Genetic Analyses of HIV-1 env Sequences Demonstrate Limited Compartmentalization in Breast Milk and Suggest Viral Replication within the Breast That Increases with Mastitis

(1)

J

OURNAL OF

V

IROLOGY

, Oct. 2010, p. 10812–10819

Vol. 84, No. 20

0022-538X/10/$12.00

doi:10.1128/JVI.00543-10

Genetic Analyses of HIV-1

env

Sequences Demonstrate Limited

Compartmentalization in Breast Milk and Suggest Viral

Replication within the Breast That Increases

with Mastitis

䌤

Soren Gantt,

1,5

* Jacquelyn Carlsson,

5

Laura Heath,

2

Marta E. Bull,

5

Avinash K. Shetty,

6

Junior Mutsvangwa,

7

Georgina Musingwini,

8

Godfrey Woelk,

8,9

Lynn S. Zijenah,

8,10

David A. Katzenstein,

11

James I. Mullins,

2,3,4

and Lisa M. Frenkel

1,3,5

Departments of Pediatrics,

1

Microbiology,

2

Laboratory Medicine,

3

and Medicine,

4

University of Washington, and

Seattle Children’s Hospital,

5

Seattle, Washington; Department of Pediatrics, Wake Forest University Health Sciences,

Winston-Salem, North Carolina

6

; Biomedical Research and Training Institute, Harare, Zimbabwe

7

;

Zimbabwe AIDS Prevention Project

8

and Departments of Community Medicine

9

and

Immunology,

10

University of Zimbabwe, Harare, Zimbabwe; and Department of

Internal Medicine, Stanford University, Palo Alto, California

11

Received 12 March 2010/Accepted 8 July 2010

The concentration of human immunodeficiency virus type 1 (HIV-1) is generally lower in breast milk than

in blood. Mastitis, or inflammation of the breast, is associated with increased levels of milk HIV-1 and risk of

mother-to-child transmission through breastfeeding. We hypothesized that mastitis facilitates the passage of

HIV-1 from blood into milk or stimulates virus production within the breast. HIV-1

env

sequences were

generated from single amplicons obtained from breast milk and blood samples in a cross-sectional study. Viral

compartmentalization was evaluated using several statistical methods, including the Slatkin and Maddison

(SM) test. Mastitis was defined as an elevated milk sodium (Na

ⴙ

) concentration. The association between milk

Na

ⴙ

and the pairwise genetic distance between milk and blood viral sequences was modeled using linear

regression. HIV-1 was compartmentalized within milk by SM testing in 6/17 (35%) specimens obtained from

9 women, but all phylogenetic clades included viral sequences from milk and blood samples. Monotypic

sequences were more prevalent in milk samples than in blood samples (22% versus 13%;

P

ⴝ

0.012), which

accounted for half of the compartmentalization observed. Mastitis was not associated with

compartmental-ization by SM testing (

P

ⴝ

0.621), but Na

ⴙ

was correlated with greater genetic distance between milk and blood

HIV-1 populations (

P

ⴝ

0.041). In conclusion, local production of HIV-1 within the breast is suggested by

compartmentalization of virus and a higher prevalence of monotypic viruses in milk specimens. However,

phylogenetic trees demonstrate extensive mixing of viruses between milk and blood specimens. HIV-1

repli-cation in breast milk appears to increase with inflammation, contributing to higher milk viral loads during

mastitis.

Breastfeeding accounts for 30 to 50% of

mother-to-child-transmission (MTCT) of human immunodeficiency virus type 1

(HIV-1) (38). MTCT through breastfeeding occurs primarily

in sub-Saharan Africa, where the use of artificial infant

for-mula is often not feasible because of cost and the associated

infant mortality from infections due to the use of unsafe water

and the lack of the protective effects of breast milk (19, 38, 51).

Numerous strategies to reduce postnatal HIV-1 infection of

infants while preserving the advantages of breastfeeding have

been evaluated, including maternal use of combination

anti-retroviral therapy or infant antianti-retroviral prophylaxis during

the period of breastfeeding (5, 25, 26, 30, 40). Understanding

the biologic events that increase the concentration of HIV-1 in

breast milk is critical to the development and evaluation of

interventions to reduce postnatal MTCT.

The risk of MTCT is strongly associated with the concentration

of HIV-1 in breast milk (28, 46, 47). Although breast milk HIV-1

RNA concentrations correlate with those in plasma, levels in milk

are typically 2 log

₁₀

lower (15, 24, 43). This suggests that HIV-1 in

blood and milk may not mix freely, likely because of the closure

of tight junctions between mammary alveolar cells that occurs

once milk production is established and before weaning (16).

Thus, HIV-1 may evolve in the breast without substantial mixing

with blood, i.e., evolving viral variants would become

compart-mentalized—a phenomenon that has been observed in the central

nervous system (50) and in some studies of the genital tract (10,

44, 57). Compartmentalization of HIV-1 variants has been

de-tected in the breast milk of a small number of women (3, 4), but

other data suggest that compartmentalization in breast milk may

be uncommon (22).

Breast inflammation (mastitis) occurs frequently during

lac-tation, most commonly without symptoms. Mastitis is

associ-ated with elevations in HIV-1 RNA levels in milk (15, 31, 47,

55), an increase in the number of inflammatory cells in milk,

and opening of tight junctions in the mammary epithelium that

* Corresponding author. Mailing address: Seattle Children’s

Hospi-tal Research Institute, 1900 Ninth Ave., Seattle, WA. 98101-1304.

Phone: (206) 987-1160. Fax: (206) 884-7311. E-mail: [email protected].

䌤

Published ahead of print on 21 July 2010.

10812

on November 8, 2019 by guest

http://jvi.asm.org/

(2)

allows passage of subcellular blood components, of which

so-dium (Na

⫹

) serves as a marker (15, 16, 36, 47, 55). Greater

permeability of mammary epithelia may allow the passage of

free virus from the blood into breast milk, which would result

in the mixing of HIV-1 subpopulations from blood and milk.

Alternatively, inflammation in the breast may induce

replica-tion of virus by HIV-1-infected cells within the breast, which

would result in divergence between milk and blood HIV-1

subpopulations. Here we describe detailed genetic analyses of

HIV-1 subpopulations in the blood and breast milk to

deter-mine whether mastitis affects the structure of these

popula-tions and to gain understanding of the processes that may lead

to increased concentrations of HIV-1 in milk.

MATERIALS AND METHODS

Study design.Specimens were selected from participants in a previously de-scribed (15) cross-sectional study of Zimbabwean women who were between 6 and 16 weeks postpartum, HIV-1 infected, and breastfeeding. All participants provided written informed consent, and all procedures were approved by the Institutional Review Board of Seattle Children’s Hospital and the Medical Re-search Council of Zimbabwe. Specimens were selected based on a high HIV-1 concentration in milk and adequate specimen volume for generation of multiple sequences by single-template PCR, and a subset were selected to have mastitis,

defined by a milk Na⫹concentration of⬎12 mM.

