1620 LETTERS TO THE EDITOR
used forpreparation of slides for theCMV-Agassay(2 x
105
cells) and the number of cells used forinoculating
the shell vials cannot be made. Although others have used similar inoculationtechniquesfor theSVA-IFA, recentlyBuller etal. reported a greater yield in SVA-IFA by using a standard inoculum to avoid toxicity (1). We have sinceadopted
this method. The lowercentrifugationtime andtemperatures used in ourlaboratoryareinkeeping
with those in otherpublished reports,including reference textswhich recommend centrifug-ing at room temperature (1, 3, 5, 11), and are those recom-mendedby the manufacturer(Syva).Following
centrifugation, shellvials were incubatedat36 ± 1°C.Therefore,
it isunlikely that our methodology for processing the SVA-IFA would accountfor the difference insensitivitybetween the two assays. Why Lipson et al. have found no difference between the detection rateof CMV inbloodusingtheCMV-Agassayand that using the SVA-IFA is notclear, but we look forward to reading their article. As morestudiescomparingthese assays are reported, greater insightinto their optimalutilizationwill begained.REFERENCES
1. Buller,R. S., T. C.Bailey,N. A.Ettinger,M.Keener,T.Langlois, J. P. Miller, and G. A. Storch. 1992. Useofamodifiedshell vial techniquetoquantitatecytomegalovirus viremiainapopulationof solid-organ transplant recipients.J.Clin.Microbiol.30:2620-2624. 2. Erice,A., M. A.Holm,P.C.Gill,S.Henry,C.L.Dirksen, D. L. Dunn,R. P.Hillam,and H. H.Balfour,Jr. 1992.Cytomegalovirus (CMV) antigenemia assayis moresensitivethan shell vial cultures forrapid detection of CMV inpolymorphonuclearblood leuko-cytes. J. Clin.Microbiol. 30:2822-2825.
3. Gleaves, C. A., D. A. Hursh, D. H. Rice, and J. D. Myers. 1989. Detectionofcytomegalovirus from clinicalspecimensin centrifu-gation culture by in situ DNA hybridization and monoclonal antibody staining.J.Clin.Microbiol.27:21-23.
4. Howell,C.L., M. J.Miller,and W. J.Martin.1979.Comparisonof
ratesof virusisolationfromleukocyte populationsseparatedfrom blood by conventional and Ficoll-Paque/Macrodex methods. J. Clin. Microbiol.10:533-537.
5. Landry,M.L.,and D.Ferguson.1993.Comparisonofquantitative
cytomegalovirus antigenemia assay with culture methods and correlation with clinicaldisease.J.Clin.Microbiol.31:2851-2856. 6. Leland, D. S., R. L. Hansing, and L. V. French. 1989. Clinical experiencewithcytomegalovirusisolationusingconventional cell cultures and early antigen detection in centrifugation-enhanced shell vialculture. J. Clin. Microbiol.27:1159-1162.
7. Miller, H.,E.Rossier,R.Milk,and C.Thomas. 1991.Prospective study ofcytomegalovirus antigenemia in allograft recipients. J. Clin. Microbiol.29:1054-1055.
8. Paya, C. V., A. D. Wold, and T. F. Smith. 1987. Detection of cytomegalovirus infections inspecimensother than urineby the shell vialassayandconventional tube cell culture. J. Clin. Micro-biol.25:755-757.
9. vanderBij,W.R.,J.Schirm,R.Torensma,W. J.vanSon,A.D. Tegzess,andT. H. The.1988. Comparisonbetween viremiaand antigenemia fordetection ofcytomegalovirus inblood. J. Clin. Microbiol. 26:2531-2535.
10. vanderBij, W.,R.Torensma,W.J.vanSon, J. Anema,J.Schirm, A. M.Tegzess,andT. H.The. 1988. Rapidimmunodiagnosisof activecytomegalovirusinfectionbymonoclonalantibodystaining ofbloodleucocytes.J. Med.Virol.25:179-188.
11. Wiedbrauk,D.L.,and S. L. G.Johnston. 1993. General method-ologies,p. 11-17. In D. L.Wiedbrauk and S. L. G. Johnston(ed.), Manual of clinicalvirology. RavenPress,New York.
TonyMazzulli Sandra A. Doveikis Martin S. Hirsch InfectiousDisease Unit Department ofMedicine Harvard Medical School MassachusettsGeneralHospital
Boston, Massachusetts02114
Evaluation of
Clearview Chlamydia
Previous studies (1, 4, 9, 11-13) of the performance of Clearview Chlamydia with both low- and high-prevalence populations have proved the test to show excellent perfor-mance inclinical settings. These data aresummarized in Table 1. Inthese independent, peer-reviewed evaluations, the sensi-tivityof theClearview test ranged from 79.0 to 93.5% and the specificityranged from 98.0 to 100%.
However, results of a study by Kluytmans et al. (5) involving
TABLE 1. Performance of ClearviewChlamydiaversus that of cell culturein previously published studies
No.ofspecimens
with thefollowing ClearviewChlamydia Studyno. result by culture Prevalence
(reference) (%)
Positive Negative Sensitivity Specificity
(%) (%
1 (1) 66 310 17.5 93.5 99.0
2
(13)
42 435 8.8 85.7 99.13(9) 34 114 23 79.4 100
4(12) 40 608 6.2 95 98
5 (11) 43 922 4.5 79.0 99.6
6
(4)
47 459 9.3 85.1 98.5724womenattendingasexually transmitted diseases clinic who weretestedforthe presence of chlamydia with Clearview and whose resultswerecomparedwith those by cell cultureshowed that Clearview hada sensitivity of 67.3% (35 of 52 samples) andaspecificityof99.7% (662 of 664 samples). The prevalence ofinfection in women was fairly low at 7.5% but was within the range in these other studies.
Compared with that of cell culture, in the same study the sensitivities of the Magic LiteChlamydia test (Ciba Corning) and a PCR test were also lower than expected, at 48.1 and 77.8%, respectively, with specimens from women. As has happened with Clearview Chlamydia, other workers have reportedmuchhigher sensitivities for these tests (2, 3, 6, 7, 10). Kluytmans et al. also report a confirmatory method for analysis of discordant results. By this technique, the sensitivi-ties of thethree tests in the evaluation were revised to 62.3% forClearview, 50.9% for Magic Lite, and 79.2% for PCR. Note that no confirmatory tests on the Clearview swab could be carried out and no independent assessment of swab quality, e.g.,immunofluorescence, was made.The possible effect of the order of the swabs taken on the Clearview results is not considered. In a previous study (9) six out of seven false-negative results byClearview were from swabs taken
last;
and immunofluorescence slides were alsonegative. Different swabs J.CLIN. MICROBIOL.on May 15, 2020 by guest
http://jcm.asm.org/
Downloaded from
on May 15, 2020 by guest
http://jcm.asm.org/
Downloaded from
on May 15, 2020 by guest
http://jcm.asm.org/
Downloaded from
on May 15, 2020 by guest
http://jcm.asm.org/
Downloaded from
on May 15, 2020 by guest
http://jcm.asm.org/
Downloaded from
on May 15, 2020 by guest
http://jcm.asm.org/
Downloaded from
on May 15, 2020 by guest
http://jcm.asm.org/
Downloaded from
on May 15, 2020 by guest
http://jcm.asm.org/
Downloaded from
on May 15, 2020 by guest
http://jcm.asm.org/
LETTERS TO THE EDITOR 1621
were used in the MagicLite, PCR, and culture tests. By this
newconfirmatory method,onepositive cell culture result was
considered afalse positive andtwo false-negative cellculture resultswere detected.
