Molecular detection of antimicrobial resistance genes in E coli isolated from slaughtered commercial chickens in Iran

0
0
5
1 day ago
PDF Preview
Full text
(1)Veterinarni Medicina, 57, 2012 (4): 193–197. Original Paper. Molecular detection of antimicrobial resistance genes in E. coli isolated from slaughtered commercial chickens in Iran H. Momtaz1, E. Rahimi1, S. Moshkelani2 1 2. Faculty of Veterinary Medicine, ShahreKord Branch, Islamic Azad University, ShahreKord, Iran Young Researchers Club, ShahreKord Branch, Islamic Azad University, ShahreKord, Iran. ABSTRACT: This study was carried out to detect the distribution of antibiotic-resistant genes in Escherichia coli isolates from slaughtered commercial chickens in Iran by PCR. The investigated genes included aadA1, tet(A), tet(B), dfrA1, qnrA, aac(3)-IV, sul1, blaSHV, blaCMY, ere(A), catA1 and cmlA. According to biochemical experiments, 57 isolates from 360 chicken meat samples were recognized as E. coli. The distribution of antibiotic-resistance genes in the E. coli isolates included tet(A) and tet(B) (52.63%), dfrA1, qnrA, catA1 and cmlA (36.84%) and sul1 and ere(A) (47.36%), respectively. Nine strains (15.78%) were resistant to a single antimicrobial agent and 11 strains (19.29%) showed resistance to two antimicrobial agents. Multi-resistance which was defined as resistance to three or more tested agents was found in 64.91% of E. coli strains. The results indicate that all isolates harbour one or more of antibiotic resistance genes and that the PCR technique is a fast, practical and appropriate method for determining the presence of antibiotic-resistance genes. Keywords: Escherichia coli; chicken meat; antibiotic-resistance genes; PCR; Iran. There is worldwide concern about the appearance and rise of bacterial resistance to commonly used antibiotics. In this regard, programs for monitoring resistance have been implemented in many countries for the purpose of protecting the health of humans as well as animals (Cizman 2003; Aarestrup 2004; Li et al. 2010). These programs usually monitor indicator bacteria such as Escherichia coli. E. coli is commonly found in human and animal intestinal tracts and, as a result of faecal contamination or contamination during food animal slaughter, is often found in soil, water, and foods. A number of E. coli strains are recognised as important pathogens of Colibacillosis in poultry and some of them can cause severe human diseases such as haemorrhagic colitis and haemolytic uremic syndrome (Riley et al. 1983; Chansiripornchai 2009; Ferens and Hovde 2011). The treatment of illnesses caused by this bacterium often requires antimicrobial therapy. The. decision to use antimicrobial therapy depends on the susceptibility of the microorganism and the pharmacokinetics of the drug for achieving the desired therapeutic concentration at the site of infection and thus clinical efficacy (McKellar et al. 2004). However, veterinary practitioners have a limited choice of antimicrobials for use in the poultry industry, due to antimicrobial resistance issues and human health concerns. Moreover, the repeated and unsuitable use of antibiotics has led to an increasing rate of antimicrobial resistance (Mooljuntee et al. 2010). Antibiotic usage selects for resistance not only in pathogenic bacteria but also in the endogenous flora of exposed individuals or populations. Therefore, the antibiotic selection pressure for resistance in bacteria in poultry is high and consequently, their faecal flora contains a relatively high proportion of resistant bacteria (Piddock, 1996; van den Bogaard and Stobberingh, 1999).. Supported by the Islamic Azad University of ShahreKord Branch in Iran (Grant No. 68982).. 193.