Specimen collection and processing.Briefly, breast milk was collected by manual expression, and skim milk was separated from cells using centrifugation

(15). The Na⫹concentration in skim milk was determined using a Roche/Hitachi

902 clinical chemistry analyzer (15). HIV-1 RNA was quantified using the Am-plicor Monitor kit (version 1.5; Roche Diagnostics) in plasma using the standard method (detection limit, 400 copies/ml) and in skim milk using the ultrasensitive method (detection limit, 50 copies/ml) (15).

Generation of single-template sequences.The nucleic acids in 0.2 to 1.0 ml of plasma samples and 0.7 to 2.0 ml of skim milk samples were extracted using Boom silica methods, with slight modifications (6, 8). Purified RNA was reverse transcribed into cDNA using primer BH2JC (TTAGTGGGTGCTACTCCTAA TGG; HXB2 coordinates 7701 to 7723) or ED12 (AGTGCTTCCTGCTGCTC

CCAAGAACCCAAG; HXB2 coordinates 7822 to 7792) forenv(1) and primer

RT1-C (GTTGACTCAGCTTGGATGCAC; HXB2 coordinates 2519 to 2539)

forpol. DNA from 1.2 ml of whole-blood or frozen milk cell pellets derived from

4 to 14 ml of whole breast milk (15) were extracted using the QIAamp minikit

(Qiagen, Hilden, Germany) into 50␮l of elution buffer, according to the

man-ufacturer’s instructions. The concentration of amplifiable viral templates in ex-tracted nucleic acids was quantified using limiting dilution nested PCR (45), with a multiplexed first round containing the above-mentioned BH2JC and RT1-C forward primers and ED5JC (TGCATGAGGATATAATCAGTTTATGGGA;

HXB2 coordinates 6535 to 6562) to amplifyenvand RT2-C (GTATATCATTG

ACAGTCCAGC; HXB2 coordinates 3321 to 3301) to amplifypol. In a

second-round PCR, the C2-V5 region ofenvwas amplified with primers DR7JC (GTG

GTATCAACTCAACTACTGTTAAATGG; HXB2 coordinates 6984 to 7012) and DR8 (CACTTCTCCAATTGTCCCTCATATCTCCTCC; HXB2 coordi-nates 7638 to 7668). Viral gene sequences were then derived by one of the two following methods. First, up to 100 amplification reactions were performed on

the nucleic acid from each specimen after dilution to⬃0.3 HIV-1 amplifiable

copies/reaction to amplify a single viral template (45, 53). Positive reactions were identified by gel electrophoresis, processed with ExoSAP-IT (USB Corporation, Cleveland, OH), and sequenced directly using fluorescent dye terminators (BigDye Terminator version 3.1 cycle sequencing kit; Applied Biosystems, Foster City, CA) and a Prism 3730XL DNA analyzer (Applied Biosciences). Second, when the average viral input exceeded 0.3 copies/reaction, amplicons were cloned as previously described (8), and one clone per PCR was sequenced to ensure derivation from separate viral templates (32). Each type of specimen (plasma RNA, whole-blood DNA, skim milk RNA, and milk cell pellet DNA) obtained from a participant was evaluated on a different day to minimize the risk of cross-contaminating specimens.

Sequence analysis and phylogenetic tree construction.Sequences were assem-bled and checked for read errors in Sequencher version 3.4 (Gene Codes Cor-poration, Ann Arbor, MI). Alignments were generated in CLUSTALW (52), and hypermutated sequences were excluded and manually adjusted using MacClade version 4.08 (34). An all-inclusive phylogenetic tree was used to verify that each

sequence segregated only with others from the identified participant. Sequences from all participants were carefully examined for contamination by comparisons to known reference sequences and to all other sequences generated in the laboratories, and no matches were found. We also screened each alignment for recombination, since this could confound compartmentalization (56). For all subjects, phylogenetic trees were constructed using the DIVEIN interface (11) (http://indra.mullins.microbiol.washington.edu/DIVEIN/index.html), with a

gen-eral time-reversible model plus invariant plus gamma distribution (GTR⫹I⫹G)

model evolution within PhyML (version 3.0) (18). Four representative subtype C HIV-1 sequences from GenBank (accession numbers AY265933, AY265936, AF268277, and AY265952) were used to root the phylogenies of each partici-pant’s sequences. In order to better evaluate the possibility of dual HIV-1 infection in the phylogenies of those individuals (participants A, D, E, G, and H) with pronounced separation of discrete clades, eight additional subtype C se-quences (GenBank accession numbers AF443091, AY772691, AY162224, AY772699, AF067155, AF286224, AF443112, and AF443106) as well as one each from subtypes A, B, and D (GenBank accession numbers AF286241, U63632, and AY253311) were included. HIV-1 coreceptor usage was predicted for the V3 region amino acid sequences using the subtype C position-specific scoring X4/R5 and syncytium-inducing and non-syncytium-inducing matrices (23) (http://indra .mullins.microbiol.washington.edu/pssm/).

Evaluation of HIV-1 population structure and statistical testing.The topology of each phylogenetic tree was examined, with particular attention to the identi-fication of breast milk- or peripheral blood-specific clades. The compartmental structure of viral sequences in blood and milk specimens obtained from each subject was evaluated by the Slatkin and Maddison (SM) test, which evaluates variation from normalcy in the distribution of sequences over a predicted tree structure using MacClade (8, 49). Each blood and milk specimen was included in SM analysis if at least five sequences were available from that specimen. Com-parisons were performed using each infecting HIV-1 strain separately for those participants that had evidence of dual infection. The SM test was further eval-uated using 1,000 bootstrap replicate phylogenies (7, 44). Genetic differentiation between breast milk and blood specimens was also evaluated using the Bayesian tip-significance (BaTS) testing tool (41) (http://evolve.zoo.ox.ac.uk/Evolve/BaTS .html), which takes into account uncertainty arising from phylogenetic structure error by testing over multiple credible topologies produced by the Bayesian phylogenetics program BEAST (13) (http://beast.bio.ed.ac.uk/Main_Page). BaTS testing evaluates the sequences by running the following two established tests: the association index (AI) (13), which assesses the population structure by weighting the contribution of each internal node based on how deep it is in the tree, and the parsimony score (PS), also known as the Slatkin and Maddison test, described above. BaTS also incorporates a new measure, the maximum single-state clade size (MC), a statistic which quantifies the observation that stronger phylogeny-trait associations should produce larger monophyletic clades whose tips all share the same trait (41). Each participant’s alignment was used to generate a posterior sample of trees (PST) in BEAST, the exponential growth model under the Hasegawa-Kishino-Yano plus gamma invariant model with a

Markov chain Monte Carlo chain length of 5⫻106_{and parameter logging every}

1,000 generations, yielding a PST of 5,000, which was the input data for BaTS testing, minus a burn-in of the first 10%, or 500 trees. BaTS testing was set to

generate 100 null distributions to test the significance of the observed data.P

values of⬍0.05 were considered to be evidence of compartmentalization without

correction for multiple comparisons. The pairwise genetic distances of each breast milk sequence from each blood sequence within a participant were cal-culated using the DIVEIN distance generator under the same model that was estimated for phylogeny calculation (48).

