94°C for 30 s, 55°C for 30 s, and 72°C for 30 s), and elongated at 72°C for 7 min.

For the nested amplification, 2ml of the product of the first amplification was transferred to 98ml of reaction mix containing 200mM dNTP, 1.5 mM MgCl2, 0.5mM each nested primer, 13commercial buffer, and 0.25 U of Taq polymerase (both from Gibco BRL). DNA was denatured at 94°C for 3 min, subjected to 28 cycles (94°C for 30 s, 52°C for 30 s, and 72°C for 30 s), and elongated at 72°C for 7 min.

Analysis.Amplification products (10ml) were subjected to electrophoresis on 2.75% agarose gels. Digitized images of gels stained with ethidium bromide were acquired by using an Imager (Appligene) (Fig. 1), and densitometric analyses were performed with the software program NIH Image. Density of the compet-itor product was adjusted for the difference in length between the wild-type and competitor sequences. The logarithm of the ratio of competitor to wild-type density was plotted against the logarithm of the number of copies of competitor RNA added to each reaction. The best-fit line was determined by the method of least squares, and the number of copies of wild-type RNA was determined as the intersection of the x axis (51). The assay permits the detection of 10 copies of

on November 9, 2019 by guest

http://jvi.asm.org/

(3)

RNA in one reaction, which sets the lower limit of detection as 1,430 RNA copies per ml of plasma when viral RNA is extracted from 140ml of plasma.

RESULTS

Prechallenge antibody response.

Four groups of seven cats

were inoculated with pT

D

20ds, pn14, pn92, or pUC DNA.

[image:3.612.96.246.70.182.2]

Following vaccination, a vigorous antibody response to Env

was not achieved. When absorbance values higher than twice

those obtained with preimmune serum and with an irrelevant

antigen were considered to be positive, three cats (Liesse,

Ligne, and Limoges) injected with plasmid pn14 and four cats

(Loggia, Lola, Longe, and Lotte) injected with plasmid pn92

mounted a weak response to the rgp100 (Fig. 2). No reactivity

with the SU2 and TM2 peptides, which correspond to highly

immunogenic domains, was found in vaccinated cat sera. Sera

from cats vaccinated with the mutated envelopes were also

tested for reactivity with two nonapeptides representing the

respective mutated PID sequences in comparison with a

non-apeptide corresponding to the wild-type sequence. Reactivity

with the mutant PID peptide was detected in some cats; in

particular, one cat that received the pn14 envelope (Libertine)

and one cat that received the pn92 envelope (Lithurgie)

de-veloped strong responses against the peptides representing the

respective mutated PID sequence, while no reactivity was

found with the wild-type peptide (data not shown). Sera

col-lected at the day of challenge, diluted 1/50, were unable to

immunoprecipitate Env from the FL-4 cell line (data not

shown) and did not bind detectably to oligomeric Env at the

surface of FL-4 cells, as assessed by flow cytometry (data not

shown). The activity of sera collected at the day of challenge

FIG. 1. Quantification of plasma viremia by QC-PCR. Viral RNA extracted

from plasma was reverse transcribed and amplified by PCR in the presence of serial dilutions of competitor RNA as described in Materials and Methods. Copy numbers of competitor RNA (from left to right) were 105, 33104, 104, 33103, and 103. A 100-bp ladder (Gibco BRL) is shown on the right.

FIG. 2. Pre- and postchallenge antibody responses to rgp100. Sera were tested weekly after challenge over 9 weeks for groups A, B, and D and over 8 weeks for group C. ELISAs were performed with 1/100 dilutions of cat sera. OD values were normalized as described in Materials and Methods. OD values higher than twice the mean values obtained with preimmune serum and with irrelevant antigen were considered indicative of an Env-specific response. The times of DNA inoculation are indicated by vertical arrows. The day of viral challenge is indicated by a large arrow. WT, wild type.

on November 9, 2019 by guest

http://jvi.asm.org/

[image:3.612.56.543.338.692.2]
(4)

from cats vaccinated with the wild-type envelope was also

tested in a viral infectivity assay performed in primary blasts;

neither neutralizing nor enhancing activity was observed (data

not shown).

Viral burden.

After challenge, all cats became infected, as

determined by measurement of plasma viremia and virus

iso-lation. However, the kinetics of infection were strikingly

dif-ferent in Env-vaccinated cats in comparison with control cats

(Fig. 3). Longitudinal plasma virus titers were monitored at 2,

3, and 4 weeks after challenge (Fig. 3). While at 2 weeks viral

RNA was not detected in control cats, a positive signal was

found in 9 of 21 Env-vaccinated cats. In two cats of the pn14

group and one cat of the pn92 group, viral loads were greater

than 10

4

RNA copies per ml of plasma. Three weeks after

challenge, a high titer of viral RNA (1.27

3

10

6

) was found in

the plasma of only one cat in the control group, and the

threshold of detection was reached in two other cats of this

group. Conversely, at the same time point, in most (17 of 21)

plasma samples from the Env-vaccinated cats, viral RNA levels

were higher than 10

4

copies of RNA per ml; in several cases,

viral RNA levels higher than

.

