Maternally localized germ plasm mRNAs and germ cell/stem cell formation in the cnidarian Clytia

(1)

Maternally localized germ plasm mRNAs and germ cell/stem cell formation in the

cnidarian Clytia

Lucas Leclère

a,

⁎

,1

, Muriel Jager

a,1

, Carine Barreau

b

, Patrick Chang

b

, Hervé Le Guyader

a

,

Michaël Manuel

a

, Evelyn Houliston

b

a

Université Pierre et Marie Curie, Univ Paris 06 UMR 7138 CNRS MNHN IRD, Case 05, 7 quai St Bernard, 75005 Paris, France

b

Université Pierre et Marie Curie, Univ Paris 06 UMR 7009 CNRS, Observatoire Océanologique, 06230 Villefranche-sur-Mer, France

a b s t r a c t

a r t i c l e i n f o

Article history:

Received for publication 23 September 2011 Revised 11 January 2012

Accepted 20 January 2012 Available online 28 January 2012

Keywords: Germ line

Multipotent stem cell Germ plasm Preformation Hydrozoa Cnidaria Evolution

The separation of the germ line from the soma is a classic concept in animal biology, and depending on spe-cies is thought to involve fate determination either by maternally localized germ plasm (“preformation” or “maternal inheritance”) or by inductive signaling (classically termed “epigenesis” or “zygotic induction”). The latter mechanism is generally considered to operate in non-bilaterian organisms such as cnidarians and sponges, in which germ cell fate is determined at adult stages from multipotent stem cells. We have found in the hydrozoan cnidarian Clytia hemisphaerica that the multipotent“interstitial” cells (i-cells) in larvae and adult medusae, from which germ cells derive, express a set of conserved germ cell markers: Vasa, Nanos1, Piwi and PL10. In situ hybridization analyses unexpectedly revealed maternal mRNAs for all these genes highly concentrated in a germ plasm-like region at the egg animal pole and inherited by the i-cell lineage, strongly suggesting i-cell fate determination by inheritance of animal-localized factors. On the other hand, experimental tests showed that i-cells can form by epigenetic mechanisms in Clytia, since larvae derived from both animal and vegetal blastomeres separated during cleavage stages developed equivalent i-cell populations. Thus Clytia embryos appear to have maternal germ plasm inherited by i-cells but also the potential to form these cells by zygotic induction. Reassessment of available data indicates that maternally localized germ plasm molecular components were plausibly present in the common cnidarian/ bilaterian ancestor, but that their role may not have been strictly deterministic.

Introduction

In a wide variety of metazoan species, a distinctive maternal cyto-plasmic region of the egg called pole plasm (in Drosophila) or germ plasm (Saffman and Lasko, 1999), is selectively inherited by the pri-mordial germ cells (PGC), founders of the germ line. In some cases, notably in Drosophila and in anuran amphibians such as Xenopus, germ plasm components have been shown experimentally to act in the determination of the germ line. This mechanism of germ line formation by inheritance of a maternal germ plasm is called “prefor-mation” or “maternal inheritance”.

Germ plasm can be recognized by various distinctive features (Eddy, 1975), including electron-dense granules composed of ribonucleo-protein complexes, variable association with dense concentrations of mitochondria and nuclear pores and all or part of a conserved set

of mRNAs and proteins (notably Piwi, Nanos, Vasa, PL10, Pumilio, Boule/Dazl and Bruno) involved in transposon silencing and mRNA regulation (Ewen-Campen et al., 2010; Juliano et al., 2010a; Voronina et al., 2011). Germ plasm is detectable during oogenesis as an amor-phous substance termed nuage near the large oocyte nucleus (germinal vesicle), and relocates to a restricted area of the cortex during oogenesis or early development. It is then inherited by a subpopulation of blasto-meres that give rise to the PGCs.

Some animal species lack any distinguishable germ plasm during early embryonic stages, and their PGCs are specified by inductive signals (Extavour and Akam, 2003). This type of germ line formation is termed“epigenesis” or “zygotic induction” and is well documented in mammals and in urodele amphibians. In both cases, experimental manipulations can induce re-specification of cells from various embry-onic regions to PGC fates, and there is no detectable mRNA or protein lo-calization for the germ plasm“markers”, or localization of electron-dense granules during early development (seeExtavour and Akam, 2003). Bone morphogenetic proteins (BMPs) have been identified as primordial germ cell inducers in mouse embryos (Lawson et al., 1999; Ohinata et al., 2009; Ying et al., 2003), but there is no indication that they are involved in germ line specification in other species (reviewed

⁎ Corresponding author at: Sars International Centre for Marine Molecular Biology, University of Bergen, Thormøhlensgate 55, N-5008, Bergen, Norway.

E-mail address:lucas.leclere@sars.uib.no(L. Leclère).

1_{These authors contributed equally.}

Contents lists available atSciVerse ScienceDirect

Developmental Biology

(2)

inEwen-Campen et al., 2010). Another“epigenetic” route to PGC forma-tion is seen in sponges, hydrozoans and planarians, and involves their segregation from multipotent stem cell populations maintained in the adult (Müller, 2006; Watanabe et al., 2009).

Irrespective of the mode and timing of PGC speciﬁcation, genes of the Piwi, Vasa, nanos set have been consistently found expressed ei-ther in the germ line or in multipotent PGC precursors. Furei-thermore, genes of this set have been shown to be essential for the maintenance and differentiation of both PGC and multipotent stem cells ( Ewen-Campen et al., 2010; Juliano et al., 2010a). Their expression, however, is not exclusive to cells with germinal potential. For instance, Piwi, Vasa and PL10 are expressed in some somatic stem cell types in mammals and Drosophila (seeJuliano et al., 2010a). In the cteno-phore Pleurobrachia, expression of Piwi, Vasa and PL10 genes occurs in both the germ line and in a variety of non-germ line stem cells (Alié et al., 2011).

Expression of the germ plasm/germ line/stem cell genes described above has been used to trace the embryological origin of the germ line, and to infer its mechanism of speci_{ﬁcation. The curious scattered} distribution of species thus inferred to use “preformation” versus “epigenesis” across the animal phylogeny has stimulated much de-bate as to which mechanism is evolutionarily the oldest. A survey based heavily on such gene expression data suggested that “epigene-sis” was more widespread and probably ancestral (Extavour, 2007; Extavour and Akam, 2003).

Among the non-bilaterian metazoan lineages, hydrozoan cnidarians are the group for which the origin of germ cells is best understood. Cnidarian are divided in two clades, anthozoans and medusozoans which include hydrozoans (Collins et al., 2006). Medusozoans are characterized by the presence of a medusa, in addition to the polyp stage. In anthozoans such as Nematostella, the embryonic origin of the germ cells and stem cells is unclear. No germ cell-generating pluripotent stem cells equivalent to hydrozoan interstitial cells (i-cells) have been detected (Technau and Steele, 2011), while reports of the localization of maternal Nanos mRNAs are contradictory (Extavour et al., 2005; Torras and Gonzalez-Crespo, 2005). In hydrozoans, the life cycle typically comprises three phases: the planula larva, the benthic, vegetatively-propagating polyp and the pelagic, sexual me-dusa. The i-cell population, present throughout the adult life, gener-ates both gamete precursors and various somatic cell types, namely neuro-sensory cells (including nematocytes) and secretory gland cells (Watanabe et al., 2009). The i-cells originate during gastrula-tion and arefirst detectable in the central, endodermal region. They are later found predominantly in the ectoderm, or between the ecto-dermal and endoecto-dermal epithelia in the polyp and medusa. Studies in various hydrozoan species (Podocoryne, Hydractinia and Hydra) have shown that i-cells in the planula larva, polyp and medusa ex-press genes considered to be germ line markers in bilaterian species (Piwi, Nanos, Vasa, PL10:Mochizuki et al., 2000, 2001; Rebscher et al., 2008; Seipel et al., 2004) and contain dense cytoplasmic granules similar to those considered characteristic of germ plasm (Noda and Kanai, 1977in Hydra). The impressive capacity of hydrozoan isolat-ed fragments from both early and late stage embryos to regulate normal development (e.g.,Freeman, 1981), has encouraged the as-sumption that i-cells have an epigenetic origin. Recent reports of maternally-localized Vasa protein in the hydrozoan Hydractinia (Rebscher et al., 2008), however, has raised doubts about this issue. We have addressed the origin of i-cells in the experimental model Clytia hemisphaerica (Houliston et al., 2010). In situ hybridization an-alyses offive germ line marker genes (Piwi, Nanos1, Nanos2, PL10 and Vasa) along with embryo bisection and q-PCR analyses provided evi-dence that maternally localized germ plasm co-exists with an epige-netic type mechanism of i-cell specification during Clytia embryonic development. Ourfindings have prompted us to reconsider the rela-tionship between germ plasm and germ line in metazoans, as well as between preformation and epigenesis.