Milk Na⫹medians were compared using the two-sample Wilcoxon rank sum

(Mann-Whitney) test, and the proportions of monotypic virus were compared using Fisher’s exact test (two tailed). Linear regression and the generalized estimating equation (GEE) with robust standard errors were used to evaluate the

association between the milk Na⫹concentration and the mean pairwise genetic

distance between sequences in the breast milk and blood specimens obtained from each participant. These analyses were performed using Stata/SE 9.2 for Macintosh (StataCorp, College Station, TX).

Nucleotide sequence accession numbers.The gene sequences determined in this study were deposited in GenBank under accession numbers HQ172164 through HQ172673.

RESULTS

Participant and specimen characteristics.

Blood and breast

milk specimens obtained from both breasts of nine women

http://jvi.asm.org/

(3)

collected 6 to 16 weeks postpartum were evaluated in a

cross-sectional study (15). All participants had received a single dose

of nevirapine for the prevention of MTCT (17) but were not

otherwise exposed to antiretroviral drugs. The median HIV-1

RNA viral load in plasma samples was 146,224 copies/ml

(range, 25,831 to 986,896 copies/ml) and in milk samples was

4,105 copies/ml (range, 241 to 124,254 copies/ml) (Table 1). A

total of 515 individual HIV-1

env

sequences were generated,

with a median of 54 sequences from each participant (range, 42

to 74) (Table 1 and Fig. 1). Of these sequences, 186 were

generated from HIV-1 RNA, and 329 were generated from

HIV-1 DNA. A total of 171 of these sequences were derived

from blood samples, and 344 were derived from milk samples

(Table 1 and Fig. 1).

Analysis of HIV-1 population structure.

Pronounced

sepa-ration of discrete clades was apparent in phylogenetic trees

obtained from five of the nine participants (A, D, E, G, and H).

The trees obtained from two of these individuals, participants

A and E, displayed separation of viral clades by reference

sequences without evidence of recombination, indicating

infec-tion with two unrelated strains of subtype C HIV-1 (Fig. 1). A

lack of genetic diversity in cell-associated HIV-1, suggestive of

recent infection, was notable in each infecting virus population

of participant E. Phylogenies obtained from each of the other

participants displayed a monophyletic cluster of sequences

dis-tinct from reference sequences, without evidence of dual

in-fection. The sequences obtained from participant H were

monophyletic with respect to reference sequences yet

dis-played two discrete clades that were found to differ by

geno-typic coreceptor usage prediction (Fig. 1) (phenogeno-typic analysis

for definitive determination of coreceptor usage was not

per-formed [23]). Sequences obtained from participants D and G

formed distinct clades that were not explained by dual

infec-tion or coreceptor use.

Across all the participants’ phylogenies, HIV-1 sequences

from breast milk specimens were interspersed with those from

blood specimens, without clades comprised exclusively of

blood or milk viruses. RNA and DNA sequences were largely

interspersed across the individual’s phylogenies. Because

cell-free and cell-associated HIV-1 sequences in untreated

individ-uals largely reflect actively replicating virus (33, 35) and

be-cause of the small numbers of sequences of each type available

for analysis, RNA and DNA sequences were combined in the

evaluations of compartmentalization.

The frequency of finding two or more monotypic sequences

(those with zero nucleotide differences) was similar across

breast milk and blood specimens (15/18 versus 5/9,

respec-tively;

P

⫽

0.175). However, monotypic variants comprised a

greater proportion of all sequences in milk specimens than in

blood specimens (22.4% versus 12.9%;

P

⫽

0.012) (Table 2).

Despite the interspersion of sequences on phylogenetic trees

noted above, statistical evaluation of the population structure

of viral sequences using SM testing based on maximum

likeli-hood phylogenies detected compartmentalization of virus

be-tween breast milk and blood in 6 of 17 (35.3%) specimens

obtained from 4 of 9 individuals (participants B, C, D, and E)

(Table 3). Results were similar when statistical estimation of

compartmentalization was performed using parsimony scores,

association indices, and maximum monophyletic clade sizes

based on Bayesian phylogenies (12, 41) (Table 3). In addition,

performing all analyses using balanced numbers of sequences

from each participant’s samples did not substantially change

estimates of compartmentalization (data not shown). No

evi-dence for compartmentalization between right and left breast

milk specimens was observed (data not shown). After

mono-typic sequences, which can inflate statistical estimates of

pop-ulation structure (7, 8, 21), were collapsed into a single

se-quence, 3 of 6 (50%) specimens no longer showed evidence of

compartmentalization by SM testing (Table 3), reducing the

overall rate to 3 of 17 (17.6%) specimens.

Effect of mastitis on HIV-1 population structure.

The

me-dian concentration of breast milk Na

⫹

across all specimens

analyzed was 8 mM (range, 2 to 86 mM), and 6 participants

had mastitis in one breast, as defined by a milk Na

⫹

concen-tration of

⬎

12 mM (Table 1) (15, 47). Milk specimens with

mastitis had a median HIV-1 viral load of 45,228 copies/ml

(range, 1,553 to 124,254 copies/ml) compared with that of

2,660 copies/ml (range, 400 to 55,227 copies/ml) in specimens

without mastitis (

P

⫽

0.043).

[image:3.585.42.543.88.244.2]

The proportion of monotypic viruses in milk specimens was

not associated with mastitis (18.4% versus 24.4% in samples

with and without mastitis, respectively;

P

⫽

0.218) (Table 2).

TABLE 1. Plasma and breast milk HIV-1 viral loads, breast milk Na

⫹

concentrations, and numbers of

single-template

env

DNA and RNA sequences analyzed

Participant

Specimen results

Blood Left breast milk Right breast milk

Plasma viral load (log copies/ml)

No. of HIV-1

envsequences Skim milk_{viral load}

(log copies/ml)

Na⫹

concn

(␮M)

No. of HIV-1

envsequences Skim milk_{viral load}

(log copies/ml)

Na⫹

concn

(␮M)

No. of HIV-1

envsequences

DNA RNA DNA RNA DNA RNA

A

4.4

11

7

3.6

18

9

7

3.0

8

2

6

B

4.8

11

10

3.6

6

12

10

4.7

18

14

C

5.0

12

3

3.5

4

9

5

3.2

6

13

12

D

5.1

11

8

4.7

4

10

7

5.1

16

0

E

5.2

11

13

2.4

8

10

12

NA

a

86

12

₀

F

5.5

12

13

4.2

6

14

8

4.8

24

10

17

G

5.7

11

0

3.2

22

10

2.6

10

13

4

H

5.7

25

0

4.1

4

28

0

4.1

10

15

0

I

6.0

13

0

3.4

2

9

13

3.3

2

6

7

a

NA⫽sample not available.

10814

GANTT ET AL.