10

6

copies of RNA per ml were

attained. Viral loads of Env- and pUC-vaccinated cat groups

were compared at 3 weeks on the basis of areas under the

curve (11), using the nonparametric Mann-Whitney test, and

found to be significantly different (P

5

0.02). Statistically

sig-nificant differences were not found between viral loads of

groups immunized with wild-type and mutant Envs. The level

of viral RNA remained below the threshold of detection at 4

weeks in one cat of the control group (Lueur) and in two cats

of the p92 group (Lotte and Loupe), although virus was

iso-lated by whole blood culture at 3 and 4 weeks from each of

these three cats (data not shown).

Postchallenge antibody response.

Cats were monitored for 9

weeks (8 weeks for the pn92 group) for antibody response

against Env and Gag antigens. Antibody responses to Env

antigens are presented in Fig. 2, 4, and 5. Figure 2 shows the

reactivity against rgp100 during immunization and after viral

challenge; Fig. 4 and 5 show the kinetics of the antibody

re-sponse to SU2 and TM2 peptides, respectively, after viral

chal-lenge. In general, the appearance of the anti-Env antibodies

paralleled the development of plasma viremia. Antibodies to

the SU2 and TM2 peptides appeared between weeks 3 and 7

after viral challenge in the Env-vaccinated animals and

be-tween weeks 5 and 7 in the control group.

[image:4.612.53.548.70.430.2]

Despite the high degree of similarity among the three Envs

used as immunogens, substantial differences were observed

among the vaccinated groups in the development of the

hu-moral response to Env after challenge. Unlike cats immunized

FIG. 3. Longitudinal analysis of plasma viremia after challenge. Plasma viral load was determined at 2, 3, and 4 weeks following infection. Virus titers were determined by QC-PCR. FIV RNA copy numbers were calculated as described in Materials and Methods. Dotted lines indicate the threshold of detection (1,430 FIV RNA copies). WT, wild type.

on November 9, 2019 by guest

http://jvi.asm.org/

(5)

with mutated envelopes, the majority (four of seven) of cats

vaccinated with the wild-type envelope did not develop a

de-tectable response to the SU2 peptide, in spite of a vigorous

anti-TM2 response. It is unclear whether vaccination may have

selectively suppressed the humoral response directed against

SU epitopes in these cats. Anti-Env antibody responses

devel-oped after challenge by the mutant n14 and n92 envelopes

were also divergent. Whereas anti-TM2 responses were similar

in the two groups, the response to the SU glycoprotein was

more vigorous in pn14-vaccinated animals than in

pn92-vacci-nated cats. Modification of the PID may alter the folding and

assembly of envelope glycoproteins (44). Thus, the

presenta-tion of the three different Envs to the immune system during

vaccination may have primed cats for disparate antiviral

re-sponses subsequent to challenge. While the anti-TM2

antibod-ies continued to increase over time after challenge in all cats,

in several cases the anti-SU2 antibodies decreased, after a peak

of activity, in the last week(s) of monitoring (Fig. 4). This

phenomenon may reflect the decline of the acute-phase virus

load and perhaps modification in antibody specificity due to

the variability of SU and, in particular, of the third variable

region of the FIV envelope, V3, containing the SU2 epitope.

The antibody response to Gag proteins was evaluated by

ELISA using p17 and p24 as antigens. Antibodies against p17

were the first to appear. In most vaccinated cats, anti-p17

reactivity was detected earlier than in the control cats, and in

some vaccinated animals, reactivity was detected before

chal-lenge (Fig. 6). This is likely due to a response raised against the

truncated form of p17 expressed by the DNA vectors (see

Materials and Methods). Viral challenge might then have

boosted antibody responses. The anti-p24 response was

de-tected later, and some cats did not seroconvert during the

study period (Fig. 7). In accordance with levels of plasma

viremia, anti-p24 reactivity appeared earlier and was stronger

in most Env-vaccinated cats than in control cats.

DISCUSSION

[image:5.612.56.546.68.426.2]

In this study, infection was sharply accelerated subsequent to

genetic immunization of cats with the Env glycoproteins. Such

immunization, however, did not induce substantial anti-Env

responses. While a weak response to the gp100 developed in

several vaccinated cats, the only antibody response raised to a

linear peptide from FIV Env before challenge was found in

cats that received Envs with mutated PIDs and was directed

against peptides containing the modified sequences. This

find-ing suggests that the immunodominance of the PID may result

from its position in the Env structure rather than from the

amino acid sequence. However, the failure to elicit a response

against the wild-type envelope precluded comparison with

Envs bearing mutations in the PID and assessment of the

FIG. 4. Kinetics of postchallenge antibody response against the SU2 peptide. Sera were tested weekly over 9 weeks for groups A, B, and D and over 8 weeks for group C. ELISAs were performed with 1/25 dilutions of cat sera. OD values were normalized as described in Materials and Methods. WT, wild type.

on November 9, 2019 by guest

http://jvi.asm.org/

(6)

putative role of anti-PID antibodies in enhancement of viral

pathogenesis.

Using a vaccination protocol similar to that employed in this

study, Okuda et al. elicited a humoral response to the HIV-1

Env in vaccinated monkeys (43). Differences between the latter

study and ours reside in the expression vector, the origin of the

lentivirus envelope, and the animal species. The type and the

efficiency of the immune response to DNA vaccination may

depend on the promoter directing gene expression, the protein

expressed, and the genetic background of the animals (50). A

defective FIV provirus was also used, in another study, to

vaccinate cats against FIV proteins (17). No antibody response

was obtained. Several studies suggested that in contrast with

other DNA-expressed antigens, lentivirus Env glycoproteins

are inefficient at raising antibodies. Multiple inoculations are

required to elicit low titers of Env-specific antibodies, and the

antibody response is transient (31, 32, 72, 73).