Kluytmansetal. statethat the otherevaluations whichshow
increasedsensitivities forClearview,Magic Lite, and PCR are
probably caused by variationsin the sensitivityof the reference
method used, i.e., cell culture. As the studies cited report
highersensitivities than thosereportedby Kluytmansetal.,the
unavoidable inference is that the cell culture procedure used
elsewhere is inferior to that of Kluytmans et al. There is no
independent evidence toestablish this. Indeed, Ravaoarinord
and Morriset (8) reported differencesin performancebetween
96-well microtiter plate and 48-well microtiter plate
proce-dures.Also, whileit is often surmisedthat the sensitivityof cell
culture varies, it is frequently assumed that specificity is in
principle and in practice 100%.
Giventhedefinitionof thenewstandardwithin the studyon
which final interpretationswere based, the cellculture
proce-dureused in the Kluytmans etal. study, although high, isless
than 100%. This emphasizes the difficulty of establishing a
universally acceptable "gold standard," given the deficiencies inall the methodsavailable.Inaddition, thecell culture testing
area cannotoften be located near theclinic where the swabs
are taken, with the obvious resulting difficulties in swab
transport andstorage.
REFERENCES
1. Arumainayagam, J. T., R. S. Matthews, S.Uthayakumar, and J. C.
Clay. 1990. Evaluation of a novel solid-phase immunoassay,
Clearview Chlamydia, for the rapid detection of Chlamydia
tra-chomatis.J. Clin. Microbiol. 28:2813-2814.
2. Claas, H.C.,W. J.Melchers,I.H. de Bruijn, M. de Graaf, W. C.
van Dijk, J. Lindeman, and W. G. Quint. 1990. Detection of
Chlamydia trachomatis in clinical specimens by the polymerase chainreaction. Eur. J. Clin. Microbiol. 9:864-868.
3. Claas,H.C.,J.H.T.Wagenvoort,H. G.M.Niesters,T.T.Tio, J.H.vanRijsoort-Vos,and W.G.V.Quint.1991.Diagnosticvalue of the polymerase chain reaction for Chlamydia detection as
determined inafollow-upstudy.J.Clin. Microbiol. 29:42-45. 4. Ferris, D. G., and W. H. Martin. 1992. A comparison of three
rapid chlamydial tests in pregnant and non-pregnant women. J. Fam. Pract.34:593-597.
5. Kluytmans, J.A.J.W.,W. H. F.Goessens,J.W.Mouton,J.H.van
Rijsoort-Vos, H. G. M. Niesters,W.G. V.Quint,L.Habbema,E. Stolz,andJ.H. T.Wagenvoort.1993.Evaluation ofClearviewand
Magic Litetests, polymerasechain reaction, andcellculture for
detection ofChlamydia trachomatis in urogenital specimens. J.
Clin. Microbiol. 31:3204-3210.
6. Neman-Simha, V.,M. C.Delmas-Beauviex,M. Geniaux,and C.
Bebear. 1991. Evaluation ofa chemiluminometric immunoassay
and a direct immunofluorescence test for detecting Chlamydia trachomatis in urogenital specimens. Eur. J. Clin. Microbiol. Infect. Dis. 10:662-665.
7. Ossewaarde,J. M.,M.Rieffe, M.Rozenberg-Arska,P. M.
Ossen-koppele,R. P.Nawrocki,and A. M.vanLoon. 1992.Development and clinical evaluation of a polymerase chain reaction test for
detection ofChlamydia trachomatis. J. Clin. Microbiol.
30:2122-2128.
8. Ravaoarinord, M., and R. Morriset. 1992.Comparative recovery of Chlamydia from endocervical specimens using two types of
plasticmicrotitre plates. Int.J. STD AIDS3:136-137.
9. Ridgway,G.L.,G.Mumtaz,E.Allason-Jones,and J. S.Bingham. 1991. Solidphase immunoassayforChlamydiatrachomatis. Geni-tourin. Med. 67:268.(Letter.)
10. Scieux,C.,A.Bianchi,I.Vassias,R.Menuchy,A.Felten,P. Morel,
and V. Perol. 1992. Evaluation of a new chemiluminometric immunoassay, Magic Lite Chlamydia, for detecting Chlamydia trachomatisantigenfromurogenital specimens.Sex.Transm.Dis. 19:161-164.
11. Skulnick, M., G. W. Small, A. E. Simor, D. E. Low, H. Khosid, S. Fraser, and R. Chua. 1991. Comparison of the Clearview Chla-mydia test, Chlamydiazyme, and cell culture for detection of Chlamydia trachomatis in women with a low prevalence of infec-tion. J. Clin. Microbiol.29:2086-2088.
12. Stratton, N. J., L. Hirsch, F. Harris, L. M. delaMaza, and E. M. Peterson. 1991.Evaluation of the rapid CLEARVIEW Chlamydia testfor direct detection of chlamydiae from cervical specimens. J. Clin.Microbiol. 29:1551-1553.
13. Young, H., A. Moyes, H. Lough,I.W.Smith, J. G. McKenna, and C.Thompson. 1991. Preliminary evaluation of "Clearview Chla-mydia" for the rapid detection of chlamydial antigen in cervical secretions. Genitourin. Med. 67:120-123.
IanDavidson LouiseRoberts UNIPATH
Bedford, United Kingdom Author's Reply
Davidson and Roberts comment on the differences in per-formance ofClearview Chlamydia (CV) with cervical samples in differentstudies. In our evaluation (4), the sensitivity of CV was 62.3%, which is lower than that in other studies (1, 3, 7-10). This could be explained by a difference in the sensitivity of the method of reference used. We concluded that the sensitivity of our cell culture method (CC) was probably higher thanthat of the CC used in the other studies. We do agree that thereis no independent evidence to prove this thesis; however, this possibility could well explain the differences found. To explain the high sensitivity of our CC, the optimal transport and storageconditions and the great amount of attention given toimprovingourCCwerediscussedintheprevious report (4). Itwasalso mentionedthatthesensitivity of CV correlated with the number of inclusions found in CC. For female cervical samples, this correlation is shownin Table 1.If the CC used is less sensitive, for whatever reason, the samples with a low number of inclusions are most likely to be missed first. For example, assume that all 13 samples containing 1 to 5 inclu-sions per well in CCwere missed(Table 1).This would result in a higher sensitivity of 80.0% (32 of 40) and a lower specificityof99.3% (671 of676)forCV,which iscomparable
totheresults found in several of the other studies(3, 7, 8, 10). However, since CC is a highly specific method
(2)
and addi-tional testingconfirmed all butonepositive
CCresult,
the 10 negative CV samples with a positive CC(Table 1)
were considered failures of CV.With regard to failures of CV, Davidson and Roberts comment that CVwas
performed
on aseparatesample.
This samplewas notavailable for furthertesting.
Theoretically,
the failures of CV couldbecausedby
swab-to-swabvariability.
The role ofswab-to-swabvariability
was evaluatedwith our popu-lationpreviously(5)
andwasfoundtobeofminorimportance.
Nevertheless,the
sampling
orderwasreversedhalfway
through
the study to minimize the effect of swab-to-swab
variability.