J. V

IROL

.

http://jvi.asm.org/

(4)

[image:4.585.48.542.48.630.2]

FIG. 1. HIV-1

env

sequences from both breast milk and blood specimens are present in all phylogenetic clades, suggesting a lack of viral

compartmentalization. Maximum likelihood phylogenetic analysis of the HIV-1

env

region C2-V5 derived from single-amplicon-derived sequences

from RNA (squares) and DNA (circles) from blood specimens (black filled symbols) and breast milk specimens (left breast, gray filled symbols;

right breast, open symbols). Dual HIV-1 infection is evident in participants A and E, with each infecting strain delineated by a bracket. The

phylogeny for participant H shows distinct clades, shown with brackets, which differ by predicted coreceptor usage (CCR5 or CXCR4). Mastitis,

as defined by a breast milk Na

⫹

concentration of

⬎

12 mM, was present in samples from subject A (left breast), B (right breast), D to F (right

breast), and G (left breast). Sequences obtained from all participants are rooted by four reference sequences of subtype C (labeled RC1, etc.).

Eight additional subtype C sequences and one each from subtypes A, B, and D were used to root phylogenies for participants A and E in order

to better characterize their dual infections. The number of substitutions per site is indicated by the horizontal line below each phylogeny.

10815

on November 8, 2019 by guest

(5)

Similarly, compartmentalization of virus was not associated

with mastitis, with compartmentalization observed in 1 of 6

(16.7%) breast milk specimens with mastitis compared to 5 of

11 (45.5%) of those without mastitis (

P

⫽

0.334) (Table 3) by

SM testing. Furthermore, the median Na

⫹

concentration did not

differ significantly between milk specimens with

compartmental-ization detected by SM testing and those without (

P

⫽

0.155).

The relationship between milk Na

⫹

concentration as a

marker of inflammation within the breast and the genetic

dis-tance between HIV-1 populations in breast milk and blood

samples was evaluated using the GEE. Breast milk Na

⫹

was

positively correlated with the genetic distance between HIV-1

in milk and blood specimens, indicating that with increasing

inflammation HIV-1 populations in milk specimens

progres-sively diverged from those in blood specimens (

␤

coefficient

⫽

3.8

⫻

10

⫺5

; 95% confidence interval, 1.6

⫻

10

⫺6

to 7.4

⫻

10

⫺5

;

P

⫽

0.041).

DISCUSSION

Three observations are noteworthy from our study. First, we

found only limited compartmentalization of HIV-1 in breast

milk specimens, suggesting substantial interchange of viruses

between the milk and blood specimens obtained from the

participants we studied. Second, monotypic sequences were

overrepresented in the HIV-1 populations from milk

speci-mens compared to those from blood specispeci-mens, suggesting

local HIV-1 production within the breast, possibly from the

proliferation of infected cells. Third, the mean genetic distance

between milk and blood viruses correlated positively with

breast milk Na

⫹

concentrations, suggesting full cycles of viral

replication within the breast and that the increased breast milk

HIV-1 concentrations observed with mastitis are not simply

due to the passage of virus from blood into breast milk.

Viral compartmentalization was detected in a minority of

breast milk specimens using a panel of statistical methods

commonly used to evaluate population structure. However,

among the participants evaluated, no tissue-specific clades

were observed in phylogenetic trees. Rather, viral sequences

from milk and blood specimens were intermingled, suggesting

that viruses mix readily between these fluids. Similarly, studies

of HIV-1 populations in the genital tract and lung have found

compartmentalization by statistical testing when segregation

by fluid/tissue is not apparent in phylogenies (7, 21). The

im-portance of such compartmentalization is unclear but is

con-sistent with replication or proliferation within a small virus

population (i.e., limited effective population size) (7, 21, 56).

[image:5.585.45.541.80.248.2]

Detection and quantification of minority sequence variants

are dependent on the method of sampling and the number of

sequences obtained. We sequenced virus derived from single

PCR amplicons, which prevents bias due to resampling of

individual variants (9, 32). Resampling of viral sequences may

explain the apparent compartmentalization of HIV-1 in breast

milk specimens previously reported for some women (3, 4). In

support of our findings, a study using a heteroduplex tracking

assay was unable to distinguish differences between HIV-1

populations from breast milk and blood specimens obtained

from 8 women (22), as did a recent study that cloned viruses

but employed methods to avoid resampling of viral templates

(20). The time and expense required for the generation of

single-amplicon sequences limits the sample size feasible for

phylogenetic analyses and therefore affects the precision of

estimates of population differences. We analyzed a large

num-ber of sequences, but these sequences were derived from a

small number of nonrandomly selected participants,

poten-tially limiting the generalizability of our findings. In addition, it

was not possible to perform analyses on cell-free virus

popu-lations separately, as few sequences were generated from

breast milk specimens with low concentrations of HIV-1 RNA.

Finally, because the sequences were derived at a single time

point early in lactation, we cannot rule out the possibility that

HIV-1 compartmentalization in an individual’s breast milk

changes significantly over time. Relevant to this last point, a

comparison of the compartmentalization of blood and milk

when these specimens were collected on the same or different

dates gave discrepant results (20). Viruses in specimens

col-lected on the same dates were rarely compartmentalized,

TABLE 2. Monotypic HIV-1

env

sequences in breast milk and plasma specimens

Participanta

No. of monotypic HIV-1envsequences/total no. of HIV-1envsequences (%)

Blood Breast milk

b

Left Right Combined

A1

2/14 (14.3)

3/11 (27.3)

0/3 (0)

3/14 (21.4)

A2

0/4 (0)

2/5 (40.0)

4/10 (40.0)

B

2/21 (9.5)

0/22 (0)

0/23 (0)

0/45 (0.0)

C

0/15 (0)

4/14 (28.6)

8/25 (32.0)

12/39 (30.8)

D

0/19 (0)

2/17 (11.8)

5/16 (31.3)

7/33 (21.2)

E1

7/17 (41.2)

11/14 (78.6)

0/3 (0)

11/17 (64.7)

E2

5/7 (71.4)

4/8 (50.0)

5/9 (55.6)

9/17 (52.9)

F

0/25 (0)

2/22 (9.1)

0/27 (0)

2/49 (4.1)

G

0/11 (0)

6/20 (30.0)

2/17 (11.8)

8/37 (21.6)

H

2/25 (8.0)

4/28 (14.3)

4/15 (26.7)

8/43 (18.6)

I

4/13 (30.8)

10/22 (45.5)

2/13 (15.4)

12/35 (34.3)

Total

22/171 (12.9)

48/183 (26.2)

28/156 (17.9)

76/339 (22.4)

a

Analyses for those participants (A and E) who had dual HIV-1 infections were performed separately on each of the infecting HIV-1 strains (1, upper clade in phylogenies; 2, lower clade in phylogenies) (Fig. 1).

b

Breast milk specimens with mastitis (Na⫹concentrations of⬎12 mM) are underlined.

10816

GANTT ET AL.

J. V

IROL

.

http://jvi.asm.org/

(6)

whereas viruses in those collected more than 100 days apart

were consistently compartmentalized across statistical

anal-yses, suggesting that significant evolution occurred in this time

frame.