The acceleration of acute infection observed after challenge

in the cats vaccinated with Env, in comparison with those that

received pUC, was striking. Viremia appeared earlier in most

cats of the Env-vaccinated groups, and the viremic peak was

established more quickly. The mechanisms involved in this

enhancement of early viral dissemination are unclear. An

ac-celeration of infection in cats vaccinated with the FIV Env

expressed by recombinant vaccinia virus has also been

de-scribed (64). Enhanced infection after viral challenge was

es-tablished in naive cats by passive transfer of plasma from

vaccinated cats, and the authors therefore proposed that the

enhancement was mediated by anti-Env antibodies (64). In our

study, it is unlikely that enhanced infection was related to

antibodies, since the anti-Env humoral response elicited by

DNA vaccination was weak or undetectable. Nevertheless, the

influence of antibodies cannot be completely excluded, since

antibody-dependent enhancement has been observed to occur

at high antibody dilutions (60, 70). Moreover, it has been

suggested that low-affinity antibodies, which may be

undetect-able in our immunological assays, could be involved in

en-hancement of viral infection (33). We found, however, no

evidence for the presence of antibodies or other soluble factors

capable of augmenting viral infection in vitro: whereas sera

from individuals infected with HIV-1 frequently increase

in-fection of primary human blasts (30), prechallenge sera from

immunized cats did not modify infection of mitogen-activated

feline PBMC (data not shown).

[image:6.612.56.544.70.419.2]

Other immune phenomena, such as cellular activation, may

have caused the acceleration of infection. FIV replicates more

efficiently in activated cells in vitro and in vivo (40a), as has

been shown for HIV-1 (42, 65, 79, 80), and can infect B and T

lymphocytes (16). Specific priming of cells of T and B lineages

by Env vaccination, while insufficient (or inappropriate) for the

induction of detectable levels of antibodies, may have been

sufficient to render cells more susceptible to viral infection.

FIG. 5. Kinetics of postchallenge antibody response against the TM2 peptide. Sera were tested weekly over 9 weeks for groups A, B, and D and over 8 weeks for group C. See the legend to Fig. 4 for ELISA conditions and interpretation. WT, wild type.

on November 9, 2019 by guest

http://jvi.asm.org/

(7)

This eventuality has been considered in the case of HIV

infec-tion. Schwartz developed a mathematical model to describe

the effect of T-cell activation on HIV infection which predicts

that the expansion of HIV-specific CD4

1

lymphocytes due to

immunization would enhance HIV replication in the earliest

phase of infection (63). Broader activation of the immune

system could arise from nonclonal mechanisms. The HIV-1

Env has been described to possess qualities of both human

T-cell and B-cell superantigens (1, 6, 27, 76). It may be

spec-ulated that the activation of lymphoid cells induced by the FIV

Env mediates expansion of particular compartments of the

immune system, increasing the target cell population and

hence the rate of viral replication in the first phase of infection

(13). Finally, nonspecific activation of the immune system

in-duced by immunization with a foreign protein cannot be

for-mally excluded, although the extent of generalized activation

following DNA vaccination, for which conventional adjuvants

are not used, might not be expected to be high. In the present

study, the cellular response to vaccination was not studied.

Work is in progress to analyze in detail the immune response

elicited in the cat by vaccination with different Env expression

vectors.

It has been shown that immunization with oligomeric Env

glycoproteins elicits a humoral response which differs from

that induced by monomeric Env and that, in particular,

con-formational epitopes presented on Env oligomers may not be

conserved in monomers (14). Therefore, immunization with

oligomeric forms of Env might be predicted to improve

reac-tion with native envelope glycoproteins and the inducreac-tion of

protective immunity. In the present study, however, genetic

immunization with the gene env, which should hypothetically

provide highly authentic expression of Env, resulted in an

accelerated acute-phase infection. This observation suggests

that, at least when an optimal immunization is not achieved,

Env DNA vaccination can be deleterious. The expression of

Env glycoproteins in a microenvironment where an

inflamma-tory reaction is developing, as may occur after the injection of

sucrose and the deleted FIV provirus, may resemble viral

ex-pression in the first phases of natural infection. After infection

with a limited infectious dose of FIV, a period of localized viral

replication ensues, followed by seeding in lymphoid tissues (3,

4). If the antiviral response develops similarly following genetic

immunization and infection, it is conceivable that the virus may

take advantage of immune responses similar to those which

caused the enhancement in our experiment to increase the

efficacy of dissemination following natural exposure.

The long-term effect of an augmentation in viral load during

the primary infection of cats by FIV is unknown. Recently, a

correlation between the inability to control the plasma viral

load in the first phase of infection and the evolution of disease

in SIV infection of rhesus monkeys has been described (22).

Nevertheless, a correlation between survival and plasma

vire-mia in the primary peak was not found (75). Due to the

ex-tended length of the asymptomatic period and the late

appear-ance of the terminal stages in experimental FIV infection (5),

study of the relationship between viral load and clinical

out-FIG. 6. Antibody response against p17. ELISA was performed with 1/100 dilutions of cat sera. The times of DNA inoculation are indicated by vertical arrows. The day of viral challenge is indicated by a large arrow. WT, wild type.

on November 9, 2019 by guest

http://jvi.asm.org/

[image:7.612.52.552.67.405.2]
(8)

come is prohibitively long. Nevertheless, it will be necessary to

explore the possibility that the acceleration of FIV infection by

Env vaccination could worsen prognosis. Such information

would be useful in appreciating the risk that such a

phenom-enon represents in human vaccination.