Davidson and Roberts comment that the sampling order
TABLE 1. Relationshipbetween numberofinclusionsperwellin CCandsensitivityof CV
No.ofsampleswiththe
Inclusions/well followingCVresult: CVsensitivity(%) Positive Negative
1-5 3 10 23.1
6-20 5 3 62.5
>20 27 5 84.4
VOL.32, 1994
on May 15, 2020 by guest
http://jcm.asm.org/
1622 LETTERS TO THE EDITOR
playedanimportant role in another study,by Ridgwayetal. In
thisreport the sampling order was rotated every 25 patients. Two false-negative CV sampleswere found. Wewere unable tofindanymention oftheimportanceof thesamplingorder in thisreport. To evaluate theimportanceof thesampling order,
wereviewed the results inourstudy. Forthe first 372females, the CV sample was taken first. With these 372 samples, 28 CC-positive results with 11 false-negative CV results were
found. For the other 352 females, the sampling order was reversed, and 24CC-positive results with 6 false-negative CV resultswerefound. The difference between thesetwogroupsis
notstatistically signifcant (P> 0.05, Fisher'sexacttest).Also, in a study by Skulnick et al., no significant influence of the
sampling order ontheperformance of CVwasreported (8).
The problem of a well-defined "gold standard" for the
evaluation of diagnostic tests for urogenital C. trachomatis infections is well recognized. Although CC isveryspecific, the
sensitivity is less than 100% (5, 6). This is especiallyaproblem
when tests with a high sensitivity are evaluated. To optimize
the value ofanevaluation, CC shouldbeperformedaswell as
possible. There are two additional possibilities. First, more testscould be included in the evaluation. IfCC isnegative and
twoor moreother testsare positive, thiscan beconsidered a
failure ofCC. Second, analysis of discordant results could be performed by using confirmatoryassays.Inthisevaluation,we
didboth, with the exception ofaconfirmatoryassay onthe CV
sample. Since the sampling orderwasreversed and the
false-negative CV results were equally distributed overboth
sam-pling-order groups, we conclude that this would not have influenced the results significantly.
In this evaluation, the performance of CCwas superior to those of thealternatives. We do admit that CC facilitiesarenot available on alarge scale and that the performance of CC is
often hampered by transport and storage conditions. There-fore, there is a definite need for alternatives. However, one
must bear in mind that if an alternative which misses a
significant number of infected patients is chosen,spread of this diseasewith its serioussequelae may occur.
REFERENCES
I. Arumainayagam, J. T.,R. S. Matthews, S. Uthayakumar,and J. C.
Clay. 1990. Evaluation of a novel solid-phase immunoassay,
Clearview Chlamydia, for the rapid detection of Chlamydia
tra-chomatis.J. Clin. Microbiol. 28:2813-2814.
2. Barnes, R. C. 1989. Laboratory diagnosis of human chlamydial
infections. Clin.Microbiol. Rev.2:119-136.
3. Ferris, D. G., and W. H. Martin. 1992. A comparison of three rapidchiamydial tests in pregnant and non-pregnantwomen. J. Fam. Pract. 34:593-597.
4. Kluytmans, J.A.J. W.,W.H. F.Goessens,J.W.Mouton, J.H. van Rijsoort-Vos,H.G.M. Niesters,W. G. V.Quint,L.Habbema,E. Stolz,andJ.H. T.Wagenvoort.1993.Evaluation ofClearview and Magic Lite Tests, polymerase chain reaction, and cell culture for detection ofChlamydia trachomatis in urogenital specimens. J. Clin. Microbiol. 31:3204-3210.
5. Kluytmans,J.A.J. W.,H.G. M.Niesters,J.W.Mouton,W. G. V. Quint, J.A.J. Ijpelaar, J. H. van Rijsoort-Vos,L.Habbema, E. Stolz,M. F.Michel,andJ.H. T.Wagenvoort.1991. Performance of a nonisotopic DNA probefordetection ofChlamydia
tracho-matis inurogenitalspecimens. J. Clin. Microbiol. 29:2685-2689. 6. Mahony,J. B.,and M. A.Chernesky. 1985.Effect of swabtypeand
storage temperature on the isolation ofChlarnydia trachomatis fromclinical specimens.J. Clin. Microbiol. 22:865-867.
7. Ridgway, G.L.,G.Mumtaz,E.Allason-Jones,andJ.S.Bingham. 1991.Solid phaseimmunoassay forChlamydia trachomatis. Geni-tourin. Med. 67:268. (Letter.)
8. Skulnick, M.,G. W.Small,A. E.Simor,D.E.Low,H.Khosid,S. Fraser, and R.Chua. 1991. Comparison of the Clearview Chla-mydia test, Chlamydiazyme, and cell culture for detection of Chliamydiatrachomatis in women with a lowprevalence of infec-tion. J. Clin. Microbiol.29:2086-2088.
9. Stratton,N.J.,L.Hirsch,F.Harris, L. M. de la Maza, andE. M. Peterson.1991.Evaluation of the rapid CLEARVIEW Chlamydia testfordirect detection ofchlamydiaefromcervical specimens.J. Clin. Microbiol. 29:1551-1553.
10. Young, H., A. Moyes, H. Lough,I.W. Smith, J. G. McKenna, and C. Thompson. 1991. Preliminary evaluation of "Clearview Chla-mydia" for the rapid detection of chlamydial antigen in cervical secretions.Genitourin. Med. 67:120-123.
J. A. J. W. Kluytmans W. H. F. Goessens J. W. Mouton J. H. van Rijsoort-Vos H. G. M. Niesters W.G. V. Quint L.Habbema E.Stolz
J. H. T.Wagenvoort
Departmnent ofClinicalMicrobiology University HospitalRotterdamDijkzigt Dr. Molewaterplein 40
3015GDRotterdam, The
Netherlanzds
J. CLIN. Ml(CROBIOL.
on May 15, 2020 by guest
http://jcm.asm.org/
JOURNAL OFCLINICALMICROBIOLOGY,Dec. 1993, p. 3204-3210
Vol.
31,No. 12 0095-1137/93/123204-07$02.00/0CopyrightX)1993,AmericanSocietyforMicrobiology
Evaluation of
Clearview and
Magic
Lite
Tests,
Polymerase
Chain Reaction, and Cell Culture for Detection of
Chlamydia
trachomatis in
Urogenital
Specimens
J. A.J. W.
KLUYTMANS,l*
W. H. F.GOESSENS,1
J. W.MOUTON,'
J. H. VAN RIJSOORT-VOS,' H.G. M. NIESTERS,"2 W. G. V. QUINT,2 L. HABBEMA,3 E. STOLZ,3AND J. H. T.WAGENVOORT't
Departmentof Clinical
Microbiology'
andDepartment ofDermato-venereology,3UniversityHospital RotterdamDijkzigt, Dr. Molewaterplein40, 3015GD Rotterdam, andDepartmentof MolecularBiology,Diagnostic Centre SSDZ, 2600 GA Delft,2 The Netherlands
Received28 June1993/Returned for modification 6 August 1993/Accepted7September 1993
TheClearview Chlamydiatest (CV; Unipath Ltd., Bedford, United Kingdom), the Magic Lite Chlamydia test(ML; CIBACorning, Medfield, Mass.), apolymerase chain reaction (PCR), and cell culture (CC) were evaluated for detection ofChlamydia trachomatis in urogenital specimens. Specimenswere collected from 283 menand724womenvisitingtheoutpatientclinic forSexually Transmitted Diseases at theUniversityHospital Rotterdam, Rotterdam, The Netherlands. ML, PCR, and CC were all performed on the same sample to preventswab-to-swab
variability.