Material and methods Gene identi_ﬁcation

cDNA sequences corresponding to the CheNanos1 and 2, ChePiwi, ChePL10 and CheVasa genes were retrieved by BLAST searches on the Clytia hemisphaerica EST collection (publicly available on Gen-Bank) sequenced by Genoscope (Evry, France) from C. hemisphaerica mixed stage normalized cDNA libraries (seeHouliston et al., 2010). The PL10 sequence was incomplete and subsequently extended using degenerate forward primers corresponding to amino-acid sequences MACAQT (PL10-1: 5′ ATGGCNTGYGCNCARAC 3′) and GSGKTAA (PL10-2: 5′ GGNWSNGGNAARACNGCNGC 3′) and speciﬁc reverse primers (PL10-1rev: 5′ ATCCAACGCGACCAACAGCC 3′ and PL10-2rev: 5′ GCTAA-CATCTGAATTTCC 3′). Two rounds of nested PCR were performed using, as template, 1_{μl of diluted cDNA extracted from a Clytia cDNA library.} GenBank accession numbers: EU199802 (ChePiwi), JQ397273 (CheVasa), JQ397274 (CheNanos1), JQ397275 (CheNanos2) and JQ397276 (ChePL10). Phylogenetic analyses

Cnidarian and bilaterian sequences were retrieved from GenBank or atwww.compagen.org (Hemmrich and Bosch, 2008). Sequences were aligned using CLUSTALW in the BioEdit package (Hall, 1999) and the alignment corrected manually. Conserved blocks were extracted to perform phylogenetic analyses, carried out using the Maximum-Likelihood (ML) method using the PhyML program (Guindon and Gascuel, 2003) with the JTT model of amino-acid substitutions (Jones et al., 1994). A BioNJ tree was used as the input tree to generate the ML tree. Among-site variation was estimated using a discrete approxi-mation to the gamma distribution with 8 rate categories. The gamma shape parameter and the proportion of invariant sites were optimized during the ML search. Branch support was tested with bootstrapping (100 replicates).

Animals and embryo manipulation

We used Clytia hemisphaerica medusae cultured in Villefranche-sur-Mer from established laboratory colonies as described previously (Chevalier et al., 2006). 8-cell stage or blastula stage embryos were cut usingfine tungsten needles on 2% agarose-coated Petri dishes. Embryo fragments were cultured in Milliporefiltered natural or arti-ficial seawater containing antibiotics on agarose coated Petri dishes. Although C. hemisphaerica embryos exhibit variable morphologies during early development, we were able to use the_{“peanut” shape} most common among C. hemisphaerica blastulae as an indicator of the animal–vegetal axis (see Video S1).

In situ hybridization

Single and double in situ hybridizations were performed using DIG-orfluorescein-labeled antisense RNA probes as described in (Denker et al., 2008) but with two modifications. (i) Color was developed with NBT/BCIP (Roche, Indianapolis, USA) for simple in situ hybridization, or NBT/BCIP and Fast RedTR-naphthol reagent (Sigma) for double in situ hybridizations. (ii) The concentration of each probe in the hy-bridization buffer was adapted to obtain the best results (low back-ground and intense signal): Piwi (80 ng/μl), Nanos1 (20 ng/μl), Nanos2 (20 ng/μl), PL10 (2 ng/μl), Vasa (8 ng/μl) with 1 μl used for hybridiza-tion in afinal volume of 1 ml.

Transmission electron microscopy

Embryos and gonads were pre-ﬁxed at room temperature (RT) for 10 min in solution A (3% glutaraldehyde, 0.3 M NaCl, 0.05% OsO4,

(3)

(0.3 M NaCl, 0.2 M sodium cacodylate pH 7.3). They wereﬁxed for 2 h at RT in solution A without OsO4, rinsed in solution R for 5 min and

post-_{ﬁxed for 1 h on ice in 1% OsO}4, 1.5% K-ferricyanide, 0.3 M NaCl,

2.5% NaHCO3, pH 7.2 (protocol modiﬁed afterEisenman and Alfert,

1982andSun et al., 2007). Samples were rinsed in H2O and

dehy-drated for 15 min each, with an ethanol series (50, 70, 90, 95%) fol-lowed by 4 incubations in 100% ethanol. They were then embedded in Spurr resin (Agar). Semi-thin sections were stained with 0.5% Methylene blue in 1% Borax. Thin sections were counter-stained with saturated aqueous uranyl acetate (15 min) and Reynolds lead citrate (15 min).

Quantitative RT-PCR

Total RNA from individual cells or embryos was extracted using RNAqueous-Micro kit according to the manufacturer's instructions (Ambion, Warrington, UK). First-strand cDNA was synthesized using

Random Hexamer Primer and Transcriptor Reverse Transcriptase (Roche Applied Science, Indianapolis, USA). q-PCRs were run in trip-licate or quadruptrip-licate and EF-1alpha used as the reference control gene. Each PCR contained 0.8μl cDNA, 10 μl SYBR Green I Master Mix (Roche Applied Science), and 200 nM of each gene-specific prim-er, in a 20_{μl final volume. q-PCR reactions were run in 96-well plates,} in a LightCycler 480 Instrument (Roche Applied Science). Negative controls (RNA without reverse transcriptase) were performed for every primer pair in each PCR plate, to ensure the absence of genomic DNA amplification. Sequences of forward and reverse primers designed for each gene: EF-1alpha-F 5′ TGCTGTTGTCCCAATCTCTG 3′; EF-1alpha-R 5′ AAGACGGAGTGGTTTGGATG 3′; piwi-F 5′ GGTCACGACCCAGA-CAGAAT 3′; piwi-R 5′ GGAATGAGCGAAAAGACGAG 3′; wnt3-F 5′ ATCATGGCAGGTGGAAACTC 3′; wnt3-R 5′ CCCCATTTCCAACCTTCTTC 3′; vasa-F 5′ GCTCGTGCACTTGTCAAAAC 3′; vasa-R 5′ ACCCCAGC-CATCATTGTTAC 3_{′; PL10-F 5′ ACTGGTTTGTCCACCTCGTT 3′; PL10-R} 5′ CACCGCCATATCTGCTCTTT 3′; nanos1-F 5′ AATGAACCCTGGACCTTTCC

Fig. 1. Expression of stem cell marker genes in Clytia medusae. A: In situ hybridization staining of whole medusae (in A1—arrow: one of the four gonads, arrowhead: one of the eight tentacle bulbs, asterisk: the manubrium). Insert in A4: staining in a statocyst (delineated by a dotted line). B, C: Expression in differentiating spermatozoids and oocytes within isolated gonads (or non-isolated in C4). In CI, C2 and C5 the gonad structure had been opened out andﬂattened so that the early oogenesis stages positioned proximally form a peripheral ring. D, E: Tentacle bulbs oriented with the proximal side at the top and the tentacle on the bottom. The row E shows double in situ hybridizations in tentacle bulbs with stem cell marker genes (blue: B) and Minicollagen 3-4a (red: R) probes. Co-staining makes a purple color (P). Insert in E4: higher magniﬁcation of CheNanos2–Minicollagen co-expressing cells. Scale bars: A1–A5: 100 μm; B1–E5: 25 μm; insert in A4 and E4: 10 μm.

(4)

3′; nanos1-R 5′ TCACTGTCTTTGAGCGTGTG 3′; nanos2-F 5′ GCCATCT-CAACCACAAAACC 3′; nanos2-R 5′ AATCGGGCAAGTGTAAGCAC 3′. Imaging

All images of in situ-stained specimens were acquired on an Olympus BX61 microscope using a Q-imaging Camera with Image Pro plus soft-ware (Mediacybernetics, Bethesda, MD). TEM images were acquired on a Hitachi H-600 at 100 kV. Timelapse recordings were made on a Zeiss Axiovert microscope with a motorized stage and camera driven by Metamorph software.

Results

“Germ line” gene expression in jellyfish germ cells and somatic stem cells We identified orthologues of five potential germ line/stem cell genes from our C. hemisphaerica EST collection (Nanos (CheNanos1, CheNanos2), PL10 (ChePL10), Vasa (CheVasa), Piwi (ChePiwi)—see Figs. S1 and S2 for gene orthology analyses).

In situ hybridization of Clytia medusae using antisense probes for allﬁve genes investigated in this study showed expression in the zone of proliferating germ cell progenitors in the gonad (Amiel and Houliston, 2009). In addition, except for CheNanos2, they all showed expression in“somatic” stem cells at the base of the tentacle bulbs (Fig. 1), specialized swellings that continuously supply nematocytes (among other cell types) to the tentacles (Denker et al., 2008). In this study we will consider both of these two spatially-separate stem cell populations as i-cells since they show equivalent gene ex-pression, but whether they are functionally interchangeable remains to be veri_{ﬁed experimentally. As in Podocoryne (}Seipel et al., 2004; Torras et al., 2004), Hydractinia (Rebscher et al., 2008) and Hydra (Mochizuki et al., 2000, 2001), expression of all these genes was more easily detectable in the gonad than at other sites. In both male (Figs. 1B1–B5) and female (Figs. 1C1–C5) gonads, the in situ signal for all these genes was most intense in a proximal strip and distal rim, cor-responding to the sites of presumptive stem cells and early oocyte dif-ferentiation stages in females. Within tentacle bulbs, ChePiwi, CheNanos1, CheVasa and ChePL10 expression was detected both in the stem cell zone of the proximal bulb area (see Denker et al., 2008,Figs. 1D1_{–D3, D5) and during the earliest step of nematogenesis,} as indicated by limited overlap with expression of minicollagen

(Figs. 1E1–E3, E5), consistent with data from Hydra (Mochizuki et al., 2000, 2001) and Podocoryne (Seipel et al., 2004).

CheNanos2 was expressed in germ cells like the other genes, but otherwise differed in expression. In the tentacle bulb, CheNanos2 mRNA was detected in a central band showing complete overlap with expression of minicollagen (Fig. 1E4), indicating that this gene is expressed in differentiating nematoblasts but not in i-cells. It was also detected in the statocyst basal epithelium, near the bell margin (insert inFig. 1A4). In young but not in mature medusae, CheNanos2 expression was also detected in the endoderm of the radial and circular gastrovascular canals and of the manubrium (Figs. 1A4, S3).