(2) Original Paper. Veterinarni Medicina, 57, 2012 (4): 193–197 formed as described by Fode-Vaughan et al. (2003). Primer design and PCR conditions were optimised for DPCR using recommendations reported previously. The PCR conditions for amplification of stx1 and stx2 were those used for pmoA.. Integrons are important players in the dissemination of antimicrobial resistance among Gramnegative bacteria. Integrons are genetic structures able to capture, excise and express genes, frequently included in mobile elements such as plasmids, that allow their dissemination among bacteria (Fluit and Schmitz 2004). Recently, molecular techniques, especially polymerase chain reaction (PCR), have been widely used to study antimicrobial resistance genes. Due to the excessive use of antibiotics in the poultry industry in Iran, the purpose of this study was to determine antimicrobial resistance patterns in E. coli isolated from slaughtered Iranian commercial chickens.. E. coli were subcultured overnight in LuriaBertani broth (Merck, Germany) and genomic DNA was extracted using a Genomic DNA purification kit (Fermentas, Germany) according to the manufacturer’s instructions.. MATERIAL AND METHODS. Primers and PCR assay. Sample collection and identification of E. coli. The presence of genes associated with resistance to streptomycin (aadA1), tetracycline [tet(A), tet(B)], trimethoprim (dfrA1), quinolones (qnr), gentamicin [aac(3)-IV], sulfonamides (sul1), beta-lactams (blaSHV, blaCMY), erythromycin [ere(A)] and chloramphenicol (catA1, cmlA) were determined by PCR and the set of primers used for each gene is shown in Table 1. PCR reactions were performed in a total volume of 25 µl, including 1.5mM MgCl 2 , 50mM KCl, 10mM Tris-HCl (pH 9.0), 0.1% Triton X-100, 200 µm of each dNTP (Fermentas), 1 µm primers, 1 IU of Taq DNA polymerase (Fermentas), and 5 µl (40–260 ng/µl) of DNA. Amplification reactions were carried out using a DNA thermo-cycler (Eppendrof Mastercycler, Eppendorf-Nethel-Hinz GmbH, Hamburg, Germany) as follows: Three min at 95 °C, 35 cycles each consisting of 1 min at 94 °C, 90 s at ~55 °C (show in Table 1) and 1 min at 72 °C, followed by a final extension step of 10 min at 72 °C. Amplified samples were analyzed by electrophoresis in 1.5% agarose gel and stained by ethidium bromide. A molecular weight marker with 100 bp increments (100 bp DNA ladder, Fermentas) was used as a size standard. Strains of E. coli O157:K88ac:H19, CAPM 5933 and E. coli O159:H20, CAPM 6006 were used as positive controls.. In this study, a total of 360 chicken meat samples were collected randomly from July to September 2010 at the Shahrekord abattoir (located in Chaharmahal va Bakhtiari province, Iran). Before collecting chicken muscle meat samples, the external surfaces were disinfected with 70% alcohol to minimize surface contamination. Using sterile scissors and tissue forceps, pieces of the muscles were collected separately into sterile bags and transported in a cooled box for further processing. The surfaces of chicken muscles were seared with a hot spatula, incised and cultured on 5% sheep blood and MacConkey agar (Merck, Germany) and incubated for 18 to 24 h at 37 °C. Colonies with the typical colour and appearance of E. coli were picked and streaked again on blood agar plates and re-streaked on EMB agar (Merck, Germany). Green metallic sheen isolates were considered to be E. coli and the presumptive colonies were biochemically tested for growth on triple sugar iron agar (TSI) and lysine iron agar (LIA), and for oxidative/fermentative degradation of glucose, citrate utilization, urease production, indol fermentation, tryptophan degradation, glucose degradation (methyl red test) and motility. The E. coli isolates were stored in tryptic soy broth (Merck, Germany) with 15% glycerol at –20 °C (Mooljuntee et al. 2010). Colony confirming was performed using molecular methods (PCR). Molecular confirmation of clones was determined according to the 16S rRNA gene region from E. coli described by Sabat et al. (2000) and identification of E. coli O157:H7 isolates was per194. DNA extraction. Antimicrobial susceptibility testing Antimicrobial susceptibility testing was performed by the Kirby-Bauer disc diffusion method using Mueller-Hinton agar (HiMedia Laboratories, Mumbai, India, MV1084), according to the Clinical.