Conflicting results have been obtained in the feline model

after immunization with Env. In a recent study, Hosie et al.

(26) reported that vaccination with purified FIV Env

glycopro-teins from the Petaluma isolate reduced the viral load after

challenge with the homologous virus, although less efficiently

than vaccination with inactivated whole virus. The observations

of enhancement of FIV infection after vaccination by Siebelink

et al. (64) and ourselves and suppression of infection in the

study by Hosie et al. (26) suggest the existence of counteracting

immune responses induced by vaccination with Env. These

responses could not be limited to the induction of enhancing

versus neutralizing antibodies. As a prerequisite to the

devel-opment of vaccines against lentiviruses, we must learn which

interactions between virus and host immunity determine the

balance between enhancement and protection and how this

balance may be displaced in favor of protection.

ACKNOWLEDGMENTS

We thank T. Vahlenkamp for valuable advice on developing a

com-petitive RT-PCR. We express our appreciation to T. Leste-Lasserre,

K. Goude, and the staff of the cattery of the Ecole Nationale

Ve´te´ri-naire for technical assistance.

This work was supported by the Ministe`re de la Recherche et de la

Technologie (Saut Technologique 95T0007), by the Agence Nationale

de Recherche sur le SIDA and the Ensemble Contre le

SIDA/Sidac-tion, and by Biomed 2 grant from the European Economic

Commu-nity.

REFERENCES

1. Akolkar, P. N., B. Gulwani-Akolkar, N. Chirmule, S. Pahwa, V. S.

Kal-yanaraman, R. Pergolizzi, S. Macphail, and J. Silver.1995. The HIV glyco-protein gp160 has superantigen-like properties. Clin. Immunol. Immuno-pathol. 76:255–265.

2. Avrame´as, A., A. D. Strosberg, A. Moraillon, P. Sonigo, and G. Pancino. 1993. Serological diagnosis of feline immunodeficiency virus (FIV) infection based on synthetic peptides from Env glycoproteins. Res. Virol. 144:209–218. 3. Bach, J.-M., M. Hurtrel, L. Chakrabarti, J.-P. Ganie`re, L. Montagnier, and

B. Hurtrel.1994. Early stages of feline immunodeficiency virus infection in lymph nodes and spleen. AIDS Res. Hum. Retroviruses 10:1731–1738. 4. Beebe, A. M., N. Dua, T. G. Faith, P. Moore, N. Pedersen, and S. Dandekar.

1994. Primary stage of feline immunodeficiency virus infection: viral dissem-ination and cellular targets. J. Virol. 68:3080–3091.

5. Bendinelli, M., M. Pistello, S. Lombardi, A. Poli, C. Garzelli, D. Matteucci,

L. Ceccherini-Nelli, G. Malvaldi, and F. Tozzini.1995. Feline immunodefi-ciency virus: an interesting model for AIDS studies and an important cat pathogen. Clin. Microbiol. Rev. 8:87–112.

6. Berberian, L., L. Goodlick, T. J. Kipps, and J. Braun. 1993. Immunoglobulin VH3 gene products: natural ligands for HIV gp120. Science 261:1588–1591. 7. Bertoni, G., M.-L. Zahno, R. Zanoni, H.-R. Vogt, E. Peterhans, G. Ruff, W. P.

Cheevers, P. Sonigo, and G. Pancino.1994. Antibody reactivity to the im-munodominant epitopes of the caprine arthritis-encephalitis virus gp38 transmembrane glycoprotein associates with the development of arthritis. J. Virol. 68:7139–7147.

8. Broder, C. C., P. L. Earl, D. Long, S. T. Abedon, B. Moss, and R. W. Doms. 1994. Antigenic implications of human immunodeficiency virus type 1 enve-lope quaternary structure: oligomer-specific and -sensitive monoclonal anti-bodies. Proc. Natl. Acad. Sci. USA 91:11699–11703.

9. Cohen, J. 1993. Jitters jeopardize AIDS vaccine trials. Science 262:980–981. 10. Davis, H. L., R. G. Whalen, and B. A. Demeneix. 1993. Direct gene transfer into skeletal muscle in vivo: factors affecting efficiency of transfer and sta-bility of expression. Hum. Gene Ther. 4:151–159.

11. Dawson, J. D. 1994. Comparing treatment groups on the basis of slopes, areas-under-the-curve, and other summary measures. Drug Inf. J. 28:723– 732.

12. Diehl, L. J., C. K. Mathiason-DuBard, L. O’Neil, and E. A. Hoover. 1995. Longitudinal assessment of feline immunodeficiency virus kinetics in plasma by use of a quantitative competitive reverse transcriptase PCR. J. Virol.

69:2328–2332.

13. Dobrescu, D., S. Kabak, K. Mehta, C. H. Suh, A. Asch, P. U. Cameron, A. S.

Hodtsev, and D. N. Posnett.1995. Human immunodeficiency virus 1 reser-voir in CD41T cells is restricted to certain Vbsubsets. Proc. Natl. Acad. Sci. USA 92:5563–5567.