Even using methods that preclude resampling, identical

se-quences were found in the majority of specimens. Indeed, we

may have slightly underestimated the number of identical

se-quences, as approximately half of the sequences were

gener-ated by cloning, which we estimate could introduce an average

of

⬍

1- to 3-base-pair changes per sequence (14). These

mono-typic sequences likely reflect very recent viral replication or, in

the case of DNA sequences, the clonal expansion of

HIV-1-infected cells (2, 7, 8, 21, 53). Thus, the disproportionate

prev-alence of monotypic sequences in breast milk specimens

com-pared to those in blood specimens may represent a relatively

greater production of HIV-1 in milk. Alternatively, the

likeli-hood of sampling identical sequences from blood specimens

compared to that from breast milk specimens may differ due to

the large total circulating volume and higher HIV-1

concen-trations in blood than in milk. It is also possible that the fact

that slightly more blood sequences than milk sequences were

obtained by cloning and may include additional errors

intro-duced during PCR resulted in an underestimate of monotypic

viruses in blood specimens. In either case, the presence of

identical sequences can bias statistical estimates of population

structure (2, 7, 8, 21). Of note, monotypic sequences accounted

for half of the instances of compartmentalization detected.

Our findings are remarkably similar to those from studies of

rhesus macaques (42) that had large numbers of monotypic

SIV

env

sequences detected in the breast milk specimens but

not in blood specimens. Furthermore, although breast milk

and blood simian immunodeficiency virus (SIV) sequences

were interspersed in phylogenetic trees, SM testing detected

compartmentalization that was again diminished by exclusion

of monotypic sequences. We contend that

compartmentaliza-tion based on monotypic or nearly identical sequences may not

reflect a separate viral population but rather might be a

snap-shot of recent events, namely, a burst of viral replication and/or

proliferation of HIV-1-infected cells.

Mastitis is associated with increased breast milk HIV-1

loads, presumably by either influx of virions from the blood

and/or local viral production within the breast (15, 31, 47, 55).

We observed a statistically significant positive correlation

be-tween breast milk Na

⫹

concentrations and the genetic distance

between milk and blood HIV-1 subpopulations. This is

consis-tent with increased replication of HIV-1 within the breast due

to mastitis, resulting in divergence of breast milk HIV-1

sub-populations from those in blood. The plausibility of mastitis

stimulating local HIV-1 replication in the breast is supported

by observations of the effects of infection and inflammation in

other settings. For example, increased production of HIV-1 in

lungs (29, 37) and lymph nodes (39) has been associated with

opportunistic infections, and viral replication can be stimulated

in T cells by various inflammatory cytokines (27, 54).

When inflammation renders mammary epithelial tight

junc-tions permeable, HIV-1 from the blood may more easily enter

breast milk, as occurs with other blood components (15, 16, 36,

47, 55). Although the passage of HIV-1 from blood into breast

milk may contribute to the increase in milk HIV-1

concentra-tions due to mastitis, our observaconcentra-tions suggest that this is not

TABLE

3.

Evaluation

of

breast

milk

HIV-1

compartmentalization

using

dif

ferent

statistical

methods

Participant a P values for breast milk vs. blood using indicated methods b Left breast Right breast SM test PS AI MC, milk MC, blood SM test PS AI MC, milk MC, blood

A1

0.201

(0.404)

0.090

(0.40)

0.260

(0.520)

0.120

(0.450)

0.930

(0.880)

—

———

A

2

—

————

—

B

0.011

(0.030)

<0.001

(<0.001)

<0.001

(0.010)

0.010

(0.010)

0.340

(0.360)

0.392

(0.505)

0.080

(0.180)

0.020

(0.070)

0.010

(0.020)

0.430

(0.350)

C

0.003

(0.010)

<0.001

(<0.001)

<0.001

(<0.001)

0.060

(0.050)

<0.001

(0.090)

0.032

(0.124)

0.050

(0.140)

0.100

(0.150)

0.180

(0.510)

0.710

(0.800)

D

0.001

(0.002)

<0.001

(<0.001)

<0.001

(0.010)

0.250

(0.150)

0.050

(0.050)

0.018

(0.153)

<0.001

(0.999)

0.020

(0.160)

0.280

(0.999)

0.010

(0.010)

E1

0.023

(—)

0.010

(—)

0.120

(—)

0.010

(—)

0.430

(—)

—

E2

0.008

(—)

0.070

(—)

0.280

(0.280)

0.720

(0.430)

0.310

(0.650)

0.854

(—)

0.780

(—)

0.710

(—)

0.910

(—)

0.410

(—)

F

0.484

(0.573)

0.470

(0.620)

0.140

(0.500)

0.410

(0.430)

0.590

(0.650)

0.741

(0.741)

0.580

(0.580)

0.230

(0.230)

0.510

(0.510)

0.999

(0.999)

G

0.540

(0.701)

0.380

(0.590)

0.480

(0.500)

0.080

(0.170)

0.590

(0.110)

0.125

(0.174)

0.540

(0.620)

0.240

(0.480)

0.970

(0.999)

0.060

(0.150)

H

0.613

(0.613)

0.550

(0.390)

0.770

(0.740)

0.999

(0.999)

0.590

(0.410)

0.097

(0.314)

0.020

(0.210)

0.030

(0.170)

0.110

(0.710)

0.820

(0.800)

I

0.059

(0.443)

0.220

(0.930)

0.280

(0.800)

0.190

(0.970)

0.650

(0.490)

0.340

(0.651)

0.210

(0.480)

0.440

(0.890)

0.870

(0.810)

0.890

(0.710)

a Analyses for those participants (A and E) who had dual HIV-1 infections were performed separately on each of the infecting HIV-1 strains (1, upper clad e in phylogenies; 2, lower clade in phylogenies) (Fig. 1). b P values shown are derived from comparing all sequences, excluding monotypic sequences, from the breast milk and blood specimens obtained from each su bject using various methods, as follows: Slatkin and Maddison (SM) test, parsimony score (PS), association index (AI), and maximum single-state clade size (MC). In parentheses are the P values for the same comparison after elimination of identical sequences within a specimen. P values of ⬍ 0.05 are shown in boldface. For the MC test, a P value ⬍ 0.05 for either the milk or blood sample is considered evidence of compartmentalization. Specimens yielding ⬍ 5 sequences were not analyzed for compartmentalization by SM (indicated by “—”). Breast milk specimens with mastitis (Na ⫹ concentrations of ⬎ 12 mM) are underlined.

http://jvi.asm.org/

[image:6.585.60.248.66.726.2]

(7)

the sole mechanism, because an influx of blood viruses would

decrease the genetic differences between these subpopulations.

While the absolute divergence of breast milk HIV-1 we

de-tected in mastitic milk was small, it is important to note that

the duration of increased viral replication would at most be 6

to 16 weeks in duration due to the timing of sample collection

after the onset of lactation. In addition, the magnitude of the

genetic differences between milk and blood HIV-1 may have

been diminished by the countervailing contribution of blood

virus leaking into milk. Of note, although there was a

signifi-cant association between milk Na

⫹

concentrations and the

genetic distance between HIV populations in blood and milk

specimens, we did not detect an association between mastitis

and the prevalence of monotypic sequences in milk specimens.

This discrepancy suggests that mastitis may stimulate viral

rep-lication across a larger population of virus in the infected

breast compared to that in the healthy breast, perhaps due to

an influx of infected inflammatory cells. Furthermore,

com-partmentalization of virus in breast milk specimens was not

associated with mastitis, suggesting either that a relatively

di-verse group of viruses replicated in milk specimens or that the

net effect of inflammation on replication within the breast was

not sufficient to affect HIV-1 population structure by these

measures.