(3) Veterinarni Medicina, 57, 2012 (4): 193–197. Original Paper. Table 1. Escherichia coli antimicrobial resistant genes and primer sequences used for PCR identification Antimicrobial agent. Resistance gene. Size (bp). Annealing temperature (°C). References. Streptomycin. aadA1. (F) TATCCAGCTAAGCGCGAACT (R) ATTTGCCGACTACCTTGGTC. 447. 58. Van et al. 2008. Gentamicin. aac(3)-IV. (F) CTTCAGGATGGCAAGTTGGT (R) TCATCTCGTTCTCCGCTCAT. 286. 55. Van et al. 2008. Sulfonamide. sul1. (F) TTCGGCATTCTGAATCTCAC (R) ATGATCTAACCCTCGGTCTC. 822. 47. Van et al. 2008. blaSHV. (F) TCGCCTGTGTATTATCTCCC (R) CGCAGATAAATCACCACAATG. 768. 52. Van et al. 2008. blaCMY. (F) TGGCCAGAACTGACAGGCAAA (R) TTTCTCCTGAACGTGGCTGGC. 462. 47. Van et al. 2008. ere(A). (F) GCCGGTGCTCATGAACTTGAG (R) CGACTCTATTCGATCAGAGGC. 419. 52. Van et al. 2008. catA1. (F) AGTTGCTCAATGTACCTATAACC (R) TTGTAATTCATTAAGCATTCTGCC. 547. 55. Van et al. 2008. cmlA. (F) CCGCCACGGTGTTGTTGTTATC (R) CACCTTGCCTGCCCATCATTAG. 698. 55. Van et al. 2008. tet(A). (F) GGTTCACTCGAACGACGTCA (R) CTGTCCGACAAGTTGCATGA. 577. 57. Randall et al. 2004. tet(B). (F) CCTCAGCTTCTCAACGCGTG (R) GCACCTTGCTGATGACTCTT. 634. 56. Randall et al. 2004. Trimethoprim. dfrA1. (F) GGAGTGCCAAAGGTGAACAGC (R) GAGGCGAAGTCTTGGGTAAAAAC. 367. 45. Toro et al. 2005. Quinolones. qnrA. (F) GGGTATGGATATTATTGATAAAG (R) CTAATCCGGCAGCACTATTTA. 670. 50. Mammeri et al. 2005. Beta-lactams. Erythromycin Chloramphenicol. Tetracycline. Sequence. and Laboratory Standards Institute guidelines (Anonymous 2006). The antimicrobial agents tested and their corresponding concentrations were as follows: sulfamethoxazol (25 µg/disk), trimethoprim (5 µg/disk), chloramphenicol (30 µg/disk), enrofloxacin (5 µg/disk), tetracycline (30 µg/disk), gentamycin (10 µg/disk), cephalothin (30 µg/disk), ampicillin (10 µg /disk), and streptomycin (10 µg/disk). After incubating the inoculated plates aerobically at 37 °C for 18 to 24 h, the susceptibility of the E. coli isolates to each antimicrobial agent was measured and the results were interpreted in accordance with criteria provided by CLSI (Anonymous 2006). E. coli ATCC 25922 was used as quality control organisms in antimicrobial susceptibility determination.. RESULTS AND DISCUSSION Out of 360 specimens collected, 57 (15.8%) E. coli isolates were identified. None of the E. coli strain isolates was identified as E. coli O157:H7.. The resistance to tetracycline was found in 52.6% and to both sulfonamides and erythromycin in 47.4% of isolates. Our results showed that the genes qnrA, dfrA1 and catA1 genes were identified in 36.8% of isolates. No genes known to be associated with resistance to streptomycin, cephalothin and ampicillin were detected (Table 2). Table 3 summarizes the resistance pattern of E. coli isolates to nine antimicrobial agents tested in this study. Of the 57 E. coli isolates tested, all were resistant to one or more antimicrobial agent. Resistance to tetracycline was the most common finding (91.2%), followed by resistance to sulfamethoxazol (45.6%), chloramphenicol and trimethoprim (29.8%). All E. coli isolates were susceptible to streptomycin, cephalothin, gentamicin and ampicillin. The mechanism of spread of antibiotic resistance from food animals to humans remains controversial. However, colonisation of the intestinal tract with resistant E. coli from chickens has been shown in human volunteers (Linton et al. 1977) and resistance to the same drugs has been described previously 195.