14. Earl, P. L., C. C. Broder, D. Long, S. A. Lee, J. Peterson, S. Chakrabarti,

R. W. Doms, and B. Moss.1994. Native oligomeric human immunodeficiency virus type 1 envelope glycoprotein elicits diverse monoclonal antibody reac-tivities. J. Virol. 68:3015–3026.

15. Eaton, A. M., K. E. Ugen, D. B. Weiner, T. Wildes, and J. A. Levy. 1994. An anti-gp41 human monoclonal antibody that enhances HIV-1 infection in the absence of complement. AIDS Res. Hum. Retroviruses 10:13–18. 16. English, R. V., J. C. M., D. H. Gebhard, and M. B. Tomkins. 1993. In vivo

lymphocyte tropism of feline immunodeficiency virus. J. Virol. 67:5175–5186. 17. Flynn, J. N., M. J. Hosie, C. A. Cannon, M. A. Rigby, A. H. Mackay, D. A.

Argyle, T. Miyazawa, O. Jarret, D. E. Onions, and J. C. Neil.1997. FIV, SIV and SHIV vaccination, p. 60. Fondation Marcel Merieux, Annecy, France. 18. Fuller, D. H., M. Murphey-Corb, J. Clements, S. Barnett, and J. R. Haynes.

1996. Induction of immunodeficiency virus-specific immune responses in rhesus monkeys following gene gun-mediated DNA vaccination. J. Med. Primatol. 25:236–241.

19. Fust, G., F. D. Toth, J. Kiss, E. Ujhelyi, I. Nagy, and D. Banhegi. 1994. Neutralizing and enhancing antibodies measured in complement-restored serum samples from HIV-1 infected individuals correlate with immunosup-pression and disease. AIDS 8:603–609.

20. Goff, S., P. Traktman, and D. Baltimore. 1981. Isolation and properties of Moloney murine leukemia virus mutants: use of a rapid assay for release of virion reverse transcriptase. J. Virol. 38:239–248.

21. Guiot, A. L., D. Rigal, D. Pialot, and G. Chappuis. 1995. Development of a simple, rapid and accurate in vitro whole blood technique for the detection and semi-quantification of FIV cellular viremia. Vet. Microbiol. 47:331–342. 22. Hirsch, V. M., T. R. Fuerst, G. Sutter, M. W. Carrol, L. C. Yang, S.

Gold-stein, M. Piatak, Jr., V. R. Elkins, W. G. Alvord, D. C. Montefiori, B. Moss, and J. D. Lifson.1996. Patterns of viral replication correlate with outcome in simian immunodeficiency virus (SIV)-infected macaques: effect of prior im-munization with a trivalent SIV vaccine in modified vaccinia virus ankara. J. Virol. 70:3741–3752.

[image:8.612.85.255.69.368.2]

23. Ho, D. D., M. S. C. Fung, H. Yoshiyama, Y. Cao, and J. E. Robinson. 1992. FIG. 7. Antibody response against p24. ELISA was performed with 1/100

dilutions of cat sera. OD values greater than twice the mean values obtained with serum collected on the day of challenge were considered indicative of anti-p24 seroconversion. Open circles, no reactivity; black circles, anti-p24 reactivity. High background found in some serum samples from cats marked with asterisks did not permit a clear interpretation of the results. wt, wild type.

on November 9, 2019 by guest

http://jvi.asm.org/

(9)

Discontinuous epitopes on gp120 important in HIV-1 neutralization. AIDS Res. Hum. Retroviruses 8:1337–1339.

24. Homsy, J., M. Meyer, and J. A. Levy. 1990. Serum enhancement of human immunodeficiency virus (HIV) infection correlates with disease in HIV-infected individuals. J. Virol. 64:1437–1440.

25. Homsy, J., M. Meyer, M. Tateno, S. Clarkson, and J. A. Levy. 1989. The Fc and Not CD4 receptor mediates antibody enhancement of HIV infection in human cells. Science 244:1357–1360.

26. Hosie, M. J., T. H. Dunsford, A. De Ronde, B. J. Willett, C. A. Cannon, J. C.

Neil, and O. Jarrett.1996. Suppression of virus burden by immunization with feline immunodeficiency virus Env protein. Vaccine 14:405–411. 27. Imberti, L., A. Sottini, A. Bettinardi, M. Puoti, and D. Primi. 1991. Selective

depletion in HIV infection of T cells that bear specific T cell receptor Vb

sequences. Science 254:860–862.

28. Issel, C. J., D. W. Horohov, D. F. Lea, W. V. Adams, S. D. Hagius, J. M.

McManus, A. C. Allison, and R. C. Montelaro.1992. Efficacy of inactivated whole-virus and subunit vaccines in preventing infection and disease caused by equine infectious anemia virus. J. Virol. 66:3398–3408.

29. Knowles, D., W. Cheevers, T. McGuire, T. Stem, and J. Gorham. 1990. Severity of arthritis is predicted by antibody response to gp135 in chronic infection with caprine arthritis-encephalitis virus. J. Virol. 64:2396–2398. 30. Kostrikis, L. G., Y. Cao, H. Ngai, J. P. Moore, and D. D. Ho. 1996.

Quan-titative analysis of serum neutralization of human immunodeficiency virus type 1 from subtypes A, B, C, D, E, F, and I: lack of direct correlation between neutralization serotypes and genetic subtypes and evidence for prevalent serum-dependent infectivity enhancement. J. Virol. 70:445–458. 31. Lu, S., J. Arthos, D. C. Motefiori, Y. Yasutomi, K. Manson, F. Mustafa, E.