CVwasperformed on a separatesample.Analysis
ofdiscordant results was performed by application of the following confirmatory assays: first, PCR on the CC, second, ML was repeated, and third, PCRwasrepeated byusingadifferent DNA extractionprotocol. If more thanonetest was positive, thesamplewasconsidered truepositive. Ifonly
onetest waspositive, whichwasconfirmedby the confirmatory assay, thesamplewasalso considered truepositive. By using theseinterpretations, the following results were obtained. Thesensitivity
andspecificity
of CV for samples from men were 60.4 and 86.3%,respectively.
Forsamplesfrom women, these valueswere62.3 and 99.7%,respectively.
The lowspecificity
for samples frommen wascausedby unidentifiedsubstances in the swab thatwasused. The use of CV onsamples frommen is notrecommended by the manufacturer. For samples from women, thespecificity
of CVwashigh, butthelowsensitivity of CV limits itsusefordiagnostic purposes. The sensitivities of MLwerelow forsamples from bothmen andwomen (68.8 and50.9%orespectively),
whilespecificitieswereexcellent forsamples from both groups (100 and 99.9%o,respectively).
The lowsensitivity
of ML limits its diagnostic value. The PCR techniquewashighly
specificforsamples from bothmen(99.6%) and women (99.9%o). Thesensitivity
ofPCR, however, wasunexpectedly
low for samples from both groups (men, 87.5%; women, 79.2%), most likely becauseofthesampletreatmentmethod used.Thesensitivity
andspecificity values of CC for samples from men were95.8 and100%,respectively.
Forsamples from women, these valueswere100 and99.9%o,respectively.
Inthe present study,CCwasthe most reliable technique for thedetection of C.trachomatis.Chlamydiatrachomatis isnowthe most common report-able sexually transmitted disease. Approximately 4 million cases occur annually in the United States (4). Theclinical spectrum of the disease ranges from urethritis, cervicitis, and endometritis to salpingitis andperihepatitis (21). Chla-mydialinfections often are asymptomatic or nonspecific in their clinicalcourse.This lack of evident symptoms contrib-utesto the furtherspread of the disease. Moreover, salpin-gitis caused by C. trachomatis, although often asymptom-atic, is a frequent cause of infertility in women (4). The optimal antibiotictherapy for chlamydial infections is doxy-cycline or erythromycin. Because of the serious sequelae, the lack of specific signs and symptoms, and the specific therapy required, it is important to have a reliable diagnostic test.
Thediagnosis of chlamydial infections is mainly based on culture of the organism on HeLa 229 or McCoy cells, which takes several days and requires extensive laboratory facili-ties.Inaddition,circumstances with regard to transport and storageof the sample may influence the reliability of the cell
*Correspondingauthor.
tPresent address: Department of Clinical Microbiology, de Wever Hospital, Regional Public Health Laboratory, 6401 CX, Heerlen,The Netherlands.
cultureresult considerably (12, 13). Theavailabilityof new antigen detection techniqueshas overcomethese disadvan-tages. Atfirst,a directfluorescent-antibody test was devel-oped; this wassoonfollowed by several enzyme immunoas-says. Both direct fluorescent-antibody tests and enzyme immunoassays have been compared with cell culture and with each other in a number of studies. The results of those studiesaresummarizedanddiscussed in three reviews (2, 7, 21).
Recently, tests based on the recognition of specific DNA or RNA sequences have been developed. A nonisotopic DNAprobe for thedetectionof
C.
trachomatis inurogenital specimensis commercially available and has been compared with cell culture, directfluorescent-antibody test, and poly-merase chain reaction (PCR) as a reference (9, 10, 14, 27). Also, several PCRs have been described and evaluated previously(3, 5, 6, 16, 17).Inthe present study, we evaluated three recently devel-oped alternatives to cellculture. The ClearviewChlamydia test (CV; Unipath Ltd., Bedford, United Kingdom) is a rapid, solid-phase sandwich immunoassay which requires minimal laboratory facilities and hands-on time. According to the manufacturer, CV is recommended for testing only female cervical samples. The Magic Lite Chlamydia test (ML; CIBA Corning, Medfield, Mass.) is a new
DETECTION OF C. TRACHOMATIS 3205
nometric sandwich immunoassay. This test is easy to per-form and can be fully automated. The PCR used in the present study is a modification of the method we evaluated and described before (6, 10). Instead of the laborious phenol extraction method that we used previously, a simplified sample preparation procedure was applied. These modifica-tions should make the PCR suitable for processing large numbers ofspecimens in routine settings.
CV, ML, and PCR were initially compared with cell culture (CC) as the "gold standard." Thereafter, analysis of discordant results was performed by using the following confirmatory assays: (i) PCR on the CC, (ii) repreat ML, and (iii) repeat PCR by using a different DNA extraction proto-col. If more than one test was positive, the sample was considered true positive. If only one test was positive and this positive result was confirmed by the confirmatory assay, thesample was also considered true positive. In this way we could evaluate possible failures of CC and thus improve the valueof the present evaluation.
MATERIALS AND METHODS
Patients and specimens. Specimens were collected from 283 men and 724 women visiting the outpatient clinic for Sexually Transmitted Diseases at the University Hospital Rotterdam. Male urethral and female cervical samples were collected. To eliminate swab-to-swab variability, ML, PCR, and CC were performed on the same sample. This sample wastaken by using a dacron E.N.T. swab (Medical Wire and Equipment Co., Corsham, Willshire, United Kingdom), which was placed into 2 ml of 0.2 M sucrose phosphate buffer(2-SP).The portion for CC was stored at 4°C or, when not tested within 24 h after collection, at -70°C. All CCs were performed within 7 days. In a previous study, these transportconditions have been shown to give optimal sen-sitivity (24). The portion of the sample used for ML was stored at 4°C or, when not tested within 5 days after collection, at -20°C. All samples for ML were processed within 14 days. Thisprocedure was approved by the manu-facturer. The 2-SP portion for PCR was stored at -70°C, and all samples for PCR were processed within 7 days. In a pilot study, itwas shown that the 2-SP transport medium caused both false-negative and false-positive results in the CV. Therefore, the CV was performed on a separate sample. The female samples for CV were collected by using the swab providedbythe manufacturer (Unipath Ltd.). This swab was notappropriate for taking male urethral samples. To obtain samplesfrom males, a dacron E.N.T. swab with an alumi-numshaft (Medical Wire and Equipment Co.) was used. The swabwastransported to the laboratory, where the samples were stored at 4°C until testing. All tests were performed within 3 days. During the first 3 months of the study, the sample for CV was taken before the 2-SP sample. The samplingorder was reversed during the second part of the study. The remainder of the 2-SP sample was stored at -70°C for further reference.