Localized maternal mRNAs in a germ plasm-like domain, inherited by i-cells

The maternal mRNAs for all_{ﬁve genes studied were found to be} concentrated around the nucleus in small and large growing oocytes (Figs. 2A–E). In this region, transmission electron microscope (TEM) sections revealed amorphous“nuage” associated with mitochondria and nuclear pores (Figs. 2F, G), highly reminiscent of germ plasm described in other species (Eddy, 1975). The maternal mRNAs for allﬁve genes investigated also showed a marked asymmetric distri-bution in spawned eggs, being highly concentrated in a restricted region immediately adjacent to the female pronucleus at the animal pole (Figs. 3A1–A5). In Hydractinia, perinuclear localization of Vasa protein has been described in the corresponding region (Rebscher et al., 2008).

During cleavage stages, transcripts of all the 5 studied genes except CheVasa remained strongly detectable in the cortical region of blasto-meres inherited from the animal pole of the egg (Figs. 3B–D). In most cases, the mRNAs were distributed in two patches on either side of the animal pole of cleavage and blastula stage embryos (seeFig. 3, lines C and D, but note the single patch inFigs. 3D1, D4). The split of the maternal mRNA into two patches reflects the division by the first unipolar cleavage furrow cutting through the animal pole, and frequent subsequent physical separation of the animal sides of the twofirst blastomeres as development proceeds (see Video S1).

In early gastrula-stage embryos, ChePiwi, CheNanos1, CheNanos2 and ChePL10 mRNA were detected in a cluster of small cells at the oral pole, the site of cell ingression (Fig. 3E1–E4). We hypothesize that zygotic transcription of these genes starts at the late blastula–early gastrula stage, as has been suggested for other embryonically expressed genes (e.g.,Momose et al., 2008). At the end of gastrulation (approximately

Fig. 2. Perinuclear concentration of“germ plasm” in growing oocytes. A–E: Characteristic perinuclear distribution of the ﬁve mRNAs in very early oocyte stages (cyt: cytoplasm; nu: nucleus). F, G: TEM sections of Clytia hemisphaerica growing oocytes. Red arrowheads indicate perinuclear“nuage” material, similar to that described in the germ plasm of many bilaterian animals. er: endoplasmic reticulum, nm: nuclear membrane, pm: cell membrane, n: nucleus, nu: nucleolus, mit: mitochondria. Scale bars A–E, G: 5 μm, F: 1 μm.

(5)

20–24 h post-fertilization) they were predominantly found in the oral half of the endodermal region of the newly-formed planula larva (see Fig. 3F1–F4 and Fig. 4). Over the following 24 h the

distribution of these cells changed progressively, such that after 2 days of development ChePiwi, CheNanos1, CheNanos2 and ChePL10 positive cells were found dispersed throughout the endoderm of

Fig. 3. Distribution of stem cell marker mRNAs during embryonic development. Continuity of ChePiwi, ChePL10, CheNanos1 and CheNanos2 mRNAs from animal cortex of the egg to i-cells. CheVasa is more broadly expressed during cleaving stages and becomes restricted to i-cell during gastrulation and early planula formation. In all panels the position of the animal/oral pole is marked by an asterisk and corresponds to the gastrulation initiation site (asterisk in gastrulae E1–E5). Insert in B5: higher magniﬁcation of perinuclear CheVasa mRNA detection in an 8-cell stage embryo. Scale bars for all panels: 50μm.

(6)

Fig. 4. ChePiwi in situ hybridization during post-blastula embryonic development. A–C: 3 successive stages of gastrulation. D, E: 1 day planulae, F: 2 day planula, G: 3 day planula. H: Schematic representation of embryos shown in panels A to G (dark gray: ectoderm, light gray: endoderm, white: blastocoel, blue: ChePiwi positive cells). Embryos get longer and thinner during gastrulation and planula formation. Flattening of the planula during micro-slide preparation explains why they look bigger than early gastrula in the panels D–G; the size of the planula has been corrected in the drawings shown in H. I: High magniﬁcation of Piwi-positive putative i-cells in the endodermal region of a 3 day old planula (ec: ec-toderm, en: endoderm, n: nucleus). Scale bars: A–G: 50 μm; I: 10 μm.

Fig. 5. Piwi expression in embryos derived from blastula halves. In situ hybridization staining for ChePiwi on uncut control embryos (A)fixed in parallel with embryos derived from lateral (B), animal or vegetal (C) halves of mid-blastula stage embryos andfixed 5–30 min, 6 h or 20 h after cutting. Panels C4 and C5 show two different in situ hybridization pat-terns obtained with embryo deriving from the vegetal half at t = 0–30 min. In all pictures the animal/oral pole is positioned on top. Proportions of embryos with or without clear Piwi-positive cells followingfixation at successive times after cutting (n=number of embryos scored) are indicated on top left in each panel. Scale bars for all panels: 50 μm.

(7)

the planula larva. In 2 and 3 day planulae Nanos2 expression was also detected in the aboral pole ectoderm (Fig. 3F4).

In 3 day planulae, ChePiwi, CheNanos1, CheNanos2 and ChePL10 positive cells in the now-differentiated endoderm layer were identi ﬁ-able as i-cells by their round shape, characteristic disposition, and high nuclear_{–cytoplasmic ratio (}Figs. 3F1_–F4,4I). Interstitial cells have been described in the endodermal region of mature C. hemisphaerica planulae in histological studies (Bodo and Bouillon, 1968). In Hydra, i-cell derivatives have been shown to include nematocytes, nerve cells, gland cells, germ cells and differentiating stages of these four cell types (Watanabe et al., 2009). No trace of capsule, dense granules or neurite-like structures was associated with the cells expressing the four genes in the Clytia larvae. We thus conclude that these four genes are expressed in multipotent i-cells and possibly also early stages of dif-ferentiation of derivative cell types, but not in mature nematoblasts, gland or nerve cells.

The expression pattern for CheVasa during embryonic develop-ment was slightly different from the other genes studied. In the egg, CheVasa mRNA was detected, albeit weakly, in the same cortical re-gion at the animal pole as the other mRNAs (Fig. 3A5). In embryos and larvae, however, cytoplasmic transcripts appeared distributed in a broad animal–vegetal gradient, with diffuse accumulations around nuclei in early cleavage stages (Fig. 3B5). In gastrulae and planulae, a population of cells strongly expressing CheVasa was detected with the same general distribution as the putative i-cells expressing the other four genes (Figs. 3E5, F5).

Experimental demonstration of i-cell formation by epigenesis

To test whether i-cells can form in the absence of the Piwi/Nanos1/ Nanos2/PL10/Vasa mRNA-rich“germ plasm”, embryo bisection exper-iments were performed at the 8-cell and blastula stages. Develop-ment of the i-cell population in the resultant half embryos was monitored by in situ hybridization, using ChePiwi as a marker.

Weﬁrst attempted to separate the animal and vegetal halves at the blastula stage by taking advantage of the characteristic peanut shape adopted by many cleaving embryos. At the blastula stage

(5–6 h post fertilization), the animal pole of such embryos is marked by a deep cleft between two major lobes (e.g., seeFig. 3D2), which from time-lapse movies of development can be deduced to derive from the animal side of thefirst unipolar cleavage furrow (Video S1). In peanut-shaped embryos, in which two patches of ChePiwi, CheNanos1, CheNanos2 and ChePL10 mRNA-rich cells are situated towards the tips of the major two lobes, we attempted bisection perpendicular to the cleft to separate animal and vegetal fragments or, for comparison, along the cleft to generate lateral halves each containing one lobe and therefore one patch of Piwi/Nanos1/Nanos2/ PL10-RNA positive cells (see diagrams inFigs. 5B and C). Our attempts at producing animal–vegetal separation were partially successful, with 10/17 (58.8%) embryos deriving from blastula“vegetal” halves fixed immediately after cutting (within 30 min) lacking Piwi-mRNA aggregates, while 100% of embryos derived from“animal” (n= 17) and_{“lateral” (n= 50) halves showed Piwi staining. The 7/17} Piwi-positive“vegetal” halves obtained in our experiments most probably resulted from inaccurate cutting, but could theoretically also reflect rapid re-expression of Piwi in some vegetal fragments. Despite the successful elimination of Piwi-mRNA aggregates in nearly 60% of cases, nearly all gastrula (6 h after cutting; 20/22; 91%) and planula (20 h after cutting; 5/5; 100%) stage embryos derived from the “veg-etal” halves, showed clear populations of Piwi positive cells (Figs. 5C6 and C7), in a very similar pattern as uncut controls or lateral halves (Figs. 5A2, A3, B2 and B3). Furthermore, following culture until the mature planula stage, all larvae derived from both animal and vegetal halves contained morphologically distinguish-able nematocytes and gland cells.

These blastula bisection experiments indicate that a functional i-cell lineage can develop in the absence of maternally-derived “germ plasm”, but are open to the criticism that there was signiﬁ-cant contamination of the_{“vegetal” fragments by germ plasm. To} ensure that none of the animal germ plasm material contaminated the vegetal fragments, we thus separated 8-cell stage embryos into single blastomeres. At this stage the germ plasm mRNA patches are restricted to the 4 animal blastomeres, and so if germ plasm determines cell fate no i-cells should develop from the vegetal blastomeres (Fig. 6).