(4) Original Paper. Veterinarni Medicina, 57, 2012 (4): 193–197. Table 2. Distribution of antibiotic resistance genes in strains of E. coli isolated from chickens Gene. aadA1 tet(A). Presence. 0. tet(B). dfrA1. qnrA. aac(3)-IV. sul1. 0. 27 (47.36%). 30 30 21 21 (53.63%) (53.63%) (36.84%) (36.84%). in programs undertaken in different countries that monitor bacterial resistance in veterinary medicine (Heuer and Hammerun 2005; Asai et al. 2006). E. coli isolates are frequent contaminants of food of animal origin, and in this study, this microorganism was recovered from 57 tested poultry meat samples; in addition, most of the isolates showed a multi-resistant phenotype. The presence of genes that confer resistance to some antimicrobial agents (erythromycin, sulphonamides, chloramphenicol and tetracycline) were especially high (36 to 52%), indicating that E. coli isolates originating from meat could be a reservoir of antimicrobial resistance. In a similar study carried out in Thailand, all isolated E. coli from Thai broilers were found to be resistant to tetracycline, ampicillin and erythromycin in agar disk diffusion assays and these resistance properties were associated with a 90%, 93.3% and 73.3% prevalence of the tet(A), blaCMY and ere(A) genes, respectively. Lower resistance in Thai broilers was observed to cephalothin (73.3%) and sulphonamide + trimethoprim (26.7%) and these resistances were in 86.4% of cases associated with blaSHV, and in 100% of cases with the sul1 and dfrA5 genes (Mooljuntee et al. 2010). The percentage of faecal samples containing resistant E. coli and the proportion of resistant faecal E. coli were determined in three different poultry populations: broilers and turkeys commonly given antibiotics, and laying hens treated with antibiotics relatively infrequently. The results of this study documented Table 3. Antimicrobial resistance profiles of Escherichia coli isolated from chickens Antimicrobial agent. Escherichia coli (n = 57). Streptomycin. –. Tetracycline. 52 (91.22%). Trimethoprim. 17 (29.82%). Enrofloxacin. 18 (31.57%). Gentamicin Sulfamethoxazol. – 26 (45.61%). Cephalothin. –. Ampicillin. –. Chloramphenicol. 196. 17 (29.82%). blaSHV blaCMY 0. 0. ere(A). catA1. cmlA. 27 21 21 (47.36%) (36.84%) (36.84%). resistance to nearly all tested antibiotics in faecal E. coli of turkey and broilers farmers, and a lower prevalence of antibiotic-resistant E. coli in laying hen farmers (van den Bogaard et al. 2001). Lietzau et al. (2006) reported 15.7% and 19.4% prevalence of ampicillin resistance in women and men, respectively, and 10% and 15% of all isolates were resistant to cotrimoxazole and doxycycline, respectively. In agreement with the above mentioned studies, our results confirmed a large percentage of antibiotic resistance in indicator strains of E. coli isolated from commercial chickens in Iran. Thus, we conclude that these commercial chickens represent an important reservoir of resistance genes.. Acknowledgements We thank, Dr. M. Gholami and Dr. E. Fathi at the Poultry Diseases Research Center of the Islamic Azad University of Shahrekord for their cooperation. This work was supported by the Islamic Azad University, Shahrekord Branch in Iran.. References Aarestrup FM (2004): Monitoring of antimicrobial resistance among food animals: principles and limitations. Journal of Veterinary Medicine B – Infectious Diseases and Veterinary Public Health 51, 380–388. Anonymous (2006): Performance Standards for Antimicrobial Disk Susceptibility Tests, Approved standardNinth Edition (M2-A9). Clinical and Laboratory Standards Institute, Wayne, PA. Asai T, Esaki H, Kojima A, Ishihara K, Tamura Y, Takahashi T (2006): Antimicrobial resistance in Salmonella isolates from apparently healthy food-producing animal from 2000 to 2003: the first stage of Japanese veterinary antimicrobial resistance monitoring (JVARM). Journal of Veterinary Medical Science 68, 881–884. Chansiripornchai N (2009): Comparative efficacy of enrofloxacin and oxytetracycline by different administration methods in broilers after experimental infection with avian pathogenic Escherichia coli. Thai Journal of Veterinary Medicine 39, 231–236..