CC. McCoy cells were grown as monolayers in plastic culture flasks (no. 3150; Costar, Cambridge, Mass.). Com-plete medium I forcell growth and maintenance consisted of Eagle minimalessential medium(Autopow; Flow Laborato-ries, Inc., Irvine, Scotland) containing 10% (vol/vol) fetal bovine serum (Hyclone Laboratories, Inc., Logan, Utah), 1%
(vol/vol)
vitamins (10Ox vitamins for Eagle minimal essential medium; Flow), 1% (vol/vol) glutamine (L-glu-tamine [200 mM] for cell culture, 29.23 mg/ml; Flow), gentamicin (20 ,ug/ml), amphotericin B (5 i±g/ml), andNaHCO3 (2.0 g/liter [pH 7.5]). For chlamydial growth, complete medium II was used; this medium contained van-comycin (25
,ug/ml),
glucose (4.5 g/liter), and cycloheximide (1,ug/ml) (Sigma Chemical Co., St. Louis, Mo.).McCoy cells were suspended to a concentration of 3.5 x 105/ml, of which 200,ul was passed to a microdilution plate containing 96 wells (Falcon 3070; Becton Dickinson Lab-ware, Oxnard, Calif.). The plates were incubated overnight at 37°C in a humidified atmosphere of 5% CO2. Before inoculation of the specimen, the cell monolayer was in-spected for confluency and was rinsed twice with 100 ,u of complete medium II. A total of 45 specimens and 3 controls were cultured in duplicate in the 96-well microtiter plate. All three controls were positive controls, containing a mixture ofC. trachomatis serotypes D, E, F, H, and K. These five serotypes are responsible for approximately 90% of the infections caused byC. trachomatis in Rotterdam (25). After the specimens and controls were agitated (SMI multitube vortexer; American Hospital Supply Corp., Miami, Fla.) for 30 s (speed 5), 200 ,ul was added to each of two wells containing McCoy cell monolayers. The inoculum was cen-trifuged onto the cells at 1,400 x g for 60min, after which the fluid was replaced with 100
RI
of complete medium II. After 48 h ofincubation at37°C in a humidified atmosphere of 5%CO2,
the monolayers were fixed with ethanol (96%) for 10 min and stained with fluorescent monoclonal Chlamydia anti-major outer membrane protein antibodies (Microtrak; Syva Co., Palo Alto, Calif.). The plates were viewed with a Leitz fluorescent microscope at a magnification of x201.6 and were examined for inclusions. Culture results were scored as follows: 0, no inclusion per two wells; 1, 1 to 5 inclusions per well; 2, 6 to 20 inclusions per well; and 3, >20 inclusions per well. The inoculated CC plates were stored at -200C.CV. CVwas performed according to the manufacturer's instructions for females. A different swab was used for males. Tests wereperformed twice a week, and one positive control was included in each run. Upon testing, the swabs were placed into aflexible reaction tube containing 0.6 ml of extraction buffer and were vortexed. The tube containing the swab was then placed into a heating block at80°Cfor 10min. After cooling for 5 min at room temperature, the swab was rotated in the buffer and was removed from the tube. Five drops(+±150
p,l)
of the mixture was added to the absorbant pad in the sample window of a small immunochromato-graphic device. The part of the absorbant pad in the sample window contains dried, colored latex particles coated with monoclonal antibodies to chlamydial antigen. The absorbant pad is in contact with amembrane strip to which two lines of antibodies have been immobilized. The first immobilized line, the result window line,contains monoclonal antibodies tochlamydial antigen. The second line, the control window line, contains polyclonal antibodies to mouse immunoglob-ulin. If chlamydial antigen is present in the sample, it will react with theantibody bound to the latex particles, forming a complex. This complex is carried up to the immobilized monoclonal antibodies to chlamydial antigen, where the complex iscaptured, to form a sandwich. This gives a line in the resultwindow. Ifchlamydial antigen is not present in the sample, no sandwich is built up and the result window remains clear. In either case some latex particles are carried on to the immobilized line of antibodies to mouse immuno-globulin, forming a line in the control window. If the control window remained clear, the sample was considered not evaluable.3206 KLUYTMANS ET AL.
ent from those in the
officially
recommended system.Al-though
themanufacturerapproved
the useof the system, it mayhaveinfluencedthe results.Furthermore,
theprocedure
was
performed exactly according
to the manufacturers' instructions. In each run, onepositive
and one negative controlwereincluded. Thenegative
controlwasdetermined intriplicate,
and thepositive
controlandthepatient
samples were determined induplicate.
Two hundred microliters ofsample
was added to 750 ,ul of reagentbuffer,
and the mixturewasvortexed twice for 15s. Two hundred microli-tersof thispretreated sample
wasaddedtothereactiontube.Then,
100,ul
ofreaction bufferwas added and the sample was vortexed.Subsequently,
100 tl of monoclonalanti-Chlamydia
antibody
labeled with an acridinium ester wasadded;
this was followedby
the addition of 500 ,u ofpolyclonal anti-Chlamydia
antibody covalently
bound toparamagnetic particles.
Themixturewasvortexed and incu-batedatroomtemperaturefor 90 min. Afterincubation,
the tubeswereplaced
onthemagnetic separation
base for3 min. The supernatantsweredecantedand the tubeswereblotted whileholding
the tube rack and the base of the magneticseparation
unittogether.
One milliliter of wash buffer wasadded,
and aftervortexing,
themagnetic separation
proce-dure wasrepeated. Finally,
100 ,u of distilled water was added and the resultswereread withaluminometer (Magic-LiteAnalyzer).
The resultsweregiven
asrelativelight
units(RLUs).
Interpretations
were madeby using
two cutoff factors(1.6
and2.3),
which were recommendedby
the manufacturer. If themeanvalue oftheduplicate
determina-tion(test result)
was <1.6 times the mean of thenegative
control,
thesample
was considerednegative.
If the test resultwas >2.3timesthe meanof thenegative control,
thesample
was consideredpositive.
Finally,
if the test resultwas
21.6
times andc2.3
times the mean of thenegative
control,
thesample
was retestedby
ablocking
assay. Theblocking
assayusedamonoclonalanti-Chlamydia antibody
withanepitope
different from those of the monoclonal andpolyclonal
anti-Chlamydia
antibodies used in the routine assay. Pretreatment of thesample
was identical to that described above. After thereactionbufferwasadded,
100 ,ul ofblocking
agentwasadded,
and the mixturewasvortexed and incubated for 30 min at room temperature.Subse-quently,
the routineprocedure
was followedstarting
with the addition of the acridinium ester labeled monoclonalanti-Chlamydia
antibody. Interpretations
weremadeby
us-ing
thefollowing
calculation:X=(A/B)
x(CID),
where Ais the RLUs of thenegative
control inthe assay of the blockedsample,
Bisthe RLUs of thenegative
controlin the assay of the unblockedsample,
C is the RLUs of the unblockedsample,
andDis theRLUs of the blockedsample.IfXwas>
1.9,
thesample
wasconsideredpositive,
orelsethesamplewas considered
negative.
The value of 1.9 was recom-mendedby
the manufacturer.PCR.To preparethe
sample
for the PCR assay,200 pl of thepatient
sample
wascentrifugedfor 10 minat1,400xg atroom temperature.Thepelletwasresuspended in 300 pl of
phosphate-buffered
saline (PBS). Sixty microliters of thissuspension
was incubatedwith 10RI
of proteinase K solu-tion(Merck)
at afinal concentration of 25 ,ug/ml and with 10 ,ulof6% Triton X-100 for1hat37°C.After heating to1000C for 15 minto inactivate the proteinase K, 100 pl of sterile waterdistilledtwicewas addedto thesample. Ten microli-tersofthis solutionwas usedforthe PCR assay. The PCR assaywasexactly
identical totheonedescribed previously(11).
