Making transgenic plants

“Making transgenic plants”

contribution by Ann Depicker

VIB, Ghent University, Belgium

Cost Exploratory Workshop:

What role of GM technology in future

competitiveness of European agri-food sector?

the teams of Jef Schell and Marc Van Montagu “understanding crown gall induction”

1978

Ghent Crown gall group

Three bacterial elements were found

Three bacterial elements were found

to be required for T

to be required for T

-

-

DNA transfer to plants:

DNA transfer to plants:

•

therefore, the whole interior part of the T-DNA could be deleted

and substituted with any other DNA sequence.

Chromosomal genes

Virulence genes

T-DNA border sequences

for tumor growth and opine synthesis but not for T-DNA transfer:

UNIVERSITEIT GENT

1982

cggcaggatatattcaattgtaaa tggcaggatatataccgttgtaat accgtcctatatatggcaacatta gcc gtcctatataagttaacattt T-DNA vir region ori LB RB

Left terminal repeat = LB

Right terminal repeat = RB

UNIVERSITEIT GENT

1983

the

the

first

first

transgenic

transgenic

plants

plants

the first selectable

markers:

kanamycin and

chloramphenicol

resistance

• Border sequences : Right border (RB) and left border (LB) regions • Consists of outer and inner border region

• RB outer region contains an “overdrive” sequence, enhancing T-DNA initiation at the RB

•Border repeat

LB RB

T-DNA

• Border sequences are cloned into a replicon that can replicate into

E. coli for T-DNA construction and into Agrobacterium for

mobilisation of the constructed T-DNA via a vir plasmid to the plant cell

•

mid 90s: first GM crops

focus on

•insect resistance: BT variants

•herbicide resistance

UNIVERSITEIT GENT

•

2000 till now:

world wide spread and increasing use of GM crops except in Europe

Not to grow GM crops in Europe except in Spain is a political decision:

Import of approved GM crops is allowed in Europe but commercial production of approved GM crops is not allowed

The consumer has a choice: labeling of GM crop derived food/feed is obligatory. However separation of the chains will become more and more costly

UNIVERSITEIT GENT

Many more GM crops to come….

• Pest tolerance (viruses, fungi, nematodes..)

• A biotic stress tolerance (drought, salt, high light..) • Yield stability

• Improved nitrogen uptake efficiency

• Growth in alkaline or Fe-restricted soils • Food quality cfr Cathie Martin

• Bio-energy production

• Molecular farming cfr Eva Stoger

– oils, pharmaceuticals, high value proteins.. • Phytoremediation

What do we have to make

transgenic plants?

• a series of vector systems

• various transgene elements

• a selection system

• a target plant

The use of the transgenic plant determines which

criteria are used to screen for a best GM

Techniques for plant transformation

Agrobacterium

-mediated

transformation

Direct gene transfer

• Tissue culture * Root * Leaf * Tissue explants * Embryogenic callus • In planta * Seed transformation * Vacuum infiltration * Floral dip • Particle bombardement (= Biolistics)

• Polyethylene glycol (PEG) • Electroporation

promoter exon1 intron1 exon2 intron2 exon3

mRNA _AUG

5’UTR

UAAUAGUGA AAUAAA poly A

coding sequence or cDNA

3’UTR

Transgene construction

1. promoter and terminator: transcriptional control

2. 5’UTR and 3’UTR: where the transcriptional fusions are made

3. introns are present if a genomic sequence is used 4. coding sequence: especially the codon usage:

optimizing the gene sequence can increase protein expression levels several fold

What are the transformation frequencies?

What are the transformation frequencies?

This is relevant for the question whether selection for a

This is relevant for the question whether selection for a

transformed plant is needed or whether a transformed

transformed plant is needed or whether a transformed

cell could be screened for?

cell could be screened for?

If transformation frequencies are far below 1 %, a selection marker is needed. This is no

problem for research but there is a lot of

opposition to the use of resistance markers in transgenic crops.

The main reason is the fear for spread of antibiotic resistance genes.