Johnson, J. C. Santoro, J. Wissink, J. I. Mullins, J. R. Haynes, N. L. Letvin, M. Wyand, and H. L. Robinson.1996. Simian immunodeficiency virus DNA vaccine trial in macaques. J. Virol. 70:3978–3991.

32. Lu, S., J. C. Santoro, D. H. Fuller, J. R. Haynes, and H. L. Robinson. 1995. Use of DNAs expressing HIV-1 Env and noninfectious HIV-1 particles to raise antibody responses in mice. Virology 209:147–154.

33. Lund, O., J. Hansen, E. Mosekilde, J. O. Nielsen, and J.-E. S. Hansen. 1993. A model of enhancement and inhibition of monocytes by antibodies against HIV. J. Biol. Phys. 19:133–145.

34. Lutz, H., R. Hoffmann-Lehmann, K. Bauer-Pham, E. Holznagel, F. Tozzini,

M. Bendinelli, G. Reubel, A. Aubert, D. Davis, D. Cox, and E. Young.1995. FIV vaccine. I. Immune response to recombinant FIV env gene products and outcome after challenge infection. Vet. Immunol. 46:115–125.

35. Mascola, J. R., B. J. Mathieson, P. M. Zack, M. C. Walker, S. B. Halstead,

and D. S. Burke.1993. Summary report: workshop on the potential risks of antibody-dependent enhancement in human HIV vaccine trials. AIDS Res. Hum. Retroviruses 9:1175–1184.

36. McElrath, M. J., L. Corey, G. P. D., T. J. Matthews, D. C. Montefiori, L.

Rowen, L. Hood, and J. I. Mullins.1996. Human immunodeficiency virus type 1 infection despite prior immunization with a recombinant envelope vaccine regimen. Proc. Natl. Acad. Sci. USA 93:3972–3977.

37. McGuire, T. C., D. P. Knowles, W. C. Davis, A. L. Brassfield, T. A. Stem, and

W. P. Cheevers.1992. Transmembrane protein oligomers of caprine arthri-tis-encephalitis lentivirus are immunodominant in goats with progressive arthritis. J. Virol. 66:3274–3250.

38. Moore, J. P., Y. Cao, L. Qing, Q. J. Sattentau, J. Pyati, R. Koduri, J.

Robinson, C. F. Barbas III, D. R. Burton, and D. D. Ho.1995. Primary isolates of human immunodeficiency virus type 1 are relatively resistant to neutralization by monoclonal antibodies to gp 120, and their neutralization is not predicted by studies with monomeric gp 120. J. Virol. 69:101–109. 39. Moore, J. P., and D. D. Ho. 1995. HIV neutralization: the consequence of

viral adaptation to growth on transformed T cells. AIDS. 9(Suppl. A):S117– S136.

40. Moraillon, A., F. Barre-Sinoussi, A. Parodi, R. Moraillon, and C. Dauguet. 1992. In vitro properties and experimental pathogenic effect of three feline immunodeficiency viruses (FIV) isolated from cats with terminal disease. Vet. Microbiol. 31:41–54.

40a.Moraillon, A., J. Richardson, and G. Pancino. Unpublished data. 41. Nara, P. L., R. R. Garrity, and J. Goudsmit. 1991. Neutralization of HIV-1:

a paradox of humoral proportions. FASEB J. 5:2437–2455.

42. O’Brien, W. A., K. Grovit-Ferbas, A. Namazi, S. Ovcak-Derzic, H.-J. Wang,

J. Park, C. Yeramian, S.-H. Mao, and J. A. Zack.1995. Human immunode-ficiency virus-type 1 replication can be increased in peripheral blood of seropositive patients after influenza vaccination. Blood 86:1082–1089. 43. Okuda, K., H. Bukawa, K. Hamajima, S. Kawamoto, K.-I. Sekigawa, Y.

Yamada, S.-I. Tanaka, N. Ishi, I. Aoki, M. Nakamura, H. Yamamoto, B. R. Cullen, and J. Fukushima.1995. Induction of potent humoral and cell-mediated immune responses following direct injection of DNA encoding the HIV type 1 env and rev gene products. AIDS Res. Hum. Retroviruses

11:933–942.

44. Pancino, G., L. Camoin, and P. Sonigo. 1995. Structural analysis of the principal immunodominant domain of the feline immunodeficiency virus transmembrane glycoprotein. J. Virol. 69:2110–2118.

45. Pancino, G., S. Castelot, and P. Sonigo. 1995. Differences in feline

immu-nodeficiency virus (FIV) host cell range correlate with envelope fusogenic properties. Virology 206:796–806.

46. Pancino, G., C. Chappey, W. Saurin, and P. Sonigo. 1993. B epitopes and selection pressures in feline immunodeficiency virus envelope glycoproteins. J. Virol. 67:664–672.

47. Pancino, G., I. Fossati, C. Chappey, S. Castelot, B. Hurtrel, A. Moraillon, D.

Klatzmann, and P. Sonigo.1993. Structure and variations of feline immu-nodeficiency virus envelope glycoproteins. Virology 192:659–662. 48. Pancino, G., and P. Sonigo. 1997. Retention of viral infectivity after extensive

mutation of the highly conserved immunodominant domain of the feline immunodeficiency virus envelope. J. Virol. 71:4339–4346.