Two sets ofprimers
recognizing sequences of theendogenous
plasmid
ofC. trachomatis (20)wereused. Bothgenerated aspecies-specific, 517-bp amplified product with all known C. trachomatis serovars. One set wasdescribed previously (5): Ti, GGACAAATCGTATCTCGG; T2, GA
AACCA ACTCTACGCTG; probe, CGCAGCGCTAGAG
GCCGGTCTATTTATGAT.The othercontained the follow-ing sequences: Ti, GCTAGAGCGGCATGCTACAT;
T2,
CGCT[ GCACGAAGTACTCTG; and probe, GATTGTA CAAGGGATCCGTAAGTTAGA. Sampleswereconsidered positive if a PCRproductwassynthesized withatleastone primerset.In eachrun apositivecontrolwasincluded.The positive control consisted of a crude phenol-chloroform extract of a McCoy cell line infected with C. trachomatis serovar L-2. Oligonucleotide primers and probe were syn-thesized on anApplied Biosystems 381A DNAsynthesizer. Analysis of discordant results by PCR. For sampleswith discordant results, confirmatory assays wereperformed(see Table 3). A confirmatory PCR was carried out by using a different DNA extractionprocedure.Therefore, 200
Vll
ofthe 2-SP sample was incubated withproteinase K(final concen-tration, 0.15 mg/ml) in 0.5% sodium dodecyl sulfate for 30 min at 37°C. Nucleic acids were extracted withphenol,
phenol-chloroform-isoamyl alcohol (25:24:1;vol/vol/vol),
andchloroform-isoamyl alcohol (24:1; vol/vol). The nucleic acidswereprecipitated by the addition of 0.1 volume of 3 M sodium acetate and 3 volumes of ethanolandwerestoredat -20°C overnight. After centrifugation for 10 min at 10,000 x g, the pellet was washed once with 80% ethanol andwas dried inavacuumexsiccator. The pellet was resuspendedin 100VI
of TE buffer (10 mM Tris, 0.1 mM EDTA). Ten microliters was used directly in the PCR assayasdescribed above in the sectiononPCR.Foranalysis of discordant results obtained by CC, another procedurewasfollowed. PCR was performed on the wells of the inoculated CCplates which had been stored at -20°C. Therefore, the inoculated McCoy cells of the monolayer weresuspendedin 100
pl
ofPBS. Then, 17.5 ,lI ofproteinase K(10mg/ml) and 17.5 p1 of Triton X-100(6%)wereadded. After incubationat37°C for 1 h, the sample was boiled for 10 min andwasdiluted with135 p1 of twice-distilled water. Ten microliterswasuseddirectly in the PCR assay, as described above in the sectiononPCR.Statistics. Statistical evaluation of the collected data was performed by using Fisher's exact test. Statistical
signifi-cance wasaccepted atP c0.05
(two-tailed).
RESULTSDETECTION OF C. TRACHOMATIS 3207 TABLE 1. CV, ML, and PCRresults compared with CC results for detection of C. trachomatis in 283 males and724females
No.of samples
CC CV result ML result PCRresult
result Males Females Males Females Males Females
+ - + - NEa + - + - + - +
+ 28 18 35 17 2 32 14 26 28 40 6 42 12
- 32 205 2 662 6 0 237 1 669 4 233 1 669
aNE,notevaluable.
CV, ML, and PCR were all significantly lower when the number of inclusions in CC was low (scores of 1 and 2) (P<
0.0001).
Analysis
ofdiscordant results. For analysis of discordant results between the different tests, confirmatory assays on CC, ML, and PCR wereperformed.The sample for CV was not available for further analysis. For discordant samples, theresults of initial tests with the outcomes ofconfirmatory assays aregiven in Table3. A newstandardforcomparison of the tests wasdefined.If more than one test waspositive, thesamplewasconsidered truepositive.Ifonlyone testwas positive and thispositiveresult was confirmed bythe con-firmatoryassay, the sample was also considered true posi-tive. Bythisnewstandard, twofalse-negative andone-false positiveCC resultswere detected. Thefalse-positiveCC had only one inclusion intwo wells.The finalinterpretations, based on the new standard, are alsogiven in Table 3. On thebasis oftheseinterpretations, thesensitivities and specificities of CC, ML, PCR, and CV wererecalculated. Forsamples from males, the specificity of CV was low (86.3%). All other tests had a specificity of 299.6%. The sensitivities forsamples from males were as follows: CV, 60.4%; ML, 68.8%; PCR, 87.5%; and CC, 95.8% (Fig. 2). For samples from females, all tests were highly specific (specificities, 299.7%). The sensitivities for samples from females were as follows: CV, 62.3%; ML, 50.9%; PCR, 79.2%; andCC, 100%.The results forfemales areshown inFig. 3.
TABLE 2. Sensitivity,specificity, predictive value ofapositive test, andpredictive value ofanegativetestofCV, ML,and PCR
compared with CCas thegold standard for detection of C. trachomatis in 283malesand 724females
Percent Test and
subject Sensitivity Specificity Predictive value Predictive value ofpositivetest of negativetest CV
Male 60.9 86.5 46.7 91.9
Female 67.3a 99.7a 94.6a 97.5a
ML
Male 69.9 100.0 100.0 94.4
Female 48.1 99.9 96.3 96.0
PCR
Male 87.0 98.6 90.1 97.5
Female 77.8 99.9 97.7 98.2
aEight sampleswere notevaluablebyCV. Thesesamplesareexcluded
from theseestimatesof theperformanceofCV.
DISCUSSION
Inthe present study, CC was compared with three alter-native methods for the detection of C. trachomatis in uro-genitalspecimens. Swab-to-swab variability of samplingwas eliminated by performingall tests except CV on the same sample.
Ofthe test methods used in thepresent study, CV wasthe quickest and easiest test to perform. For samples from males, both sensitivity and specificity were low (60.4 and 86.5%, respectively). Toevaluate the lowspecificity ofCV, 25 swabswithout anypatient materialwerevortexed vigor-ously in the transport medium. CV was subsequently per-formed. Five of the 25 swabstestedpositive. Anunknown substance in the swab caused the false-positive results.The manufacturer does not recommend the use of CV for sam-ples from males. Our findings confirm this policy. For samples from females, the specificity ofCV was excellent (99.7%). However, its sensitivity was low (62.3%). Other studies (1, 8, 19, 22, 28) found higher sensitivities of CV ranging from 79 to95%,whilespecificitieswere consistently lower(98.0to99.6%). Since CV isperformedby a standard-ized protocol, these differences in performance are most likely causedbyvariationsinthesensitivityof the reference method(CC) usedin the studies describedhere. The sensi-tivity ofourCCwasprobably higher than those oftheCCs used in the otherstudies. In oursetting, the patientrooms arenext to the laboratory. Therefore,the problems associ-ated with transport and storage conditions are confined. Moreover, this CC method has been used frequently as a reference method in evaluations of alternativetests for the
sensitivity
100% 96.4%
87.3%
80%
80%
-:-::;: - ~~~~69.6s 0
80% ...
M.%.., - ...3.S.. .-'':...
0% 38.1%1
39.1%
27.3
21.7
20%-0%
---Ciearview MagicLite PCR
FIG. 1. RelationbetweenCCscoreandsensitivityofCV, ML, and PCR.
-,
CCscoreof1(1to5inclusionsperwell),
X,CC score of 2 (6 to 20 inclusions per well;0,
CC score of3(>20
inclusionsperwell).3208 KLUYTMANS ET AL.