In summary, phylogenetic analyses of HIV-1 genomes from

breast milk and blood specimens obtained from lactating

women found limited viral compartmentalization, indicating

relatively free mixing of viruses between milk and blood

spec-imens. The greater prevalence of monotypic HIV-1 in breast

milk specimens suggests viral replication and/or proliferation

of cells containing proviruses within the breast. Statistical

mod-eling of the effect of inflammation on genetic distance between

HIV-1 subpopulations in milk and blood specimens found

ev-idence for increased HIV-1 replication in breasts with mastitis.

ACKNOWLEDGMENTS

We are grateful to the participants. We appreciate the contributions

of Mary Mucheche and Lynda Stranix-Chibanda in participant

enroll-ment; Rhona Jack, Ingrid Beck, Patrick Abe, and Kuda Matasa for

technical assistance; and the Zimbabwe Ministry of Health, the

Chi-tungwiza Health Department, and the Department of Pediatrics and

Child Health, University of Zimbabwe College of Health Sciences.

This work was supported by the National Institutes of Health grants

R21 AI065288 (to L.M.F.), KL2 RR025015 (to S.G.), and T32

HD07233 (to S.G.) and the University of Washington Center for AIDS

Research Computational Biology Core (grant P30 AI27757 to J.I.M.).

We all made substantial contributions to the project and agree to

our positions in the byline.

We have no conflicts of interest to declare.

REFERENCES

1.Altfeld, M., E. S. Rosenberg, R. Shankarappa, J. S. Mukherjee, F. M. Hecht, R. L. Eldridge, M. M. Addo, S. H. Poon, M. N. Phillips, G. K. Robbins, P. E. Sax, S. Boswell, J. O. Kahn, C. Brander, P. J. Goulder, J. A. Levy, J. I. Mullins, and B. D. Walker. 2001. Cellular immune responses and viral diversity in individuals treated during acute and early HIV-1 infection. J.

Exp. Med.193:169–180.

2.Bailey, J. R., A. R. Sedaghat, T. Kieffer, T. Brennan, P. K. Lee, M. Wind-Rotolo, C. M. Haggerty, A. R. Kamireddi, Y. Liu, J. Lee, D. Persaud, J. E. Gallant, J. Cofrancesco, Jr., T. C. Quinn, C. O. Wilke, S. C. Ray, J. D. Siliciano, R. E. Nettles, and R. F. Siliciano.2006. Residual human immu-nodeficiency virus type 1 viremia in some patients on antiretroviral therapy is dominated by a small number of invariant clones rarely found in

circulat-ing CD4⫹T cells. J. Virol.80:6441–6457.

3.Becquart, P., N. Chomont, P. Roques, A. Ayouba, M. D. Kazatchkine, L. Belec, and H. Hocini.2002. Compartmentalization of HIV-1 between breast

milk and blood of HIV-infected mothers. Virology300:109–117.

4.Becquart, P., V. Courgnaud, J. Willumsen, and P. Van de Perre.2007. Diversity of HIV-1 RNA and DNA in breast milk from HIV-1-infected

mothers. Virology363:256–260.

5.Bedri, A., B. Gudetta, A. Isehak, S. Kumbi, S. Lulseged, Y. Mengistu, A. V. Bhore, R. Bhosale, V. Varadhrajan, N. Gupte, J. Sastry, N. Suryavanshi, S. Tripathy, F. Mmiro, M. Mubiru, C. Onyango, A. Taylor, P. Musoke, C. Nakabiito, A. Abashawl, R. Adamu, G. Antelman, R. C. Bollinger, P. Bright, M. A. Chaudhary, J. Coberly, L. Guay, M. G. Fowler, A. Gupta, E. Hassen, J. B. Jackson, L. H. Moulton, U. Nayak, S. B. Omer, L. Propper, M. Ram, V. Rexroad, A. J. Ruff, A. Shankar, and S. Zwerski.2008. Extended-dose ne-virapine to 6 weeks of age for infants to prevent HIV transmission via breastfeeding in Ethiopia, India, and Uganda: an analysis of three

random-ised controlled trials. Lancet372:300–313.

6.Boom, R., C. Sol, M. Salimans, C. Jansen, P. W.-V. Dillen, and J. V. d. Noordaa.1990. Rapid and simple method for purification of nucleic acids.

J. Clin. Microbiol.28:495–503.

7.Bull, M., G. Learn, I. Genowati, J. McKernan, J. Hitti, D. Lockhart, K. Tapia, S. Holte, J. Dragavon, R. Coombs, J. Mullins, and L. Frenkel.2009. Compartmentalization of HIV-1 within the female genital tract is due to monotypic and low-diversity variants not distinct viral populations. PLoS One4:e7122.

8.Bull, M. E., G. H. Learn, S. McElhone, J. Hitti, D. Lockhart, S. Holte, J. Dragavon, R. W. Coombs, J. I. Mullins, and L. M. Frenkel.2009. Monotypic human immunodeficiency virus type 1 genotypes across the uterine cervix

and in blood suggest proliferation of cells with provirus. J. Virol.83:6020–

6028.

9.Bull, M. E., G. H. Learn, J. I. Mullins, and L. M. Frenkel.2007. Methods used to examine compartmentalization of viral populations between the

genital tract and peripheral blood. J. Infect. Dis.196:493–494. (Author’s

reply,196:494–495.)

10.Delwart, E. L., J. I. Mullins, P. Gupta, G. H. Learn, Jr., M. Holodniy, D. Katzenstein, B. D. Walker, and M. K. Singh.1998. Human

immunodefi-ciency virus type 1 populations in blood and semen. J. Virol.72:617–623.

11.Deng, W., B. S. Maust, D. C. Nickle, G. H. Learn, Y. Liu, L. Heath, S. L. K. Pond, and J. I. Mullins.2010. DIVEIN: a web server to analyze phylogenies,

sequence divergence, diversity, and informative sites. Biotechniques48:405–

408.

12.Drummond, A. J., G. K. Nicholls, A. G. Rodrigo, and W. Solomon.2002. Estimating mutation parameters, population history and genealogy

simulta-neously from temporally spaced sequence data. Genetics161:1307–1320.

13.Drummond, A. J., and A. Rambaut.2007. BEAST: Bayesian evolutionary

analysis by sampling trees. BMC Evol. Biol.7:214.

14.Eckert, R. A., and T. A. Kunkel.1991. DNA polymerase fidelity and the

polymerase chain reaction. PCR Methods Appl.1:17–24.

15.Gantt, S., A. K. Shetty, K. D. Seidel, K. Matasa, G. Musingwini, G. Woelk, L. S. Zijenah, D. A. Katzenstein, and L. M. Frenkel. 2007. Laboratory indicators of mastitis are not associated with elevated HIV-1 DNA loads or

predictive of HIV-1 RNA loads in breast milk. J. Infect. Dis.196:570–576.

16.Georgeson, J. C., and S. M. Filteau.2000. Physiology, immunology, and

disease transmission in human breast milk. AIDS Patient Care STDS.14:

533–539.