49. Pardoll, D. M., and A. M. Beckerleg. 1995. Exposing the immunology of naked DNA vaccines. Immunity 3:165–169.

50. Pertmer, T. M., T. R. Roberts, and J. R. Haynes. 1996. Influenza virus nucleoprotein-specific immunoglobulin G subclass and cytokine responses elicited by DNA vaccination are dependent on the route of vector delivery. J. Virol. 70:6119–6125.

51. Piatak, M. J., K.-C. Luk, B. Williams, and J. D. Lifson. 1993. Quantitative competitive polymerase chain reaction for accurate quantitation of HIV DNA and RNA species. BioTechniques 14:70–80.

52. Pistello, M., S. Menzo, M. Giorgi, L. Da Prato, G. Cammarota, M. Clementi,

and M. Bendinelli.1994. Competitive polymerase chain reaction for quan-titating feline immunodeficiency virus load in infected cat tissues. Mol. Cell. Probes 8:229–234.

53. Poignard, P., P. J. Klasse, and Q. J. Sattentau. 1996. Neutralization of the human immunodeficiency virus type 1. Immunol. Today 17:239–246. 54. Reid, G., M. A. Rigby, M. McDonald, M. J. Hosie, J. C. Neil, and O. Jarrett.

1991. Immunodiagnosis of feline immunodeficiency virus infection using recombinant viral p17 and p24. AIDS 5:1477–1483.

55. Richardson, J., I. Fossati, A. Moraillon, S. Castelot, P. Sonigo, and G.

Pancino.1996. Neutralization sensitivity and accessibility of continuous B cell epitopes of the feline immunodeficiency virus envelope. J. Gen. Virol.

77:759–771.

56. Robinson, W. E., M. K. Gorny, J. I. Xy, W. M. Mitchell, and S. Zolla-Pazner. 1991. Two immunodominant domains of gp41 bind antibodies which en-hance human immunodeficiency virus type 1 infection in vitro. J. Virol.

65:4169–4176.

57. Robinson, W. E., T. Kawamura, D. Lake, Y. Masuho, W. M. Mitchell, and

E. M. Hersh.1990. Antibodies to the primary immunodominant domain of human immunodeficiency virus type 1 (HIV-1) glycoprotein 41 enhance HIV-1 infection in vitro. J. Virol. 64:5301–5305.

58. Robinson, W. E., D. C. Montefiori, and W. M. Mitchell. 1988. Antibody-dependent enhancement of human immunodeficiency virus type 1 infection. Lancet i:790–794.

59. Robinson, W. E., D. C. Montefiori, and W. M. Mitchell. 1987. A human immunodeficiency virus infection-enhancing factor in seropositive sera. Bio-chem. Biophys. Res. Commun. 149:693–699.

60. Robinson, W. E., D. C. Montefiori, W. M. Mitchell, A. M. Prince, H. J. Alter,

G. R. Dreesman, and J. W. Eichberg.1989. Antibody-dependent enhance-ment of human immunodeficiency virus type 1 (HIV-1) infection in vitro by serum from HIV-1-infected and passively immunized chimpanzees. Proc. Natl. Acad. Sci. USA 86:4710–4714.

61. Sattentau, Q. J., S. Zolla-Pazner, and P. Poignard. 1995. Epitope exposure on functional, oligomeric HIV-1 gp41 molecules. Virology 206:713–717. 62. Schutten, M., A. C. Andeweg, M. L. Bosch, and A. D. M. E. Osterhaus. 1995.

Enhancement of infectivity of a non-syncytium inducing HIV-1 by sCD4 and by human antibodies that neutralize syncytium inducing HIV-1. Scand. J. Im-munol. 41:18–22.

63. Schwartz, D. H. 1994. Potential pitfalls on the road to an effective HIV vaccine. Immunol. Today 15:54–57.

64. Siebelink, K. H. J., E. Tijhaar, R. C. Huisman, W. Huisman, A. de Ronde,

I. H. Darby, M. J. Francis, G. F. Rimmelzwaan, and A. D. M. E. Osterhaus.

1995. Enhancement of feline immunodeficiency virus infection after immu-nization with envelope glycoprotein subunit vaccines. J. Virol. 69:3704–3711. 65. Stanley, S. K., M. A. Ostrowski, J. S. Justement, K. Gantt, S. Hedayati, M.

Mannix, K. Roche, D. J. Schwartzentruber, C. H. Fox, and A. S. Fauci.1996. Effect of immunization with a common recall antigen on viral expression in patients infected with human immunodeficiency virus type 1. N. Engl. J. Med. 334:1222–1230.

66. Steele, F. R. 1995. gp120: Good, bad or indifferent. Nat. Med. 1:1105–1106. 67. Steimer, K. S., C. J. Scandella, P. V. Stiles, and N. L. Haigwood. 1991. Neutralization of divergent HIV-1 isolates by conformation-dependent hu-man antibodies to gp120. Science 254:105–108.

68. Sullivan, N., Y. Sun, J. Li, W. Hofman, and J. Sodroski. 1995. Replicative function and neutralization sensitivity of envelope glycoproteins from pri-mary and T-cell line-passaged human immunodeficiency virus type 1 isolates. J. Virol. 69:4413–4422.

69. Takeda, A., J. E. Robinson, D. D. Ho, C. Debouck, N. L. Haigwood, and F.

Ennis.1992. Distinction of human immunodeficiency virus type 1 neutral-ization and infection enhancement by human monoclonal antibodies to gly-coprotein 120. J. Clin. Invest. 89:1952–1957.