TABLE 3. Analysis of discordant results byconfirmatorytestsin males and females
No.of Testresult'
patieNo.s
Interpretationpatients CC CCconf ML MLconf PCR PCRconf CV
Male
32 - - - + False-positiveCV
7 + NDC + ND + ND - False-negative CV
1 + ND - - + ND + False-negativeML
2 + ND - + + ND + False-negative ML
6 + ND - + + ND - False-negativeMLandCV
2 + + - - - - + False-negativeMLandPCR
1 + + + + - + - False-negativePCR andCV
1 - + + + + + - False-negative CCand CV
2 + + - - - + - False-negativeML,PCR,and CV
1 + + - - - False-negative ML, PCR, and CV
1 - - - - + + - False-negative CC,ML,andCV
2 - - - - + - - False-positivePCR
Female
2 - - - + False-positive CV
2 + ND + ND + ND - False-negativeCV
1 + ND - - + ND + False-negativeML
4 + ND - + + ND + False-negativeML
4 + ND - - + ND - False-negativeMLand CV
5 + ND - + + ND - False-negativeMLand CV
2 + ND - - + ND NEd False-negativeMLand CV
1 + + - - - - + False-negativeML andPCR
3 + + - + - + + False-negativeMLandPCR
4 + + - - - False-negativeML, PCR, and CV
1 + + - - - + - False-negative ML, PCR,and CV
2 + + - + - + - False-negative ML, PCR,and CV
1 - - + - - - - False-positiveML
1 - - - - + - - False-positivePCR
1 + - - - False-positiveCC
aNumberofpatientswithdiscordanttestresults.
bCCconf, MLconf, and PCRconfaretheconfirmatorytestresults ofCC, ML,andPCR,respectively.
ND, notdone.
dNE,notevaluable.
detection of C. trachomatis(5, 6,10, 11, 23,26). Therefore,
aconsiderableamountof attention has beenpaidto improv-ing the performance of this CC method over recentyears. Both thetransport conditions and theperformanceof CC in other settings may vary significantly. This problem of the goldstandard has been discussedpreviously (10).
Acomparison is more reliable if an analysis of samples
with discordant results isperformed. In the presentstudy, the CVsamplewas notavailable forfurtheranalysis. There-fore,theerrorcausedbyswab-to-swabvariabilitycouldnot be determined. To minimize the effect of swab-to-swab variability,thesamplingorderwasreversed.Moreover, ina
previous study (10)itwasshown that swab-to-swab variabil-itydidnothave amajorinfluenceonthe results.
sensitivity/specificity sensitivity/specif icity
0% ~~~~~~
~
~
~
IIClearview MagicLite PCR CellCulture
FIG. 2. Sensitivity (_)and specificity(5)ofCV,ML, PCR,
andCC forsamplesfrommalesafteranalysisofdiscordantresults
byconfirmatoryassays.
100%
-80%
-99.7% 99.9% 99.9% 100% 99.9%
60%
-
40%-Clearview MagicLite PCR CellCulture
FIG. 3. Sensitivity(_) and specificity
(5)
ofCV, ML, PCR andCCforsamplesfromfemalesafteranalysisofdiscordantresultsby
confirmatoryassays.DETECTION OF
C.
TRACHOMATIS 3209 ML was very specific. Only one false-positive result wasfound in samples from females, and none was found in samples from males. However, the sensitivity was low for samples from both males (68.8%) and females (50.9%). Forty-two ML samples were false negative. Upon retesting of these samples, whichhad been stored at -70°C, 22 (55%) samplesbecame positive. This high number of samples with positiveMLresultsafter freezing and thawing was evaluated further. For this purpose, 25 CC-positive 2-SP samples, which were collected prospectively, were tested by ML after storage forapproximately8weeks at both 4 and -70°C. The samples which were stored at -70°C showed significantly higher RLUs than the samples which were stored at 4°C (data not shown). These findings indicate that the perfor-manceof thishighly specific technique could be improved by using a better extraction protocol. In other studies, the sensitivity ofML was higher. In a mixed population of92 menand 102women,Scieuxetal. (18) foundasensitivity of 72.4% and a
specificity
of97.7% for theMLcompared with CC. Neman-Simha et al. (15) compared ML with a direct immunofluorescence technique and cell culture in 89 menand 171 women. Thesensitivitywas88.5% and the
specific-itywas97%. These lower specificities with higher sensitiv-ities compared with our results can also be
explained
byalowersensitivity of the CCmethodused in the other studies. Another explanation for the low
sensitivity
of ML in ourstudy could be the use of another swab and transport medium than the one
supplied
by the manufacturer. How-ever, the manufacturerapproved
the swab and transport medium that we used in combination with the ML. The impactof the useofa different swab andtransport medium cannotbedeterminedfromtheresults of the presentstudy.
The
sensitivity
of the PCR in the present evaluationwas lowerthanthose in otherstudies(5, 6,
16). Furthermore,
the sensitivity of the PCR assay correlatedwith the number of inclusions found inCC,
as shown inFig.
1. From thisexercise,
it can be concluded that the PCRapplied
in the currentinvestigation
is influencedby
alimiting
number of DNA targets in thepatient sample.
In this respect, the sampletreatmentprotocol
plays
acrucialrole. In thestudies ofClaaset al.(5,
6),
aphenol
extractionmethodwasused. In addition to apurifying
effect,
thephenol
method also has aconcentration effect.Sample
volumes of 1 mlor more can easilybe concentrated to 100,ul,
and of this concentrated DNA, aparticular
volume is added to the PCR mixture. Claasetal.(5,
6)
actually
applied
100,ul
of the initialsample
volume in the final PCR. In thecurrently
applied
protocol,
the DNA was not
purified
at all and wasactually
diluted instead of concentrated. If the dilution factor is taken into account,only
2.2,ul
of theoriginal
200,u1
was used in the PCR assay. Theconfirmatory
PCR assay in thepresent
study
usedaconcentrating
phenol
extractionstep
forsample
treatment.By
thismethod,
9 of the 18false-negative
PCR resultswerepositive.
This indicates that thesample
treat-mentmethod usedinourstudy
diminishes thesensitivity
of thePCR. Ossewaardeetal.(16) recently
reported
aPCR for thedetection ofC. trachomatis thatuses asimplified
sample
preparation
procedure
in which thesample
isconcentrated bycentrifugation.
They
applied
24 ,ul of thepatient
sample
into the PCR. A
study investigating
the correlation between theapplied
sample
volumeand the final PCR result isbeing
undertakeninourinstitute.
CC
proved
to be bothhighly
specific
and sensitive.Al-though
CCremainsthegold
standard,
there isadefinite need for alternatives to this method. Both of theimmunoassays
showedlow
sensitivities,
which limits theiruseasdiagnostic
tests. The PCRwasmoresensitive than the
immunoassays.
The
sensitivity
of87.5% forsamples
from maleswashigher
than thatfor
samples
fromfemales(79.3%),
andspecificities
wereexcellent for
samples
fromboth groups.Nevertheless,
the
performance
ofthe PCR described here is too low toreplace
CC fordiagnostic
purposes. Modifications in thesample
treatment should furtherimprove
thesensitivity
ofthe PCR.
ACKNOWLEDGMENTS
Thepresent
study
wassupported by Unipath Ltd.,PCH-diagnos-tica, Haarlem,
TheNetherlands,
andCibaCorning.
We thank N. Knecht and B. Schuit for technical advice and assistance.
REFERENCES
1.
Arumainayagam,
J.T.,
R.S.Matthews,
S.Uthayakumar,
and J.C.Ckay.
1990. Evaluation ofanovelsolid-phase
immunoas-say,Clearview
Chlamydia,
forthe
rapid
detection ofChlamydia
trachomatis.J. Clin. Microbiol.28:2813-2814.
2. Barnes,R.C. 1989.
Laboratory
diagnosis
of humanchlamydial
infections. Clin. Microbiol. Rev. 2:119-136.
3.
Bobo, L.,
F.Coumee,
R.H.Yolken,T.Quinn,
andR. P.Viscidi. 1990.Diagnosis
ofChlamydia
trachomatiscervical infectionby
detection of
amplified
DNAwithan enzymeimmunoassay.