17.Guay, L. A., P. Musoke, T. Fleming, D. Bagenda, M. Allen, C. Nakabiito, J. Sherman, P. Bakaki, C. Ducar, M. Deseyve, L. Emel, M. Mirochnick, M. G. Fowler, L. Mofenson, P. Miotti, K. Dransfield, D. Bray, F. Mmiro, and J. B. Jackson.1999. Intrapartum and neonatal single-dose nevirapine compared with zidovudine for prevention of mother-to-child transmission of HIV-1 in

Kampala, Uganda: HIVNET 012 randomised trial. Lancet354:795–802.

18.Guindon, S., and O. Gascuel.2003. A simple, fast, and accurate algorithm to

estimate large phylogenies by maximum likelihood. Syst. Biol.52:696–704.

19.Harris, J. R., S. K. Greene, T. K. Thomas, R. Ndivo, J. Okanda, R. Masaba, I. Nyangau, M. C. Thigpen, R. M. Hoekstra, and R. E. Quick.2009. Effect of a point-of-use water treatment and safe water storage intervention on

diar-rhea in infants of HIV-infected mothers. J. Infect. Dis.200:1186–1193.

20.Heath, L., S. Conway, L. Jones, K. Semrau, K. Nakamura, J. Walter, W. D. Decker, J. Hong, T. Chen, M. Heil, M. Sinkala, C. Kankasa, D. M. Thea, L. Kuhn, J. I. Mullins, and G. M. Aldrovandi.2010. Restriction of HIV-1 genotypes in breast milk does not account for the population transmission

genetic bottleneck that occurs following transmission. PLoS One5:e10213.

21.Heath, L., A. Fox, J. McClure, K. Diem, A. B. van ’t Wout, H. Zhao, D. R. Park, J. T. Schouten, H. L. Twigg, L. Corey, J. I. Mullins, and J. E. Mittler. 2009. Evidence for limited genetic compartmentalization of HIV-1 between

lung and blood. PLoS One4:e6949.

22.Henderson, G. J., N. G. Hoffman, L. H. Ping, S. A. Fiscus, I. F. Hoffman, K. M. Kitrinos, T. Banda, F. E. Martinson, P. N. Kazembe, D. A. Chilongozi, M. S. Cohen, and R. Swanstrom.2004. HIV-1 populations in blood and

breast milk are similar. Virology330:295–303.

23.Jensen, M. A., G. S. Gottlieb, A. B. van ’t Wout, F. S. Li, D. C. Nickle, K. Wong, H. X. He, S. McLaughlin, R. Shankarappa, J. B. Margolick, and J. I. Mullins.2003. A bioinformatic predictor of coreceptor usage corre-lates with markers of disease progression and supports the gradual evo-lution of X4 virus via R5X4 intermediates, poster 498. Abstr. 10th Conf. Retroviruses Opportunistic Infect., Boston, MA.

10818

GANTT ET AL.

J. V

IROL

.

http://jvi.asm.org/

(8)

24.John, G. C., R. W. Nduati, D. A. Mbori-Ngacha, B. A. Richardson, D. Panteleeff, A. Mwatha, J. Overbaugh, J. Bwayo, J. O. Ndinya-Achola, and J. K. Kreiss.2001. Correlates of mother-to-child human immunodeficiency virus type 1 (HIV-1) transmission: association with maternal plasma HIV-1 RNA load, genital HIV-1 DNA shedding, and breast infections. J. Infect. Dis.183:206–212.

25.Kilewo, C., K. Karlsson, A. Massawe, E. Lyamuya, A. Swai, F. Mhalu, and G. Biberfeld. 2008. Prevention of mother-to-child transmission of HIV-1 through breast-feeding by treating infants prophylactically with lamivudine in Dar es Salaam, Tanzania: the Mitra Study. J. Acquir. Immune Defic.

Syndr.48:315–323.

26.Kilewo, C., K. Karlsson, M. Ngarina, A. Massawe, E. Lyamuya, A. Swai, R. Lipyoga, F. Mhalu, and G. Biberfeld.2009. Prevention of mother-to-child transmission of HIV-1 through breastfeeding by treating mothers with triple antiretroviral therapy in Dar es Salaam, Tanzania: the Mitra Plus Study. J.

Acquir. Immune Defic. Syndr.52:406–416.

27.Kinter, A., A. Moorthy, R. Jackson, and A. S. Fauci.2003. Productive HIV

infection of resting CD4⫹T cells: role of lymphoid tissue microenvironment

and effect of immunomodulating agents. AIDS Res. Hum. Retroviruses 19:847–856.

28.Koulinska, I. N., E. Villamor, B. Chaplin, G. Msamanga, W. Fawzi, B. Renjifo, and M. Essex.2006. Transmission of cell-free and cell-associated

HIV-1 through breast-feeding. J. Acquir. Immune Defic. Syndr.41:93–99.

29.Koziel, H., S. Kim, C. Reardon, X. Li, R. Garland, P. Pinkston, and H. Kornfeld.1999. Enhanced in vivo human immunodeficiency virus-1 replica-tion in the lungs of human immunodeficiency virus-infected persons with

Pneumocystis carinii pneumonia. Am. J. Respir. Crit. Care Med.160:2048–

2055.

30.Kumwenda, N. I., D. R. Hoover, L. M. Mofenson, M. C. Thigpen, G. Kafu-lafula, Q. Li, L. Mipando, K. Nkanaunena, T. Mebrahtu, M. Bulterys, M. G. Fowler, and T. E. Taha.2008. Extended antiretroviral prophylaxis to reduce

breast-milk HIV-1 transmission. N. Engl. J. Med.359:119–129.

31.Lee, E. J., R. Kantor, L. Zijenah, W. Sheldon, L. Emel, P. Mateta, E. Johnston, J. Wells, A. K. Shetty, H. Coovadia, Y. Maldonado, S. A. Jones, L. M. Mofenson, C. H. Contag, M. Bassett, and D. A. Katzenstein.2005. Breast-milk shedding of drug-resistant HIV-1 subtype C in women exposed

to single-dose nevirapine. J. Infect. Dis.192:1260–1264.

32.Liu, S.-L., A. G. Rodrigo, R. Shankarappa, G. H. Learn, L. Hsu, O. Davidov, L. P. Zhao, and J. I. Mullins.1996. HIV quasispecies and resampling.

Science273:415–416.

33.Liu, S. L., T. Schacker, L. Musey, D. Shriner, M. J. McElrath, L. Corey, and J. I. Mullins.1997. Divergent patterns of progression to AIDS after infection from the same source: human immunodeficiency virus type 1 evolution and

antiviral responses. J. Virol.71:4284–4295.

34.Maddison, D. R., and W. P. Maddison.2000. MacClade 4: analysis of phy-logeny and character evolution. Sinauer Associates, Inc., Sunderland, MA. 35.Mohri, H., A. S. Perelson, K. Tung, R. M. Ribeiro, B. Ramratnam, M. Markowitz, R. Kost, A. Hurley, L. Weinberger, D. Cesar, M. K. Hellerstein, and D. D. Ho.2001. Increased turnover of T lymphocytes in HIV-1 infection

and its reduction by antiretroviral therapy. J. Exp. Med.194:1277–1287.