Fig. 6. Piwi expression in embryos derived from isolated 8-cell stage blastomeres. A, B: In situ hybridization staining for ChePiwi on uncut control embryos (A)ﬁxed in parallel with mini-embryos (B) derived from isolated blastomeres of 8 cell stage embryos at different times of development: 5–20 min, 1 h, 6.5 h, 20 h and 50 h after cutting. In all panels the animal/oral pole is on top. Proportion of embryos with or without clear Piwi-positive cells followingﬁxation at successive times after cutting (n=number of embryos scored) are indicated on top left in each panel. ChePiwi in situ hybridization of 2 day old planula (A5) comes from an independent experiment. Scale bars for all panels: 50μm.

(8)

As expected, Piwi mRNA aggregates were detectable in 35/66 (53%) of blastomeresﬁxed within 20 min of isolation (Fig. 6B1). Note that the isolates were mixed, because in the absence of clear morphological polarity markers it is hard to generate large populations of uniquely animal or vegetal blastomeres. Correspondingly, at the blastula stage, 6 h 30 min after blastomere isolation, strongly Piwi positive cells were detected in only 28/60 (47%) of the resultant mini-embryos (Fig. 6B3) indicating that there had been no reformation of germ plasm during pre-blastula development. In planula larvae, however,_{ﬁxed 20 h} (1-day planula) or 50 h (2-(1-day planula) after fertilization, 100% of the embryos had correctly formed epithelial endoderm and ectoderm layers and nearly all displayed Piwi-positive cells (73/78 and 65/68 respectively—Figs. 6B4 and B5). Furthermore, mature nematocytes were visible at the aboral pole in 66% (43/65) of the 2-day planulae with Piwi-positive cells in the endodermal region. These results demonstrate that embryo fragments lacking detectable mRNA-rich “germ plasm” are able to re-generate Piwi-expressing i-cells by the time of gastrulation, and thereby to develop a functional interstitial cell lineage in the endoderm.

A pool of non-localized maternal germ cell/stem cell mRNAs

The observed development of Piwi-positive i-cells in vegetal em-bryo fragments could theoretically involve either the mobilization of non-localized maternal mRNAs or new transcription of germ cell/ stem cell genes. As afirst step to distinguishing these possibilities we quantified mRNA levels by reverse transcription PCR (Q-RT-PCR). Mid-blastula stage embryos were bisected into animal and veg-etal halves and subject directly to PCR to quantify levels of ChePiwi, CheVasa, ChePL10, CheNanos1 and CheNanos2 mRNAs. The experiment shown in Fig. 7A involved independent measurement of three matched pairs of animal and vegetal halves. CheNanos1 and CheNa-nos2 mRNAs showed a clear animal bias in their distribution, equiva-lent to that of CheWnt3, whose maternal mRNAs has been shown to be highly localized at the animal cortex of eggs and early embryos (Momose et al., 2008), while others showed levels in the vegetal half that were only modestly lower than in animal halves (ChePL10, ChePiwi) or indistinguishable (CheVasa). Equivalent results were obtained following bisection of four 8-cell stage embryos along the third cleavage plane. The average proportion of mRNA in the vegetal half (4 blastomeres) was approximately 30% for CheNanos1, 40% for CheNanos2, ChePL10 and ChePiwi and 50% for CheVasa (Fig. 7B). Prior to the blastula stage, Clytia embryos thus contain significant vegetal pools of many “germ plasm” mRNAs, despite the locally high concentration around the animal pole revealed by in situ hybridization.

Discussion

In this study we have provided evidence that maternally localized “germ plasm” mRNAs and a regulative “zygotic induction” (“epige-netic”) mechanism of interstitial stem cell lineage specification may co-exist during embryogenesis in the hydrozoan Clytia hemisphaerica. The maternally localized mRNAs are not inherited by a dedicated germ line, but appear to segregate into precursors of multipotent stem cells (i-cells). We suggest that Clytia germ plasm does not have a strictly deterministic function, but may favor the generation of i-cell precursors from the animal region of the egg during embry-onic development, thus coordinating their formation with that of the endoderm. Regulative mechanisms can promote i-cell formation when germ plasm is missing and could also account for position-dependent i-cell formation during normal embryogenesis. Distinct mechanisms based on signaling from surrounding tissues at a much later life cycle stage segregate definitive PGCs from the i-cell popula-tion. Ourfindings have prompted us to reconsider the relationship be-tween germ plasm and germ line, as well as bebe-tween preformation/ maternal inheritance mechanisms and two types of epigenetic/zygotic induction mechanisms, one operating during embryogenesis and the other in adult life.

Maternal germ plasm in Clytia?

We have uncovered a distinct region in the animal cytoplasm of Clytia eggs characterized by marked local concentrations of Vasa, Piwi, Nanos and PL10 mRNAs. This region of the cytoplasm overlaps with a domain of cortical Wnt3 mRNA localization, which extends fur-ther away from the animal pole (Amiel and Houliston, 2009; Momose et al., 2008), and also with the localization of CheSox1 and CheSox13 mRNAs (Jager et al., 2011). The maternal perinuclear Piwi, Nanos and PL10 mRNA aggregates are inherited by a distinct cell population located at the animal pole through cleavage stages. During gastrula-tion, expression of Piwi, Nanos1 and PL10, along with Vasa, continues zygotically in a sub-population of cells corresponding to i-cells (and possibly some of their undifferentiated derivatives) in the planula larvae. This maternal mRNA localization and inheritance proﬁle is highly suggestive of a“maternal inheritance” mechanism generating i-cells. Although the i-cells do not constitute a dedicated germ line, we propose to retain the term“germ plasm”, to deﬁne a characteristic cytoplasmic domain inherited by a“germ track”, which includes both multipotent somatic/germinal stem cells and dedicated germ cell precursors. The concept of the germ track was originally elabo-rated by AugustWeismann (1893)in relation to his theory of the continuity of the “germ plasm”, originally developed from

Fig. 7. Widespread distribution of“germ plasm” mRNAs in early embryos. Quantitative RT-PCR detection of CheWnt3, CheNanos1, CheNanos2, ChePL10, ChePiwi and CheVasa mRNAs in (A) animal and vegetal halves from three individual mid-blastula stage embryos (numbered 1 to 3 on the X axis) and (B) 4 isolated blastomeres from animal or vegetal halves of four 8 cell stage embryos (numbered 1 to 4), processed immediately after cutting. mRNA levels in each half are expressed as a percentage of the total quantity in the embryo. The animal cortical localized mRNA Wnt3 was quantiﬁed in parallel for comparison. q-PCR was performed in triplicate or quadruplicate and results normalized with respect to the level of EF-1alpha mRNA.

(9)

(10)

observations of germ cell segregation in hydrozoans (Berrill and Liu, 1948; Weismann, 1883). It referred to the genealogy of cells contain-ing the germ plasm from the egg to the germ cells, with or without early segregation of a proper germ line, i.e. of a cell lineage that does not produce any somatic cell. It is important to realize that modern use of the term germ plasm, as referring to a cytoplasmic structure, is completely different to Weismann's germ plasm, which in fact equates with nuclear genetic material (reviewed in

Lankenau, 2008). However, since the continuity of the (cytoplasmic) germ plasm appears to occur in species with or without early segre-gation of the germ line, the concept of“germ track” could ﬁnd a new relevance.

It is important to emphasize that the proposition that the Vasa/ Nanos/Piwi/PL10 mRNA-rich“germ plasm” in Clytia acts as a maternal determinant, and so directs the fate of the cells that inherit it, is currently based only on circumstantial evidence, and has two im-portant caveats. Firstly, current evidence does not show de finitive-ly that the i-cell precursors actualfinitive-ly inherit the maternalfinitive-ly localized germ plasm mRNA, although they do form in the appropriate posi-tion in the embryo. Confirmation of direct inheritance during the blastula–gastrula transition would require the maternal mRNAs or the cells that inherit them at the blastula stage to be tracked in vivo, possibilities that are not at the moment technically feasible. The succes-sive segregation of these localized mRNA during cleavage divisions, means that lineage tracing by dye injection at an earlier stage would be uninformative.

Secondly, it should be stressed that localization does not imply function. Even if they are inherited by the i-cells, it is possible that the localized “germ plasm” mRNAs have no role in determining their fate, or indeed no significant function in development, as seems to be the case for a set of mRNAs similarly closely associated with female pronucleus in the beetle Tribolium (Peel and Averof, 2010). It is also possible that they could participate in other developmental processes, for example, in embryonic axis formation as seen with Drosophila Nanos. Testing the function of maternally localized mRNAs in Clytia is currently problematic because their proximity to the nucleus precludes transplantation and irradiation approaches. Testing the roles of individual genes by using morpholino antisense oligonucleotides to block translation could be undertaken (e.g. Momose et al., 2008), but would affect both maternally and zygotically transcribed mRNAs and so would not distinguish between roles in maternal inheritance and regulative mechanisms. Specific experimental approaches to disrupt germ plasm formation during oogenesis, and/or transgenesis approaches to speci_{fically track germ plasm molecular components need to be} developed.

“Zygotic induction” mechanisms for i-cell formation

Our q-PCR measurements indicate that in Clytia, the region of i-cell formation is not restricted spatially by the distribution of“germ plasm” mRNAs. Although they are highly concentrated in the animal pole region these mRNAs are also present across all regions of the early embryo to a greater or lesser extent. The pools of non-localized maternal RNAs clearly cannot play a classical determinant role otherwise all cells would become i-cells. A very similar situation exists for Drosophila germ plasm components, with the majority of nanos and oskar mRNAs dispersed throughout the embryo cytoplasm (96% and 82% respectively) despite striking mRNA localization to posterior pole plasm revealed by in situ hy-bridization (Bergsten and Gavis, 1999).