70. Takeda, A., C. U. Tuazon, and F. A. Ennis. 1988. Antibody-enhanced

on November 9, 2019 by guest

http://jvi.asm.org/

(10)

tion by HIV-1 via FC receptor-mediated entry. Science 242:580–583. 71. Talbott, R. L., E. E. Sparger, K. M. Lovelace, W. M. Fitch, N. C. Pedersen,

P. A. Luciw, and J. H. Elder. 1989. Nucleotide sequence and genomic organization of feline immunodeficiency virus. Proc. Natl. Acad. Sci. USA

86:5743–5747.

72. Wang, B., J. Boyer, V. Srikantan, K. Ugen, L. Gilbert, C. Phan, K. Dang, M.

Merva, M. G. Agadjanyan, M. Newman, R. Carrano, D. McCallus, L. Coney, W. V. Williams, and D. B. Weiner.1995. Induction of humoral and cellular immune responses to the human immunodeficiency type 1 virus in non human primates by in vivo DNA inoculation. Virology 211:102–112. 73. Wang, B., K. E. Ugen, V. Srikantan, M. Agadjanyan, K. Dang, Y. Refaeli, A.

Sato, J. Boyer, W. Williams, and W. D. B.1993. Gene inoculation generates immune responses against human immunodeficiency virus type 1. Proc. Natl. Acad. Sci. USA 90:4156–4160.

74. Wang, S. Z.-S., K. E. Rushlow, C. J. Issel, R. F. Cook, S. J. Cook, M. L.

Raabe, Y.-H. Chong, L. Costa, and R. C. Montelaro.1994. Enhancement of EIAV replication and disease by immunization with a baculovirus-expressed recombinant envelope surface glycoprotein. Virology 199:247–251. 75. Watson, A., J. Ranchalis, B. Travis, M. J., W. Sutton, P. R. Johnson, S.-L.

Hu, and N. L. Haigwood.1997. Plasma viremia in macaques infected with

simian immunodeficiency virus: plasma viral load early in infection predicts survival. J. Virol. 71:284–290.

76. Westby, M., F. Manca, and A. G. Dalgleish. 1996. The role of host immune responses in determining the outcome of HIV infection. Immunol. Today

17:120–125.

77. Wolff, J. O., R. W. Malone, P. Williams, W. Chong, G. Acsadi, A. Jani, and

P. L. Felgner.1990. Direct gene transfer into mouse muscle in vivo. Science

247:1465–1468.

78. Yamamoto, J. K., C. D. Ackley, H. Zochlinski, H. Louie, E. Pembroke, M.

Torten, H. Hansen, R. Munn, and T. Okuda.1991. Development of IL-2-independent feline lymphoid cell lines chronically infected with feline im-munodeficiency virus: Importance for diagnostic reagents and vaccines. In-tervirology 32:361–375.

79. Zack, J. A., S. J. Arrigo, S. R. Weitzman, A. S. Go, A. Haislip, and I. S. Y.

Chen.1990. HIV-1 entry into quiescent primary lymphocytes: molecular analysis reveals a labile, latent viral structure. Cell 61:213–222.

80. Zagury, D., J. Bernard, R. Leonard, R. Cheynier, M. Feldman, P. S. Sarin,

and R. C. Gallo.1986. Long-term cultures of HTLV-III-infected T cells: a model of cytopathology of T-cell depletion in AIDS. Science 231:850–853.

on November 9, 2019 by guest

http://jvi.asm.org/

Figure

FIG. 1. Quantification of plasma viremia by QC-PCR. Viral RNA extractedfrom plasma was reverse transcribed and amplified by PCR in the presence of
FIG. 3. Longitudinal analysis of plasma viremia after challenge. Plasma viral load was determined at 2, 3, and 4 weeks following infection
FIG. 4. Kinetics of postchallenge antibody response against the SU2 peptide. Sera were tested weekly over 9 weeks for groups A, B, and D and over 8 weeks forgroup C
FIG. 5. Kinetics of postchallenge antibody response against the TM2 peptide. Sera were tested weekly over 9 weeks for groups A, B, and D and over 8 weeks forgroup C
+3

References

Related documents

For that purpose, we studied the ability of IGRP2 cells to express a functional ORF6 gene product by specific immunodetection of the fiber protein, a prototypic viral protein

To study the role of CD44 in HIV-1 infection and tropism, we have used cells of the human T-lymphoblast line Jurkat, a CD4-positive, CD44-negative cell line which can be infected

In this study, we found that a particular strain of mouse hepatitis virus, JHM2c, which has a deletion of a 9-nucleotide (nt) sequence (UUUAUAAAC) immediately downstream of the

To demonstrate that the two UL28 mutants contain the deletion/insertion mutations at the appropriate position in the viral genome, we isolated total-cell DNA from Vero cells

The N-terminal region of the envelope (env) transmembrane protein of human immunodeficiency virus type 1 (HIV-1) has a leucine zipper-like motif.. This highly conserved zipper

Previously, we dem- onstrated that a SV40 late replacement vector (pBABY) could be used to express large amounts of properly proc- essed HIV-1 envelope proteins and tat in

The main social threats of digitalization for a nation are moral and spiritual degradation of society, reforming the economy without taking into account social priorities,

Застосування 30% настойки листеця ряски малої в дозі 1 мл/100 г маси тіла тварини чинило коригуючий вплив на гіпотиреоїдний стан ЩЗ, про що свідчило