(5) Veterinarni Medicina, 57, 2012 (4): 193–197 Cizman M (2003): The use and resistance to antibiotics in the community. International Journal of Antimicrobial Agents 21, 297–307. Ferens WA, Hovde CJ (2011): Escherichia coli O157:H7: animal reservoir and sources of human infection. Foodborne Pathogens and Disease 8, 465–485. Fluit AC, Schmitz FJ (2004): Resistance integrons and super-integrons. Clinical Microbiology and Infection 10, 272–288. Fode-Vaughan KA, Maki JS, Benson JA, Collins ML (2003): Direct PCR detection of Escherichia coli O157:H7. Letters in Applied Microbiology 37, 239–243. Heuer O, Hammerun A (2005): Use of Antimicrobial Agents and Occurrence of Antimicrobial Resistance in Bacteria from Food Animals, Food and Humans in Denmark. Staten’s Serum Institute, Danish Veterinary and Food Administration, Danish Medicines Agency, Danish Institute for Food and Veterinary Research, Copenhagen, Denmark. 57 pp. Li D, Liu B, Chen M, Guo D, Guo X, Liu F, Feng L, Wang L (2010): A multiplex PCR method to detect 14 Escherichia coli serogroups associated with urinary tract infections. Journal of Microbiological Methods 82, 71–77. Lietzau S, Raum E, Von Baum H, Marre R, Brenner H (2006): Clustering of antibiotic resistance of E. coli in couples: suggestion for a major role of conjugal transmission. BMC Infectious Diseases 6, 119. Linton AH, Howe K, Bennett PM, Richmond MH, Whiteside EJ (1977): The colonization of the human gut by antibiotic resistant Escherichia coli from chickens. Journal of Applied Bacteriology 43, 465–469. Mammeri H, van de Loo M, Poirel L, Martinez-Martinez L, Nordmann P (2005): Emergence of plasmid-mediated quinolone resistance in Escherichia coli in Europe. Antimicrobial Agents and Chemotherapy 49, 71–76. Mckellar QA, Sanchez Bruni SF, Jones DG (2004): Pharmacokinetic/pharmacodynamic relationships of antimicrobial drugs used in veterinary medicine. Journal of Veterinary Pharmacology and Therapeutics 27, 503–514. Mooljuntee S, Chansiripornchai P, Chansiripornchai N (2010): Prevalence of the cellular and molecular antimi-. Original Paper crobial resistance against E. coli isolated from Thai broilers. Thai Journal of Veterinary Medicine 40, 311–315. Piddock LJ (1996): Does the use of antimicrobial agents in veterinary medicine and animal husbandry select antibiotic-resistant bacteria that infect man and compromise antimicrobial chemotherapy? Journal of Antimicrobial Chemotherapy 38, 1–3. Randall LP, Cooles SW, Osborn MK, Piddock LJ, Woodward MJ (2004): Antibiotic resistance genes, integrons and multiple antibiotic resistance in thirty-five serotypes of Salmonella enterica isolated from humans and animals in the UK. Journal of Antimicrobial Chemotherapy 53, 208–216. Riley LW, Remis RS, Helgerson SD, Mcgee HB, Wells JG, Davis BR, Hebert RJ, Olcott ES, Johnson LM, Hargrett NT, Blake PA, Cohen ML (1983): Hemorrhagic colitis associated with a rare Escherichia coli serotype. New England Journal of Medicine 308, 681–685. Sabat G, Rose P, Hickey WJ, Harkin JM (2000): Selective and sensitive method for PCR amplification of Escherichia coli 16S rRNA genes in soil. Applied and Environmental Microbiology 66, 844–849. Toro CS, Farfan M, Contreras I, Flores O, Navarro N, Mora GC, Prado V (2005): Genetic analysis of antibiotic-resistance determinants in multidrug-resistant Shigella strains isolated from Chilean children. Epidemiology and Infection 133, 81–86. Van TT, Chin J, Chapman T, Tran LT, Coloe PJ (2008): Safety of raw meat and shellfish in Vietnam: an analysis of Escherichia coli isolations for antibiotic resistance and virulence genes. International Journal of Food Microbiology 124, 217–223. Van den Bogaard AE, Stobberingh EE (1999): Antibiotic usage in animals: impact on bacterial resistance and public health. Drugs 58, 589–607. Van den Bogaard AE, London N, Driessen C, Stobberingh EE (2001): Antibiotic resistance of fecal Escherichia coli in poultry, poultry farmers and poultry slaughterers. Journal of Antimicrobial Chemotherapy 47, 763–771. Received: 2011–09–15 Accepted after corrections: 2012–04–25. Corresponding Author: Hassan Momtaz, Islamic Azad University, Faculty of Veterinary Medicine, ShahreKord Branch, Department of Microbiology, P.O. Box 166, ShahreKord, Iran Tel./Fax +98 381 336 1064, E-mail: hamomtaz@yahoo.com; hamomtaz@iaushk.ac.ir. 197.