Cocultivation

Cocultivation

with

with

Agrobacterium

Agrobacterium

and nonselective regeneration

and nonselective regeneration

Conclusion:

After cocultivation with Agrobacterium, selection is required to obtain

Arabidopsis root explant transformants, but no selection is required to obtain tobacco protoplasts transformants

=>different tissues or types of cells have a different competence for transformation

transformation of root explants of 0 transformants Arabidopsis thaliana /172 plants

transformation of protoplasts of 26 transformants

Regenerated plants Number

Isolated 84

With a transiently expressed C T-DNA 4/84 (5%) With an integrated C T-DNA (transformation) 0/84 (<1%)

• Selection is essential to obtain transgenic Arabidopsis

plants after root transformation

• The T-DNA transfer frequency is approximately 5% and thus more than 10-fold above the T-DNA integration frequency

Transfer and integration frequencies

Transfer and integration frequencies

in

• Cotransformation frequencies are much higher

than expected from the transformation

frequencies: this means that especially the

integration is limiting the transformation

frequencies

• Co-transformed T-DNAs often co-integrate at the

same site and this results in Inverted and

Transformation frequencies are

determined by:

• accessibility of the plant cell to be

transformed

•

Agrobacterium

attachment efficiency and

T-DNA transfer

• competence of the plant cell for T-DNA

integration

Selectable marker genes

on the T-DNA

• Plant transformation is, in many cases, a very-low

frequency event; therefore, selection is needed.

• In most cases, selection is based on the inclusion into the

culture medium of a substance that is toxic to plants. •The classical selectable markers confer resistance to antibiotics and herbicides.

•The recent alternatives are metabolic selection markers (eg.

pmi and dao) and easily screenable visual markers (eg. dsred, gfp).

for instance: a new selectable marker gene on

the T-DNA

The marker has been successfully established in Arabidopsis thaliana, and proven to be versatile, rapidly yielding unambiguous results, and allowing selection immediately after germination

The P35S-dao1 gene (from yeast Rhodotorula gracilis) catalyzes the oxidative deamination of a range of D-amino acids

A gene useful as reporter for transformation: the Green Fluorescent protein (GFP)

WT Advantage of GFP: the assay is non-destructive

Also seed specific Dsred expression allows to pick

immediately the transformed Arabidopsis seeds

Removal of the selectable marker?

• Different ways: cotransformation and

subsequent segregation, removal via site

specific recombination, or screening via PCR

based methods for transformants

• Why remove the selectable marker?

– Primarily to avoid problems with horizontal gene transfer to pathogenic bacteria. However, this does not seem to happen.

– Also to allow subsequent transformation with

additional transgenes: can be circumvented with crossing and PCR screening.

T

T--DNA integrationDNA integration

D

T-DNA integration occurs through illegitimate recombination:

• First, the T-strand is made double stranded in the plant cell

• Then the ds DNA is integrated at random positions

• Parallels are seen with double strand break repair (DSB) and non-homologous end joining (NHEJ) via single strand annealing mechanism

=> T-DNA integration makes use of the plant DNA double strand break repair system

plant DNA preinsertion site

T-DNA

Target site deletion

69 T-DNA plant DNA recombination sites

were sequenced and subdivided in 3 classes:

- 10 % end to end ligations

- 50 % junctions with microhomology

- 40 % junctions with filler DNA

RB junction LB junction

T-DNA integration: integration site can not (yet) be controlled

• T-DNA: random integration: in genes and between genes - no homology between the T-DNA ends and the plant DNA target - preference for open chromatin regions

• plant target DNA shows a deletion of approximately 10 to 100 basepairs

• the ends of the T-DNA are often processed (truncated) up to about 100 basepairs

=> sequence the integration site and subsequent T-DNA

T-DNA integration

• Some transformants contain a single T-DNA copy;

however most transformants contain many T-DNA copies at one locus or at 2 or 3 loci

• Truncated copies may be present and also non-T-DNA or vector DNA may occur (skipping of the border

sequences)

• Many transformants contain unlinked point mutations; translocations occur in 10 to 20 % of the transformants and also aneuploidy is found more often then expected.

=> screen for transformants with a single T-DNA copy and and inbreed this event for several generations

PCR analysis

T-DNA

a b

- Allows to screen transgenic plants for integration of T-DNAs that do not contain a selection marker

- Allows to screen transgenic plants for the presence of silenced T-DNAs

- PCR reaction for internal T-DNA fragments does not allow the determination of copy number of the integrated T-DNAs

- Different transformants with the same T-DNA can not be distinguished

- Allows to screen mixture of plants/crops or food/feed for the presence of GM plants