Given the presence of a distinct domain with germ plasm charac-teristics at the egg animal pole, our experimental demonstration that a regulative mechanism can generate i-cells from vegetal regions of cleavage or blastula stage embryos was unexpected. Although initial-ly uncomfortable at a conceptual level, co-existence of germ plasm-based and_{“zygotic induction” mechanisms for interstitial stem cell} lineage speciﬁcation during embryogenesis can be easily reconciled at a mechanistic level (as already suggested byExtavour, 2007). Start-ing from a situation where a conserved set of stem cell genes such as Piwi, Nanos and Vasa is expressed in the oocyte, it is easy to imagine that the aggregation and association of their maternal mRNAs in one part of the egg could favor rapid interstitial stem cell determina-tion in the cells that inherit them, while signaling mechanisms acting after the onset of zygotic gene transcription could contribute to reg-ulating the size of the cell population and/or to regionally restricting their formation and/or proliferation, or to facilitate their restoration following stress or injury. A similar situation has been described in the ascidian Ciona intestinalis where a maternal germ plasm seems to contain determinants of the germ line but removal of the PGCs at larval stage can be compensated by formation of new ones from multipotent stem cells (Takamura et al., 2002).

The term“zygotic induction” comprises very diverse modes of germ line formation and is defined in opposition to the “maternal inheri-tance” mechanism. This later mode can clearly be defined based on classical observations and more recent molecular analyses: (i) pres-ence of a distinct, restricted cytoplasmic region generated during oogenesis, or at least before thefirst division; (ii) this specialized cytoplasm is restricted to a distinct subset of cells during early devel-opment, and (iii) the cells that take up this cytoplasm differentiate into the primordial germ cells, while those that are not associated with the germ plasm, at least initially, take on a somatic fate. Those organisms where all three criteria are met can be said to use mater-nal inheritance, while those that do not, including Clytia, require

Fig. 8. Phylogenetic distribution of maternal localized germ plasm molecular components in the egg and type of PGC segregation in Metazoa. The distribution of germ plasm RNAs and/or proteins (in red) is represented at 1-cell stage, cleavage and gastrula embryonic stages for one species per taxonomic group for which molecular data are available. For groups containing both species with maternal localized germ plasm molecular components and species without, a species with maternal localization is presented. At larval/juvenile stage, the presence and distribution of the germ line (in yellow) and/or multipotent stem cell line giving rise to the germ line (in blue) are represented. Asterisks indicate the an-imal/anterior pole for bilaterians and the animal/oral pole for cnidarians and ctenophores. Metazoan phylogeny presented is derived fromPhilippe et al. (2011). For character cod-ing, only groups for which molecular data are available were considered: Porifera (Funayama et al., 2010; Müller, 2006—species represented: Suberites domuncula), Ctenophores (Alié et al., 2011—sp.: Pleurobrachia pileus), Anthozoa (Extavour et al., 2005; Torras and Gonzalez-Crespo, 2005—sp.: Nemastostella vectensis/staining shown for early embryonic stage: Vasa, PL10, Nanos2), Hydrozoa (this study;Rebscher et al., 2008; Torras et al., 2004; Seipel et al., 2004; Mochizuki et al., 2000, 2001—sp.: Clytia hemisphaerica/st.: Piwi, PL10, Nanos), Annelida (Agee et al., 2006; Dill and Seaver, 2008; Giani et al., 2011; Kang et al., 2002; Pilon and Weisblat, 1997;Rebscher et al., 2007; Sugio et al., 2008; Tadokoro et al., 2006—sp.: Platynereis dumerilii/st.: Vasa), Mollusca (Fabioux et al., 2004; Rabinowitz et al., 2008; Swartz et al., 2008; Kranz et al., 2010—sp.: Crassostrea gigas/st.: Vasa), Roti-fera (Smith et al., 2010—sp.: Brachionus plicatilis/st.: Vasa), Nematoda (Subramaniam and Seydoux, 1999; Salinas et al., 2007—sp.: Caenorhabditis elegans/st.: VBH-1=PL10), Arthro-poda (Hay et al., 1990; Chang et al., 2002; 2009; Dearden et al., 2003; Extavour, 2005; Sagawa et al., 2005; Dearden, 2006; Schröder, 2006; Nakkrasae and Damrongphol, 2007; Mito et al., 2008; Özhan-Kizil et al., 2009—sp.: Drosophila melanogaster/st.: Vasa, Nanos), Chaetognatha (Carré et al., 2002—sp.: Sagitta setosa/st.: Vasa), Echinodermata (Voronina et al., 2008; Juliano et al., 2006; Juliano et al., 2010b; Yajima and Wessel, 2011—sp.: Strongylocentrotus purpuratus/st.: Vasa), Cephalochordata (Wu et al., 2011—sp.: Branchiostoma flor-idae/st.: Vasa, Nanos), Urochordata (Takamura et al., 2002; Shirae-Kurabayashi et al., 2006; Sunanaga et al., 2006; Sunanaga et al., 2008; Brown et al., 2009, Review inKawamura et al., 2011—sp.: Ciona intestinalis/st.: Vasa), Teleostei (Knaut et al., 2002; Raz, 2003; Saito et al., 2004; Herpin et al., 2007; Aoki et al., 2008—sp.: Danio rerio/st.: Vasa), Amphibia Anura (Machado et al., 2005; Sekizaki et al., 2004—sp.: Xenopus laevis/st: Vasa), Amphibia Caudata (Tamori et al., 2004; Bachvarova et al., 2004—sp.: Ambystoma mexicanum/st.: dazl), Mammalia (review for mice inHayashi et al., 2007; Lee et al., 2005—sp.: Mus musculus/st.: Nanos3), Aves (Tsunekawa et al., 2000—sp.: Gallus gallus/st.: Vasa). We did not consider molecular studies in Acoelomorpha (De Mulder et al., 2009), Platyhelminthes (Handberg-Thorsager and Saló, 2007; Pfister et al., 2008; Sato et al., 2006), turtles (Bachvarova et al., 2009), Dipnoi (Johnson et al., 2003) and Chondrostei (Johnson et al., 2011) since these publications do not provide expression patterns in mature eggs and cleavage stage embryos. Note that while the Rotifera are considered in thisfigure to lack localized maternal germ plasm on the basis of the only molecular study available (Smith et al., 2010), this con-clusion is provisional since pre-molecular studies suggest that localized maternal germ plasm is present at least in some species of this group (seeExtavour and Akam, 2003).

(11)

additional input for the induction of the germ cells, and thus use the “zygotic induction” mode.

The_{“zygotic induction” modes of germ line formation can be} di-vided into different types. One type, classically observed in mammals and in urodele amphibians, involves determination of PGC fate during embryogenesis, with no role for maternal germ plasm. A second type is found in species like Clytia. A maternal germ plasm has a facultative or essential role in multipotent stem-cell lineage determination, but distinct intercellular signaling based mechanisms act at a much later life cycle stage to segregate deﬁnitive PGCs from the multipotent stem cell population. A similar two-step model of PGC determination was proposed byRebscher et al. (2007)based on observations in the polychaete Platynereis in which multipotent stem cells seem to orig-inate by inheritance of maternal determinants, and deﬁnitive germ cell fate determination occurs secondarily, through an epigenetic signal, from the multipotent stem cells.

The evolutionary origin of maternal germ plasm

As demonstrated in the survey presented inFig. 8, maternally localized germ plasm as assessed mainly from molecular data, is very widespread in the Metazoa. Germ plasm ultrastructure and its position in the egg at the future site of gastrulation are very similar between distant animal groups. Germ plasm con-tains variable combinations of conserved gene products present as mRNAs or proteins or both depending on the species, such that no single molecular component is a universal feature. Even in species lacking maternal localization, germ plasm components can localize very early during embryogenesis, for instance in mi-cromeres at the 16-cell stage in echinoderms (Voronina et al., 2008; Yajima and Wessel, 2011) or in the 4d cell lineage for most species of annelids and molluscs (e.g.Dill and Seaver, 2008; Kranz et al., 2010; Swartz et al., 2008). Overall, rare are the groups without localization of germ plasm components in a germ track prior to gastru-lation. Previous phylogenetic surveys, in which detection of maternal germ plasm was equated with preformation, and evidence for late PGC formation equated with epigenesis, concluded that maternal germ plasm/preformation probably derived from epigenesis multiple times in evolution (Extavour, 2007; Extavour and Akam, 2003).

Given the close relationship of the Bilateria and Cnidaria (Philippe et al., 2009; Philippe et al., 2011), and the presence of lo-calized germ plasm in both Clytia and in nearly all the major bila-terian clades (Fig. 8), the hypothesis that maternally localized germ plasm was present in the last common cnidarian–bilaterian (= eumetazoan) ancestor remains quite plausible. This_“ancestral germ plasm” scenario implies that maternal germ plasm was lost in the urodele amphibians and mammalian lineages as well as in the anthozoans. In support of this scenario, “basally branching” chordates such as urochordates or cephalochordates and proto-stomes such as chaetognaths seem to have a maternal germ plasm and“maternal inheritance” mode of germ line speciﬁcation (Carré et al., 2002; Shirae-Kurabayashi et al., 2006; Wu et al., 2011).