(6)

New documents

Nonhumans in participatory design
Research and practice concerned with participatory design mostly focuses on human participants, however nonhumans also participate in the design process and can play a significant role
4 Hex­yl­oxy 3 meth­oxy­benzaldehyde
Data collection: X-AREA Stoe & Cie, 2001; cell refinement: XAREA; data reduction: X-AREA; programs used to solve structure: SHELXS97 Sheldrick, 2008; programs used to refine structure:
(E) 3 [4 (Pent­yl­oxy)phen­yl] 1 phenyl­prop 2 en 1 one
Data collection: X-AREA Stoe & Cie, 2001; cell refinement: XAREA; data reduction: X-AREA; programs used to solve structure: SHELXS97 Sheldrick, 2008; programs used to refine structure:
Science fiction and science futures: Considering the role of fictions in public engagement and science communication work
Emphasizing fiction as a method for engaging with and mapping the influence of possible futures, this panel discussed the role of science fiction historically, the role of science
2,2′ Di­meth­oxy 4,4′ [rel (2R,3S) 2,3 di­methylbutane 1,4 diyl]diphenol
Data collection: XSCANS Siemens, 1996; cell refinement: XSCANS; data reduction: XSCANS; programs used to solve structure: SHELXS97 Sheldrick, 2008; programs used to refine structure:
1,3 Dihydr­­oxy 2 (hy­droxy­meth­yl)propan 2 aminium 2,2 di­chloro­acetate
Data collection: CrystalClear Rigaku, 2005; cell refinement: CrystalClear; data reduction: CrystalClear; programs used to solve structure: SHELXS97 Sheldrick, 2008; programs used to
Payments for Ecosystem Services in Sustainable Mangrove Forest Management in Bangladesh
64 Another example is the USAID funded Integrated Protected Area Co-management project IPAC,65 managed by the Forest Department, which seeks to engage local stakeholders through a
1 [(3 Methyl­piperidin 1 yl)(phen­yl)meth­yl] 2 naphthol
Data collection: CrystalClear Rigaku, 2005; cell refinement: CrystalClear; data reduction: CrystalClear; programs used to solve structure: SHELXS97 Sheldrick, 2008; programs used to
'Eating disorders are not about food, they're about life': Client perspectives on anorexia nervosa treatment
In addition it is recommended that inpatient care, when it is required, should include psychological treatment: ‘which has a focus both on eating behaviour and attitudes to weight and
4 (Di­methyl­amino)pyridinium tribromide: whole mol­ecule disorder of cation and anion
Data collection: APEX2 Bruker, 2008; cell refinement: SAINT Bruker, 2008; data reduction: SAINT; programs used to solve structure: SHELXS97 Sheldrick, 2008; programs used to refine

Related documents

History in the Making: A History of the People of the United States of America to 1877
Grant defeated Horatio Seymour in the presidential race february 1869 Fifteenth Amendment passed by Congress December 1869 Grant encouraged Congress to readmit
0
13
864
The Ideologies of Lived Space in Literary Texts, Ancient and Modern
ideologies.lived.spaces.book Page 229 Saturday, August 17, 2013 11:47 AM 229 Writing space, living space Time, agency and place relations in Herodotus’s Histories1
0
5
261
Antibiotic resistance patterns of Staphylococcus aureus, Escherichia coli, Salmonella, Shigella and Vibrio isolated from chicken, pork, buffalo and goat meat in eastern Nepal
Antibiotic resistance patterns of Staphylococcus aureus, Escherichia coli, Salmonella, Shigella and Vibrio isolated from chicken, pork, buffalo and goat meat in eastern Nepal
0
0
6
Antimicrobial resistance genes in Salmonella and Escherichia coli isolates from chicken droppings in Nairobi, Kenya