36.Morton, J. A.1994. The clinical usefulness of breast milk sodium in the

assessment of lactogenesis. Pediatrics93:802–806.

37.Nakata, K., W. N. Rom, Y. Honda, R. Condos, S. Kanegasaki, Y. Cao, and M. Weiden.1997. Mycobacterium tuberculosis enhances human

immunodefi-ciency virus-1 replication in the lung. Am. J. Respir. Crit. Care Med.155:

996–1003.

38.Nduati, R., G. John, D. Mbori-Ngacha, B. Richardson, J. Overbaugh, A. Mwatha, J. Ndinya-Achola, J. Bwayo, F. E. Onyango, J. Hughes, and J. Kreiss.2000. Effect of breastfeeding and formula feeding on transmission of

HIV-1: a randomized clinical trial. JAMA283:1167–1174.

39.Orenstein, J. M., C. Fox, and S. M. Wahl.1997. Macrophages as a source of

HIV during opportunistic infections. Science276:1857–1861.

40.Palombi, L., M. C. Marazzi, A. Voetberg, and N. A. Magid.2007. Treatment acceleration program and the experience of the DREAM program in

pre-vention of mother-to-child transmission of HIV. AIDS21(Suppl. 4):S65–

S71.

41.Parker, J., A. Rambaut, and O. G. Pybus.2008. Correlating viral phenotypes with phylogeny: accounting for phylogenetic uncertainty. Infect. Genet. Evol. 8:239–246.

42.Permar, S. R., H. H. Kang, A. B. Wilks, L. V. Mach, A. Carville, K. G. Mansfield, G. H. Learn, B. H. Hahn, and N. L. Letvin.2010. Local replica-tion of simian immunodeficiency virus in the breast milk compartment of

chronically infected, lactating rhesus monkeys. Retrovirology7:7.

43.Pillay, K., A. Coutsoudis, D. York, L. Kuhn, and H. M. Coovadia.2000. Cell-free virus in breast milk of HIV-1-seropositive women. J. Acquir.

Im-mune Defic. Syndr.24:330–336.

44.Poss, M., A. G. Rodrigo, J. J. Gosink, G. H. Learn, D. de Vange Panteleeff, H. L. Martin, Jr., J. Bwayo, J. K. Kreiss, and J. Overbaugh.1998. Evolution of envelope sequences from the genital tract and peripheral blood of women

infected with clade A human immunodeficiency virus type 1. J. Virol.72:

8240–8251.

45.Rodrigo, A. G., P. C. Goracke, K. Rowhanian, and J. I. Mullins.1997. Quantitation of target molecules from polymerase chain reaction-based

lim-iting dilution assays. AIDS Res. Hum. Retroviruses13:737–742.

46.Rousseau, C. M., R. W. Nduati, B. A. Richardson, M. S. Steele, G. C. John-Stewart, D. A. Mbori-Ngacha, J. K. Kreiss, and J. Overbaugh.2003. Longitudinal analysis of human immunodeficiency virus type 1 RNA in breast milk and of its relationship to infant infection and maternal disease.

J. Infect. Dis.187:741–747.

47.Semba, R. D., N. Kumwenda, D. R. Hoover, T. E. Taha, T. C. Quinn, L. Mtimavalye, R. J. Biggar, R. Broadhead, P. G. Miotti, L. J. Sokoll, L. van der Hoeven, and J. D. Chiphangwi.1999. Human immunodeficiency virus load in breast milk, mastitis, and mother-to-child transmission of human

immuno-deficiency virus type 1. J. Infect. Dis.180:93–98.

48.Shankarappa, R., J. B. Margolick, S. J. Gange, A. G. Rodrigo, D. Upchurch, H. Farzadegan, P. Gupta, C. R. Rinaldo, G. H. Learn, X. He, X. L. Huang, and J. I. Mullins.1999. Consistent viral evolutionary changes associated with the progression of human immunodeficiency virus type 1 infection. J. Virol. 73:10489–10502.

49.Slatkin, M., and W. P. Maddison.1989. A cladistic measure of gene flow

inferred from the phylogenies of alleles. Genetics123:603–613.

50.Strain, M. C., S. Letendre, S. K. Pillai, T. Russell, C. C. Ignacio, H. F. Gunthard, B. Good, D. M. Smith, S. M. Wolinsky, M. Furtado, J. Marquie-Beck, J. Durelle, I. Grant, D. D. Richman, T. Marcotte, J. A. McCutchan, R. J. Ellis, and J. K. Wong.2005. Genetic composition of human immuno-deficiency virus type 1 in cerebrospinal fluid and blood without treatment

and during failing antiretroviral therapy. J. Virol.79:1772–1788.

51.Thior, I., S. Lockman, L. M. Smeaton, R. L. Shapiro, C. Wester, S. J. Heymann, P. B. Gilbert, L. Stevens, T. Peter, S. Kim, E. van Widenfelt, C. Moffat, P. Ndase, P. Arimi, P. Kebaabetswe, P. Mazonde, J. Makhema, K. McIntosh, V. Novitsky, T. H. Lee, R. Marlink, S. Lagakos, and M. Essex. 2006. Breastfeeding plus infant zidovudine prophylaxis for 6 months versus formula feeding plus infant zidovudine for 1 month to reduce mother-to-child HIV transmission in Botswana. A randomized trial: the Mashi Study. JAMA296:794–805.

52.Thompson, J. D., D. G. Higgins, and T. J. Gibson.1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice.

Nucleic Acids Res.22:4673–4680.

53.Tobin, N. H., G. H. Learn, S. E. Holte, Y. Wang, A. J. Melvin, J. L. McK-ernan, D. Pawluk, K. M. Mohan, P. F. Lewis, J. I. Mullins, and L. M. Frenkel.2005. Evidence that low-level viremias during effective highly active antiretroviral therapy result from two processes: expression of archival virus

and replication of virus. J. Virol.79:9625–9634.

54.Unutmaz, D., V. N. KewalRamani, S. Marmon, and D. R. Littman.1999. Cytokine signals are sufficient for HIV-1 infection of resting human T

lym-phocytes. J. Exp. Med.189:1735–1746.

55.Willumsen, J. F., S. M. Filteau, A. Coutsoudis, K. E. Uebel, M. L. Newell, and A. M. Tomkins.2000. Subclinical mastitis as a risk factor for

mother-infant HIV transmission. Adv. Exp. Med. Biol.478:211–223.

56.Zarate, S., S. L. Pond, P. Shapshak, and S. D. Frost.2007. Comparative study of methods for detecting sequence compartmentalization in human

immunodeficiency virus type 1. J. Virol.81:6643–6651.

57.Zhu, T., N. Wang, A. Carr, D. S. Nam, R. Moor-Jankowski, D. A. Cooper, and D. D. Ho.1996. Genetic characterization of human immunodeficiency virus type 1 in blood and genital secretions: evidence for viral

compartmen-talization and selection during sexual transmission. J. Virol.70:3098–3107.

on November 8, 2019 by guest

http://jvi.asm.org/