On the other hand, in insects, maternal germ plasm and early setting aside of germ cells are restricted to the monophyletic Holometabola, and are associated with the presence and function of the novel gene oskar, which is an Holometabola speciﬁc gene (Lynch et al., 2011). Species that have lost oskar also have lost maternal inheritance. This molecular and phylogenetic evidence indicates that maternal germ plasm seen in insects such as Drosophila is a derived state within the insects. In the chordate lineage, maternal inheritance is associated with another novel gene, bucky-ball, which is similarly restricted to the vertebrate lineage (Bontems et al., 2009). This might also indicate that maternal germ plasm in this clade is an evolutionary novelty associated with the invention of a new gene. However this gene is also present in mammalian genomes that have a clear epigenetic mode of PGC segregation (Extavour and Akam, 2003) and is not

present in non-vertebrate chordate genomes such as Ciona and Bran-chiostoma that display“maternal inheritance” (Shirae-Kurabayashi et al., 2006; Wu et al., 2011).

Given the various arguments in both directions and the lack of functional testing of the role of maternal germ plasm mRNAs in most metazoan phyla, it is not possible for the moment to deduce whether the ancestral function of maternal germ plasm was to pro-vide determinants of the germ track. We suggest that both localized maternal germ plasm and“zygotic induction” of the germ track dur-ing embryonic development might have co-existed in the ancestor of the Eumetazoa and that some animal lineages have subsequently favored or lost one or the other during evolution. This would offer an explanation of their presence in a diverse and phylogenetically dispersed set of animals.

Maternal germ plasm RNAs in Clytia, as well as early zygotic ex-pression in Nematostella (Extavour et al., 2005), are localized on the same side as mRNAs that direct gastrulation and endoderm formation (Martindale, 2005; Momose et al., 2008). The relationship between germ plasm and gastrulation is thus the same in cnidarians and in bilaterians, although the fate map is reversed with respect to egg animal–vegetal polarity (Martindale, 2005). A common association between the germ plasm and the gastrulation site might represent an ancient feature of animal development, facilitating association of germ cell precursors with developing endodermal or mesodermal derivatives, and/or reﬂecting ancestral participation of germ plasm components in embryo patterning. The case of Nanos is interesting in this context as this mRNA has an additional function in patterning the posterior pole in various protostomes (e.g. Drosophila—Lehmann and Nusslein-Volhard, 1991, grasshopper—Lall et al., 2003, mollusk—

Rabinowitz et al., 2008, and leech—Agee et al., 2006). The role of Nanos in axial patterning may have evolved in the protostome line-age since no such function has been described in a deuterostome, and remains to be tested in non-bilaterians.

Considering the phylogenetic distribution of species harboring early germ line segregation versus post-embryonic PGC formation from a multipotent stem cell lineage such as hydrozoan i-cells (Fig. 8), it is not clear which type of germ track is ancestral (i.e. one-step or two-step PGC segregation). Several recent reviews and articles (e.g.Juliano and Wessel, 2010; Rebscher et al., 2007) favor an ancestral multipotent stem cell system capable of giving rise to both germ line and somatic cells and still present in hydrozoans and planarians. Caution is required, however, since this scenario re-lies heavily on the absence of early embryonic PGC segregation in many animal groups for which data on early embryonic stages are very scattered and contradictory, like Platyhelminthes, Acoelomor-pha or Anthozoa (De Mulder et al., 2009; Extavour et al., 2005; Pﬁster et al., 2008). To solve this question, it would be particularly informative to know the timing of germ line segregation in early branching metazoans such as anthozoans, acoels and ctenophores. Acknowledgments

We thank our research colleagues, Elsa Denker, Lisbeth C. Olsen and Fabian Rentzsch for useful suggestions, and two anonymous re-viewers for comments that improved the quality of the manuscript. This work was supported by a grant from the GIS“Institut de la Génomique Marine”–ANR “programme blanc” NT_NV_52 Genocni-daire and by the“Agence Nationale de la Recherche” grant ANR-09-BLAN-0236-01 DiploDevo. EST sequencing was performed by the Consortium National de Recherche en Génomique at the Genoscope (Evry, France).

Appendix A. Supplementary data

Supplementary data to this article can be found online atdoi:10. 1016/j.ydbio.2012.01.018.

(12)

References

Agee, S.J., Lyons, D.C., Weisblat, D.A., 2006. Maternal expression of a NANOS homolog is required for early development of the leech Helobdella robusta. Dev. Biol. 298, 1–11.

Alié, A., Leclère, L., Jager, M., Dayraud, C., Chang, P., Le Guyader, H., Quéinnec, E., Manuel, M., 2011. Somatic stem cells express Piwi and Vasa genes in an adult ctenophore: ancient association of“germline genes” with stemness. Dev. Biol. 350, 183–197.

Amiel, A., Houliston, E., 2009. Three distinct RNA localization mechanisms contribute to oocyte polarity establishment in the cnidarian Clytia hemisphaerica. Dev. Biol. 327, 191–203.

Aoki, Y., Nagao, I., Saito, D., Ebe, Y., Kinjo, M., Tanaka, M., 2008. Temporal and spatial lo-calization of three germline-speciﬁc proteins in medaka. Dev. Dyn. 237, 800–807. Bachvarova, R.F., Masi, T., Drum, M., Parker, N., Mason, K., Patient, R., Johnson, A.D., 2004. Gene expression in the axolotl germ line: Axdazl, Axvh, Axoct-4, and Axkit. Dev. Dyn. 231, 871–880.

Bachvarova, R.F., Crother, B.I., Manova, K., Chatﬁeld, J., Shoemaker, C.M., Crews, D.P., Johnson, A.D., 2009. Expression of Dazl and Vasa in turtle embryos and ovaries: evidence for inductive speciﬁcation of germ cells. Evol. Dev. 11, 525–534. Bergsten, S.E., Gavis, E.R., 1999. Role for mRNA localization in translational activation

but not spatial restriction of nanos RNA. Development 126, 659–669.

Berrill, N.J., Liu, C.K., 1948. Germplasm, Weismann, and hydrozoa. Q. Rev. Biol. 23, 124–132.

Bodo, F., Bouillon, J., 1968. Étude histologique du développement embryonnaire de quelques hydroméduses de Roscoff: Phialidium hemisphaericum (L.), Obelia sp. Péron et Lesueur, Sarsia eximia (Allman), Podocoryne carnea (Sars), Gonionemus vertens Agassiz. Cah. Biol. Mar. 9, 69–104.

Bontems, F., Stein, A., Marlow, F., Lyautey, J., Gupta, T., Mullins, M.C., Dosch, R., 2009. Bucky ball organizes germ plasm assembly in zebraﬁsh. Curr. Biol. 19, 414–422. Brown, F.D., Tiozzo, S., Roux, M.M., Ishizuka, K., Swalla, B.J., De Tomaso, A.W., 2009. Early

lineage speciﬁcation of long-lived germline precursors in the colonial ascidian Botryllus schlosseri. Development 136, 3485–3494.

Carré, D., Djediat, C., Sardet, C., 2002. Formation of a large Vasa-positive germ granule and its inheritance by germ cells in the enigmatic Chaetognaths. Development 129, 661–670. Chang, C.C., Dearden, P., Akam, M., 2002. Germ line development in the grasshopper

Schistocerca gregaria: vasa as a marker. Dev. Biol. 252, 100–118.

Chang, C.C., Huang, T.Y., Cook, C.E., Lin, G.W., Shih, C.L., Chen, R.P., 2009. Developmental expression of Apnanos during oogenesis and embryogenesis in the parthenogenetic pea aphid Acyrthosiphon pisum. Int. J. Dev. Biol. 53, 169–176.

Chevalier, S., Martin, A., Leclère, L., Amiel, A., Houliston, E., 2006. Polarised expression of FoxB and FoxQ2 genes during development of the hydrozoan Clytia hemisphaerica. Dev. Genes Evol. 216, 709–720.

Collins, A.G., Schuchert, P., Marques, A.C., Jankowski, T., Medina, M., Schierwater, B., 2006. Medusozoan phylogeny and character evolution clariﬁed by new large and small subunit rDNA data and an assessment of the utility of phylogenetic mixture models. Syst. Biol. 55, 97–115.

Dearden, P.K., 2006. Germ cell development in the honeybee (Apis mellifera); vasa and nanos expression. BMC Dev. Biol. 6, 6.

Dearden, P., Grbic, M., Donly, C., 2003. Vasa expression and germ-cell speciﬁcation in the spider mite Tetranychus urticae. Dev. Genes Evol. 212, 599–603.

De Mulder, K., Kuales, G., Pﬁster, D., Willems, M., Egger, B., Salvenmoser, W., Thaler, M., Gorny, A.K., Hrouda, M., Borgonie, G., Ladurner, P., 2009. Characterization of the stem cell system of the acoel Isodiametra pulchra. BMC Dev. Biol. 9, 69. Denker, E., Manuel, M., Leclère, L., Le Guyader, H., Rabet, N., 2008. Ordered progression

of nematogenesis from stem cells through differentiation stages in the tentacle bulb of Clytia hemisphaerica (Hydrozoa, Cnidaria). Dev. Biol. 315, 99–113. Dill, K.K., Seaver, E.C., 2008. Vasa and nanos are coexpressed in somatic and germ line

tissue from early embryonic cleavage stages through adulthood in the polychaete Capitella sp. I. Dev. Genes Evol. 218, 453–463.

Eddy, E.M., 1975. Germ plasm and the differentiation of the germ cell line. Int. Rev. Cytol. 43, 229–280.

Eisenman, E.A., Alfert, M., 1982. A newﬁxation procedure for preserving the ultra-structure of marine invertebrate tissues. J. Microsc. 125, 117–120.

Ewen-Campen, B., Schwager, E.E., Extavour, C.G.M., 2010. The molecular machinery of germ line speciﬁcation. Mol. Reprod. Dev. 77, 3–18.