Different resistance patterns of Escherichia coli and Salmonella isolates to antibiotics tested in the current study are in consistence with previous related studies on antimicrobial
0
0
6
Emerging of antimicrobial resistance in staphylococci isolated from clinical and food samples in Algeria
The aim of this study was to determine phenotypic antimicrobial resistance and associated genes of staphylococci isolates from clinical and food samples in Algeria... Main text Methods
0
1
7
Imipenem resistance in clinical Escherichia coli from Qom, Iran
In this study, the first evaluation of MBL genes, blaIMP and blaVIM, in Escherichia coli resistant to imipenem isolated from urine and blood specimens in Qom, Iran is described.. Three
0
0
5
Biofilm and fluoroquinolone resistance of canine Escherichia coli uropathogenic isolates
coli isolates from dog urinary tract infections, and its association with virulence and β- lactamase antimicrobial resistance genes, and with 2nd generation quinolones resistance.. coli
0
0
5
Diarrhoeagenic Escherichia coli in mother child Pairs in Ile Ife, South Western Nigeria
Antimicrobial resistance patterns of diarrhoeagenic Escherichia coli DEC isolates and Non Diarrhoeagenic Escherichia coli non-DEC from mother and child pairs.. The DEC n = 125 isolates
0
0
9
Geographical variation in antibiotic resistance profiles of Escherichia coli isolated from swine, poultry, beef and dairy cattle farm water retention ponds in Florida
Geographical variation in antibiotic resistance profiles of Escherichia coli isolated from swine, poultry, beef and dairy cattle farm water retention ponds in Florida1 S.. Braun5 and
0
0
8
Molecular epidemiological studies of Campylobacter isolated from different sources in New Zealand between 2005 and 2015 : a thesis presented in partial fulfilment of the requirements for the degree of Doctor of Philosophy at Massey University, Manawatu, N
coli isolates collected in the Manawatu region of New Zealand from clinical cases, fresh poultry meat, ruminant feces, and environmental water sources, between 2005 and 2014, to study
0
0
192
Challenges and Opportunities in the Use of Marketing Tools and the Promotion of Non Wood Forest Products Based Small and Medium Enterprises in the South East Europe
This paper describes the challenges and opportunities related to the use of marketing tools for improving business of the small and medium enterprises SMEs dealing with non-wood forest
0
0
10
Future of the Main Important Forest Tree Species in Serbia from the Climate Change Perspective
Distribution data of the nine most abundant tree species in Serbia European beech, Turkey oak, Sessile oak, Hungarian oak, Pedunculate oak, Norway spruce, Silver fir, Black and Scots
0
0
8
Assessment of Forest Damage in Croatia Caused by Natural Hazards in 2014
Estimate of the total amount of damage Estimate of the total amount of damage loss of value on timber volume When estimating the damage of natural disasters in the forests, the areas
0
0
16
Effects of a species specific probiotic formulation on multiresistant Escherichia coli isolates from the gut of veal calves
ABSTRACT: In this study, 254 Escherichia coli isolates from faecal samples of veal calves were evaluated for antimicrobial susceptibility using the disk diffusion method.. During the
0
0
7
 Survival of Mycobacterium avium subsp hominissuis in homemade smoked pork sausages
hominissuis MAH in artificially contaminated homemade smoked sausages prepared from pork meat according to traditional recipes, the effect of storage of such sausages at –20°C for three
0
0
7
Show more