T-DNA / plant junctions T-DNA

probe

Identification of transgenic plants

Identification of transgenic plants

by Southern analysis

by Southern analysis

T1 T2 T3 T4 T5 T6

Simple transgene insert

The T-DNA plant

junctions are different in every transformant; the number of

fragments indicates the number of T-DNA copies

PCR ANALYSIS

CLEAN TRANSGENE

1 SCREENING AND DETECTION

2 CONSTRUCT SPECIFIC DETECTION

3 EVENT SPECIFIC DETECTION

1

2

10000 1000 100 10 1 0.1 0.01

Determination of GUS activity in 5 T2 plants of

100 transformants obtained after floral dip transformation

100 transgenic plants obtained from 4 different experiments

In an exon: 7

Integration in a transcribed annotated gene: 10 events

Integration in an intergenic region : 9 chrV MQM1 8.05 F12B17 3.3 chrI F5A18 26.30 F12P19 24.25 F14J22 18.05 T18A20 19.80 F14J16 20.6 F2D10 7.2 T4K22 10.75 FK24 F2K3 CK2L102 CK2L72 CK2L36 CK2L111 CK2L6 CK2L129 chrII F2I9 0.22 F14B2 18.1 F13A10 19.25 F2K16 F2Hsb21 chrIII F5E6 2.05 F21A14 14.15 F4F15 19.6 CK2L107 CK2L70 CK2L94 chrIV F14M19 12.35 L23H3 14.90 F8B4 14.85 FH33 F2Hsb20 F2Hsb31 F2Hsb22 CK2L7 T22J18 8.25 CK2L129 CK2L148 In an intron: 3 Characterization of the T-DNA integration position in 19 single-copy transformants

Conclusions

• 21 single copy T-DNA transformants, selected on the expression of

an antibiotic resistance marker, were identified and characterized

• In 19/21 single copy lines, gus expression was similar and not

silenced; in 2/21 lines transgene expression was more than 20-fold lower - In one of those lines, methylation of the transgene was clearly demonstrated

• Integration into an intergenic or genic region, into an exon or an

intron, in sense or antisense orientation, did not result in differential transgene expression

• The presence of binary vector sequences in 2 single copy lines did not have a negative influence on transgene expression

Conclusions

• Single-copy transformants were not the highest expressers

• This implies that multicopy loci are not always inducing transgene silencing. What is triggering the silencing in multicopy loci is not known

• Only very few transformants have no expression of the GUS

reporter gene: this means that complete silencing of a transgene in the first generation is rather rare.

• The silencing degree varies in different transformants and is in leaves typically between 20 and 200 fold.

Last part: in search of the genes

encoding agronomic traits

What to use ?

How to find the genes ?

• Expression data, mutant phenotypes, yeast

complementation, functional assays, prediction, … • Functional genomics in planta screens

– Endogenous genes – Heterologous genes • Bacterial • Yeast • Physcomitrella patens • …

• Plate-based screen of > 1,500 overexpressed transcription factors

• Drought assay (soil grown)

• ~ 40 different transcription factors regulate drought tolerance

• NF-YB (Nelson et al., 2007)

Improved drought physiology Survival assay

Nelson et al., 2007 Mendel Biotechnology & Monsanto

Molecular phenotyping indicates New mode of action

Field efficacy trials

Healthier transgenics: Less leaf rolling Higher chlorophyll index Higher photosynthesis rate Cooler leaf temperature Higher stomatal conductance

Increased ABA sensitivity

No effect on photosynthetic yield

Molecular phenotyping: > 80 at least 2.1 fold upregulated. Enrichment for Osmotic Adjustment genes

Functional equivalence in cyanobacteria and diatoms between ferredoxin and

flavodoxin under iron deficiency

Other Fd-dependent reactions

Fld

• Photosynthetic microorganisms compensate Fd decline by inducing Flavodoxins. • Flds: ~19kDa with 1 noncovalently bound flavin mononucleotide as prosthetic group • Not sensitive to oxidative conditions

• Efficient replacement of Fd in NADP+ reduction, nitrogen fixation, sulfite reduction,. • Flds are restricted to prokaryotes and some eukaryotic algae.

Plants expressing a cyanobacterial flavodoxin in chloroplasts develop increased tolerance to various sources of environmental stress

pfld4-2

pfld12-4

18 h at 500 µmol quanta m-2 s-1 and 40o_C

20 days at 500 µmol quanta m-2 _s-1_{and 9}o_C

3-day water deprivation regime

18 h to a focused light beam of 2,000 µmol quanta m-2_s-1

20 min to UV-C radiation

UV-AB radiation for 24 h

Future of GM plants in Europe?

• will depend on the sound and flexible re-evaluation of the legal framework

• this will determine whether there is a market for GM crops in Europe

Anyway,

• the technology is available to introduce a variety of traits • the perspectives promise a future which plant