Extavour, C.G.M., 2005. The fate of isolated blastomeres with respect to germ cell for-mation in the amphipod crustacean Parhyale hawaiensis. Dev. Biol. 277, 387–402. Extavour, C.G., 2007. Evolution of the bilaterian germ line: lineage origin and

modula-tion of speciﬁcamodula-tion mechanisms. Integr. Comp. Biol. 47, 770–785.

Extavour, C.G., Akam, M., 2003. Mechanisms of germ cell speciﬁcation across the meta-zoans: epigenesis and preformation. Development 130, 5869–5884.

Extavour, C.G., Pang, K., Matus, D.Q., Martindale, M.Q., 2005. vasa and nanos expression patterns in a sea anemone and the evolution of bilaterian germ cell speciﬁcation mechanisms. Evol. Dev. 7, 201–215.

Fabioux, C., Huvet, A., Lelong, C., Robert, R., Pouvreau, S., Daniel, J.Y., Minguant, C., Le Pennec, M., 2004. Oyster vasa-like gene as a marker of the germline cell develop-ment in Crassostrea gigas. Biochem. Biophys. Res. Commun. 320, 592–598. Freeman, G., 1981. The role of polarity in the development of the hydrozoan planula

larva. Dev. Genes Evol. 190, 168–184.

Funayama, N., Nakatsukasa, M., Mohri, K., Masuda, Y., Agataa, K., 2010. Piwi expression in archeocytes and choanocytes in demosponges: insights into the stem cell system in demosponges. Evol. Dev. 12, 275–287.

Giani Jr., V.C., Emi, Y., Michael, B.J., Seaver, E.C., 2011. Somatic and germline expression of piwi during development and regeneration in the marine polychaete annelid Capitella teleta. Evodevo 2, 10.

Guindon, S., Gascuel, O., 2003. A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst. Biol. 52, 696–704.

Hall, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41, 95–98.

Handberg-Thorsager, M., Saló, E., 2007. The planarian nanos-like gene Smednos is expressed in germline and eye precursor cells during development and regener-ation. Dev. Genes Evol. 217, 403–411.

Hay, B., Jan, L.Y., Jan, Y.N., 1990. Localization of vasa, a component of Drosophila polar granules, in maternal-effect mutants that alter embryonic anteroposterior polarity. Development 109, 425–433.

Hayashi, K., de Sousa, Chuva, Lopes, S.M., Surani, M.A., 2007. Germ cell speciﬁcation in mice. Science 316, 394–396.

Hemmrich, G., Bosch, T.C., 2008. Compagen, a comparative genomics platform for early branching metazoan animals, reveals early origins of genes regulating stem-cell differentiation. Bioessays 30, 1010–1018.

Houliston, E., Momose, T., Manuel, M., 2010. Clytia hemisphaerica: a jellyﬁsh cousin joins the laboratory. Trends Genet. 26, 159–167.

Jager, M., Quéinnec, E., Le Guyader, H., Manuel, M., 2011. Multiple Sox genes are expressed in stem cells or in differentiating neurosensory cells in the hydrozoan Clytia hemisphaerica. Evodevo 2, 12.

Johnson, A.D., Drum, M., Bachvarova, R.F., Masi, T., White, M.E., Crother, B.I., 2003. Evo-lution of predetermined germ cells in vertebrate embryos: implications for macro-evolution. Evol. Dev. 5, 414–431.

Johnson, A.D., Richardson, E., Bachvarova, R.F., Crother, B.I., 2011. Evolution of the germ line–soma relationship in vertebrate embryos. Reproduction 141, 291–300. Jones, D.T., Taylor, W.R., Thornton, J.M., 1994. A model recognition approach to the prediction

of all-helical membrane protein structure and topology. Biochemistry 33, 3038–3049. Juliano, C., Wessel, G., 2010. Developmental biology. Versatile germline genes. Science

329 (5992), 640–641.

Juliano, C.E., Voronina, E., Stack, C., Aldrich, M., Cameron, A.R., Wessel, G.M., 2006. Germ line determinants are not localized early in sea urchin development, but do accu-mulate in the small micromere lineage. Dev. Biol. 300, 406–415.

Juliano, C.E., Swartz, S.Z., Wessel, G.M., 2010a. A conserved germline multipotency program. Development 137, 4113–4126.

Juliano, C.E., Yajima, M., Wessel, G.M., 2010b. Nanos functions to maintain the fate of the small micromere lineage in the sea urchin embryo. Dev. Biol. 337, 220–232. Kang, D., Pilon, M., Weisblat, D.A., 2002. Maternal and zygotic expression of a

nanos-class gene in the leech Helobdella robusta: primordial germ cells arise from seg-mental mesoderm. Dev. Biol. 245, 28–41.

Kawamura, K., Tiozzo, S., Manni, L., Sunanaga, T., Burighel, P., De Tomaso, A.W., 2011. Germline cell formation and gonad regeneration in solitary and colonial ascidians. Dev. Dyn. 240, 299–308.

Knaut, H., Steinbeisser, H., Schwarz, H., Nüsslein-Volhard, C., 2002. An evolutionary conserved region in the vasa 3′UTR targets RNA translation to the germ cells in the zebraﬁsh. Curr. Biol. 12, 454–466.

Kranz, A.M., Tollenaere, A., Norris, B.J., Degnan, B.M., Degnan, S.M., 2010. Identifying the germline in an equally cleaving mollusc: Vasa and Nanos expression during embry-onic and larval development of the vetigastropod Haliotis asinina. J. Exp. Zool. B Mol. Dev. Evol. 314, 267–279.

Lall, S., Ludwig, M.Z., Patel, N.H., 2003. Nanos plays a conserved role in axial patterning outside of the Diptera. Curr. Biol. 13, 224–229.

Lankenau, D.H., 2008. The legacy of the germ line— maintaining sex and life in metazoans: cognitive roots of the concept of hierarchical selection. In: Egel, R., Lankenau, D.-H. (Eds.), Genomic Dynamics and Stability. : Recombination and Meiosis, 3. Springer, Berlin, Heidelberg, pp. 289–339.

Lawson, K.A., Dunn, N., Roelen, B.A., Zeinstra, L.M., Davis, A.M., Wright, C.V.E., Korving, J.P.W.F.M., Hogan, B.L.M., 1999. Bmp4 is required for the generation of primordial germ cells in the mouse embryo. Genes Dev. 13, 424.

Lee, G.S., Kim, H.S., Lee, S.H., Kang, M.S., Kim, D.Y., Lee, C.K., Kang, S.K., Lee, B.C., Hwang, W.S., 2005. Characterization of pig vasa homolog gene and speciﬁc expression in germ cell lineage. Mol. Reprod. Dev. 72, 320–328.

Lehmann, R., Nusslein-Volhard, C., 1991. The maternal gene nanos has a central role in posterior pattern formation of the Drosophila embryo. Development 112, 679–691. Lynch, J.A., Ozüak, O., Khila, A., Abouheif, E., Desplan, C., Roth, S., 2011. The phylogenetic origin of oskar coincided with the origin of maternally provisioned germ plasm and pole cells at the base of the Holometabola. PLoS Genet. 7, e1002029.

Machado, R.J., Moore, W., Hames, R., Houliston, E., Chang, P., King, M.L., Woodland, H.R., 2005. Xenopus Xpat protein is a major component of germ plasm and may func-tion in its organisafunc-tion and posifunc-tioning. Dev. Biol. 287, 289–300.

Martindale, M.Q., 2005. The evolution of metazoan axial properties. Nat. Rev. Genet. 6, 917–927.

Mito, T., Nakamura, T., Sarashina, I., Chang, C.C., Ogawa, S., Ohuchi, H., Noji, S., 2008. Dy-namic expression patterns of vasa during embryogenesis in the cricket Gryllus bimaculatus. Dev. Genes Evol. 218, 381–387.

Mochizuki, K., Sano, H., Kobayashi, S., Nishimiya-Fujisawa, C., Fujisawa, T., 2000. Ex-pression and evolutionary conservation of nanos-related genes in Hydra. Dev. Genes Evol. 210, 591–602.

Mochizuki, K., Nishimiya-Fujisawa, C., Fujisawa, T., 2001. Universal occurrence of the vasa-related genes among metazoans and their germline expression in Hydra. Dev. Genes Evol. 211, 299–308.

Momose, T., Derelle, R., Houliston, E., 2008. A maternally localised Wnt ligand required for axial patterning in the cnidarian Clytia hemisphaerica. Development 135, 2105–2113. Müller, W.E., 2006. The stem cell concept in sponges (Porifera): metazoan traits. Semin.

Cell Dev. Biol. 17, 481–491.

Nakkrasae, L.I., Damrongphol, P., 2007. A vasa-like gene in the giant freshwater prawn, Macrobrachium rosenbergii. Mol. Reprod. Dev. 74, 835–842.

(13)

Noda, K., Kanai, C., 1977. An ultrastructural observation on Pelmatohydra robusta at sexual and asexual stages, with a special reference to“Germinal plasm”. J. Ultra-struct. Res. 61, 284–294.

Ohinata, Y., Ohta, H., Shigeta, M., Yamanaka, K., Wakayama, T., Saitou, M., 2009. A sig-naling principle for the speciﬁcation of the germ cell lineage in mice. Cell 137, 571–584.

Özhan-Kizil, G., Havemann, J., Gerberding, M., 2009. Germ cells in the crustacean Par-hyale hawaiensis depend on Vasa protein for their maintenance but not for their formation. Dev. Biol. 327, 230–239.