J.Clin. Microbiol. 28:1968-1973.
4. Centersfor DiseaseControl.1985.
Chlamydia
trachomatis infec-tions.Policy
guidelines
forprevention
and control. Morbid. Mortal.Weekly
Rep.
35:535-574.5. Claas, H. C., W. J. Melchers, I. H. de
Bruin,
M. de Graaf, W.C.vanDUk,J.Lindeman,and W.G.Quint.
1990. Detection ofChlamydia
trachomatis in clinicalspecimens by
thepoly-merasechain reaction.Eur.J. Clin.Microbiol. 9:864-868.
6.
Claas,
H.C.J.,J. H. T.Wagenvoort,
H.G. M.Niesters,T. T.Tio,J.H.van
Risoort-Vos,
and W.G.V.Quint.
1991.Diagnos-tic value of the
polymerase
chain reaction forChiamydia
detectionasdeterminedinafollow-up study.
J.Clin. Microbiol.29:42-45.
7. Ehret, J. M., and F. N. Judson. 1989. Genital
chlamydia
infections. Clin. Lab. Med. 9:481-500.
8. Ferris, D.G.,and W. H. Martin. 1992. A
comparison
ofthreerapid
chlamydial
testsinpregnantandnon-pregnantwomen.J.Fam.Pract.34:593-597.
9.
Iwen,
P.C.,
T.M. H.Blair,andG. L. Woods.1991.Comparison
of theGen-Probe PACE2system,directfluorescent-antibody,
and cell culture for
detecting
Chlamydia
trachomatisincervicalspecimens.
Am.J. Clin. Pathol. 95:578-582.10.
Kluytmans,
J. A. J. W., H. G. M. Niesters, J. W. Mouton, W. G. V.Quint,
J. A. J.Ijpelaar,
J. H.vanRjsoort-Vos,
L. Habbema, E. Stolz, M. F. Michel, and J. H. T.Wagenvoort.
1991.Performance ofanon-isotopic
DNAprobe
fordetection ofChlamydia
trachomatisinurogenital
specimens.
J.Clin. Micro-biol.29:2685-2689.11.
Kluytmans,
J.A.J.W.,A. H.vanderWilligen,
B. Y. M.vanHeyst,
W.I.vanderMeyden,
E.Stolz,andJ.H. T.Wagenvoort. 1990. Evaluation ofanenzymeimmunoassay
for detection ofChlamydia
trachomatis inurogenital specimens.
Int. J. STD AIDS1:49-52.12.
Limberger,
R. J., R.Biega,
A. Evancoe, L.McCarthy,
L.
Sliviensky,
and M. Kirkwood. 1991. Evaluation of culture and theGen-Probe PACE2assay fordetection ofNeissenia
gonor-rhoeae andChlamydia trachomatis in endocervicalspecimens
transported
to a state healthlaboratory.
J. Clin. Microbiol.30:1162-1166.
13. Mahony,J.B.,and M. A.
Chernesky.
1985. Effectofswabtype andstoragetemperatureonthe isolation ofChlamydia
tracho-matisfromclinical
specimens.
J. Clin. Microbiol. 22:865-867. 14. Mercer,L.J.,D.C. Robinson,D.F.Sahm,
M.J. Lawrie,andS. N.Hajj.1990.
Comparison
ofchemiluminescentDNAprobe
tocellculturefor the
screening
ofChlamydia
trachomatis inagynecology
clinicpopulation.
Obstet.Gynecol.
76:114-117.3210 KLUYTMANS ET AL.
15. Neman-Simha, V., M. C.Delmas-beauvieux,M.Geniaux, and C. Bebear.1991. Evaluation ofachemiluminometricimmunoassay anda direct immunofluorescence testfordetecting Chlamydia trachomatis in urogenital specimens. Eur. J. Clin. Microbiol. Infect. Dis. 10:662-665.
16. Ossewaarde, J. M., M. Rieffe, M. Rozenberg-Arska, P. M. Ossekoppele, R. P. Nawrocki, and A. M. van Loon. 1992. Development and clinical evaluation of a polymerase chain reaction fordetection ofChlamydia trachomatis. J. Clin. Mi-crobiol. 30:2122-2128.
17. 0stergaard,L., S.Birkelund, and G.Christiansen.1990.Use of polymerase chain reaction fordetection ofChlamydia tracho-matis. J.Clin. Microbiol. 28:1254-1260.
18. Scieux, C.,A. Bianchi, I.Vassias, R. Menuchy, A. Felten, P. Morel, and V. Perol. 1992. Evaluation ofa new chemilumino-metric immunoassay,MagicLiteChlamydia, fordetecting Chla-mydia trachomatis antigen from urogenital specimens. Sex. Transm. Dis.19:161-164.
19. Skulnick, M., G. W.Small, A. E. Simor, D. E.Low,H. Khosid, S. Fraser, and R. Chua. 1991. Comparison of the Clearview Chlamydiatest, Chlamydiazymeand cell culture for detection ofChlamydia trachomatisinwomen with a low prevalence of infection.J. Clin. Microbiol.29:2086-2088.
20. Sriprakash, K. S., and E. S. Macavoy. 1987. Characterization and sequence of aplasmid from the trachoma biovar of Chla-mydiatrachomatis. Plasmid 18:205-214.
21. Stamm, W.E.1988. DiagnosisofChlamydia trachomatis geni-tourinary infections.Ann. Intern. Med. 108:710-717.
22. Stratton, N. J., L. Hirsch, F. Harris, L. M. de la Maza, and
E. M. Peterson. 1991. Evaluation of the rapidCLEARVIEW Chlamydiatestfor direct detection ofchlamydiaefrom cervical specimens. J. Clin. Microbiol.29:1551-1553.
23. Thewessen, E. A. P.M., I. Freundt,J.H. vanRijsoort-Vos, E. Stolz,M. F.Michel,andJ.H. T.Wagenvoort. 1989. Comparison of HeLa 229 and McCoycell cultures for detection of Chla-mydia trachomatis in clinical specimens. J. Clin. Microbiol. 27:1399-1400.
24. Tjiam, K. H., B. Y. M. van Heyst, J. C. deRoo,A. deBeer,T. van Joost, M. F. Michel, and E. Stolz. 1984. Survival of Chlamydia trachomatis in different transport media and at different temperatures: diagnostic implications. Br. J. Vener. Dis. 60:92-94.
25. Wagenvoort, J. H. T., R. J. Suchland,and W. E.Stamm. 1988. Serovar distribution of urogenital Chlamydia trachomatis strains in theNetherlands.Genito-Urin.Med.64:159-161. 26. Wagenvoort, J. H. T., T. vanRijsoort-Vos,A.Overkleeft-van de
Ree, and E. Stolz. 1988. Enhancement ofyield of Chlamydia trachomatis HeLa 229 cell culture. Eur. J. Clin. Microbiol. Infect. Dis.7:822.
27. Woods, G. L., A. Young, J. C. Scott, T. M. H.Blair, and A. M. Johnson. 1990.Evaluation ofanonisotopic probe for detection ofChlamydia trachomatis in endocervical specimens. J. Clin. Microbiol.28:370-372.
28. Young, H., A. Moyes, H. Lough,I.W. Smith,J. G. McKenna, andC. Thompson. 1991. Preliminary evaluation of "Clearview Chlamydia" for the rapid detection of chlamydial antigen in cervicalsecretions. Genito-Urin. Med.67:120-123.