Peel, A.D., Averof, M., 2010. Early asymmetries in maternal transcript distribution asso-ciated with a cortical microtubule network and a polar body in the beetle Tribolium castaneum. Dev. Dyn. 239, 2875–2887.

Pﬁster, D., De Mulder, K., Hartenstein, V., Kuales, G., Borgonie, G., Marx, F., Morris, J., Ladurner, P., 2008. Flatworm stem cells and the germ line: developmental and evo-lutionary implications of macvasa expression in Macrostomum lignano. Dev. Biol. 319, 146–159.

Philippe, H., Derelle, R., Lopez, P., Pick, K., Borchiellini, C., Boury-Esnault, N., Vacelet, J., Renard, E., Houliston, E., Quéinnec, E., Da Silva, C., Wincker, P., Le Guyader, H., Leys, S., Jackson, D.J., Schreiber, F., Erpenbeck, D., Morgenstern, B., Wörheide, G., Manuel, M., 2009. Phylogenomics revives traditional views on deep animal relationships. Curr. Biol. 19, 706–712.

Philippe, H., Brinkmann, H., Lavrov, D.V., Littlewood, D.T., Manuel, M., Wörheide, G., Baurain, D., 2011. Resolving difﬁcult phylogenetic questions: why more sequences are not enough. PLoS Biol. 9, e1000602.

Pilon, M., Weisblat, D.A., 1997. A nanos homolog in leech. Development 124, 1771–1780. Rabinowitz, J.S., Chan, X.Y., Kingsley, E.P., Duan, Y., Lambert, J.D., 2008. Nanos is re-quired in somatic blast cell lineages in the posterior of a mollusk embryo. Curr. Biol. 18, 331–336.

Raz, E., 2003. Primordial germ-cell development: the zebraﬁsh perspective. Nat. Rev. Genet. 4, 690–700.

Rebscher, N., Zelada-González, F., Banisch, T.U., Raible, F., Arendt, D., 2007. Vasa unveils a common origin of germ cells and of somatic stem cells from the posterior growth zone in the polychaete Platynereis dumerilii. Dev. Biol. 306, 599–611.

Rebscher, N., Volk, C., Teo, R., Plickert, G., 2008. The germ plasm component vasa allows tracing of the interstitial stem cells in the cnidarian Hydractinia echinata. Dev. Dyn. 237, 1736–1745.

Saffman, E.E., Lasko, P., 1999. Germline development in vertebrates and invertebrates. Cell. Mol. Life Sci. 55, 1141–1163.

Sagawa, K., Yamagata, H., Shiga, Y., 2005. Exploring embryonic germ line development in the waterﬂea, Daphnia magna, by zinc-ﬁnger-containing VASA as a marker. Gene Expr. Patterns 5, 669–678.

Saito, T., Otani, S., Fujimoto, T., Suzuki, T., Nakatsuji, T., Arai, K., Yamaha, E., 2004. The germ line lineage in ukigori, Gymnogobius species (Teleostei: Gobiidae) during em-bryonic development. Int. J. Dev. Biol. 48, 1079–1085.

Salinas, L.S., Maldonado, E., Macías-Silva, M., Blackwell, T.K., Navarro, R.E., 2007. The DEAD box RNA helicase VBH-1 is required for germ cell function in C. elegans. Genesis 45, 533–546.

Sato, K., Shibata, N., Orii, H., Amikura, R., Sakurai, T., Agata, K., Kobayashi, S., Watanabe, K., 2006. Identiﬁcation and origin of the germline stem cells as revealed by the expression of nanos-related gene in planarians. Dev. Growth Differ. 48, 615–628. Schröder, R., 2006. vasa mRNA accumulates at the posterior pole during blastoderm

for-mation in theﬂour beetle Tribolium castaneum. Dev. Genes Evol. 216, 277–283. Seipel, K., Yanze, N., Schmid, V., 2004. The germ line and somatic stem cell gene Cniwi

in the jellyﬁsh Podocoryne carnea. Int. J. Dev. Biol. 48, 1–8.

Sekizaki, H., Takahashi, S., Tanegashima, K., Onuma, Y., Haramoto, Y., Asashima, M., 2004. Tracing of Xenopus tropicalis germ plasm and presumptive primordial germ cells with the Xenopus tropicalis DAZ-like gene. Dev. Dyn. 229, 367–372. Shirae-Kurabayashi, M., Nishikata, T., Takamura, K., Tanaka, K.J., Nakamoto, C.,

Nakamura, A., 2006. Dynamic redistribution of vasa homolog and exclusion of somatic cell determinants during germ cell speciﬁcation in Ciona intestinalis. Development 133, 2683–2693.

Smith, J.M., Cridge, A.G., Dearden, P.K., 2010. Germ cell speciﬁcation and ovary struc-ture in the rotifer Brachionus plicatilis. Evodevo 1, 5.

Subramaniam, K., Seydoux, G., 1999. nos-1 and nos-2, two genes related to Drosophila nanos, regulate primordial germ cell development and survival in Caenorhabditis elegans. Development 126, 4861–4871.

Sugio, M., Takeuchi, K., Kutsuna, J., Tadokoro, R., Takahashi, Y., Yoshida-Noro, C., Tochinai, S., 2008. Exploration of embryonic origins of germline stem cells and neoblasts in Enchytraeus japonensis (Oligochaeta, Annelida). Gene Expr. Patterns 8, 227–236.

Sun, M.G., Williams, J., Munoz-Pinedo, C., Perkins, G.A., Brown, J.M., Ellisman, M.H., Douglas, R., Green, D.R., Frey, G.T., 2007. Correlated three-dimensional light and electron microscopy reveals transformation of mitochondria during apoptosis. Nat. Cell Biol. 9, 1057–1065.

Sunanaga, T., Saito, Y., Kawamura, K., 2006. Postembryonic epigenesis of Vasa-positive germ cells from aggregated hemoblasts in the colonial ascidian, Botryllus primi-genus. Dev. Growth Differ. 48, 87–100.

Sunanaga, T., Satoh, M., Kawamura, K., 2008. The role of Nanos homologue in gameto-genesis and blastogameto-genesis with special reference to male germ cell formation in the colonial ascidian, Botryllus primigenus. Dev. Biol. 324, 31–40.

Swartz, S.Z., Chan, X.Y., Lambert, J.D., 2008. Localization of Vasa mRNA during early cleavage of the snail Ilyanassa. Dev. Genes Evol. 218, 107–113.

Tadokoro, R., Sugio, M., Kutsuna, J., Tochinai, S., Takahashi, Y., 2006. Early segregation of germ and somatic lineages during gonadal regeneration in the annelid Enchytraeus japonensis. Curr. Biol. 16, 1012–1017.

Takamura, K., Fujimura, M., Yamaguchi, Y., 2002. Primordial germ cells originate from the endodermal strand cells in the ascidian Ciona intestinalis. Dev. Genes Evol. 212, 11–18. Tamori, Y., Iwai, T., Mita, K., Wakahara, M., 2004. Spatio-temporal expression of a DAZ-like gene in the Japanese newt Cynops pyrrhogaster that has no germ plasm. Dev. Genes Evol. 214, 615–627.

Technau, U., Steele, R.E., 2011. Evolutionary crossroads in developmental biology: Cnidaria. Development 138, 447–458.

Torras, R., Gonzalez-Crespo, S., 2005. Posterior expression of nanos orthologs during embryonic and larval development of the anthozoan Nematostella vectensis. Int. J. Dev. Biol. 49, 895–899.

Torras, R., Yanze, N., Schmid, V., González-Crespo, S., 2004. nanos expression at the em-bryonic posterior pole and the medusa phase in the hydrozoan Podocoryne carnea. Evol. Dev. 6, 362–371.

Tsunekawa, N., Naito, M., Sakai, Y., Nishida, T., Noce, T., 2000. Isolation of chicken vasa homolog gene and tracing the origin of primordial germ cells. Development 127, 2741–2750.

Voronina, E., Lopez, M., Juliano, C.E., Gustafson, E., Song, J.L., Extavour, C., George, S., Oliveri, P., McClay, D., Wessel, G., 2008. Vasa protein expression is restricted to the small micromeres of the sea urchin, but is inducible in other lineages early in development. Dev. Biol. 314, 276–286.

Voronina, E., Seydoux, G., Sassone-Corsi, P., Nagamori, I., 2011. RNA granules in germ cells. Cold Spring Harb. Perspect. Biol. 3. doi:10.1101/cshperspect.a002774. Watanabe, H., Hoang, V.T., Mättner, R., Holstein, T.W., 2009. Immortality and the base

of multicellular life: lessons from cnidarian stem cells. Semin. Cell Dev. Biol. 20, 1114–1125.

Weismann, A., 1883. Die Entstehung der Sexualzellen bei den Hydromedusen. Gustav Fischer, Jena.

Weismann, A., 1893. Germ-Plasm, a Theory of Heredity. Scribners, New York. English translation by W. N. Parker and H. Ronnfeldt.

Wu, H.R., Chen, Y.T., Su, Y.H., Luo, Y.J., Holland, L.Z., Yu, J.K., 2011. Asymmetric localiza-tion of germline markers Vasa and Nanos during early development in the amphi-oxus Branchiostomaﬂoridae. Dev. Biol. 353, 147–159.

Yajima, M., Wessel, G.M., 2011. Small micromeres contribute to the germline in the sea urchin. Development 138, 237–243.

Ying, Q.L., Nichols, J., Chambers, I., Smith, A., 2003. BMP induction of Id proteins sup-presses differentiation and sustains embryonic stem cell self-renewal in collabora-tion with STAT3. Cell 115, 281–292.