DOI: 10.1534/genetics.107.072876
Genetic Dissection of Parallel Sister-Chromatid Cohesion Pathways
Hong Xu,*
,†Charles Boone*
,†,1and Grant W. Brown
†,‡,1,2*Banting and Best Department of Medical Research, Department of Medical Genetics and Microbiology, University of Toronto, Toronto, Ontario M5S 1A8, Canada,†Terrence Donnelly Centre for Cellular and Biomolecular Research,
University of Toronto, Toronto, Ontario M5S 3E1, Canada and‡Department of Biochemistry, University of Toronto, Toronto, Ontario M5S 1A8, Canada
Manuscript received March 4, 2007 Accepted for publication April 25, 2007
ABSTRACT
Sister-chromatid cohesion, the process of pairing replicated chromosomes during mitosis and meiosis, is mediated through the essential cohesin complex and a number of nonessential cohesion genes, but the specific roles of these nonessential genes in sister-chromatid cohesion remain to be clarified. We analyzed sister-chromatid cohesion in double mutants ofmrc1D,tof1D, andcsm3Dand identified additive cohesion defects that indicated the existence of at least two pathways that contribute to sister-chromatid cohesion. To understand the relationship of other nonessential cohesion genes with respect to these two pathways, pairwise combinations of deletion and temperature-sensitive alleles were tested for cohesion defects. These data defined two cohesion pathways, one containingCSM3,TOF1,CTF4, andCHL1, and the second containingMRC1,CTF18,CTF8, andDCC1. Furthermore, we found that the nonessential genes are not important for the maintenance of cohesion at G2/M. Thus, our data suggest that nonessential cohesion genes make critical redundant contributions to the establishment of sister-chromatid cohesion and define two cohesion pathways, thereby establishing a framework for understanding the role of nonessential genes in sister-chromatid cohesion.
S
ISTER-CHROMATID cohesion is mediated by cohe-sin, an essential complex that is conserved across species and that in Saccharomyces cerevisiae consists of Smc1, Smc3, Scc1, and Scc3 (Strunnikovet al. 1993;Guacci et al. 1997; Michaelis et al. 1997; Tothet al.
1999). This core particle is assembled onto chromo-somes by the loading complex Scc2/Scc4 (Ciosket al.
2000). Establishment of sister-chromatid cohesion re-quires Eco1 (Skibbenset al. 1999; Tothet al. 1999) and
its maintenance is mediated through Pds5 (Hartman
et al. 2000; Panizzaet al. 2000). At the
metaphase-to-anaphase transition, the cleavage of cohesin by Esp1 leads to the equal segregation of sister chromatids to mother and daughter cells (Ciosk et al. 1998). In
ad-dition to these essential genes, there are a number of nonessential genes that contribute to efficient sister-chromatid cohesion (Hanna et al. 2001; Mayer et al.
2001, 2004; Naiki et al. 2001; Skibbens 2004; Warren
et al. 2004; Xuet al. 2004). Mutant forms of these
non-essential cohesion genes typically have mild cohesion defects (15–30% premature sister-chromatid separation) at both chromosome arm and centromere regions (Hannaet al. 2001; Mayeret al. 2001, 2004; Naikiet al.
2001; Skibbens 2004; Warren et al. 2004; Xu et al.
2004). By contrast, essential cohesion mutants exhibit 50–60% premature sister-chromatid separation at these loci (Guacciet al. 1997; Michaeliset al. 1997; Skibbens
et al. 1999; Tothet al. 1999). In addition to their
co-hesion roles, nonessential coco-hesion genes also partici-pate in other cellular processes, such as the S-phase replication checkpoint (Alcasabas et al. 2001; Foss
2001; Bellaouiet al. 2003; Tonget al. 2004; Pan et al.
2006). A number of nonessential cohesion genes have been identified in large-scale synthetic-lethal genetic interaction screens (Mayer et al. 2004; Tonget al.
2004; Warren et al. 2004), which identify conditions
under which these genes are required for viability; how-ever, the mechanism by which nonessential cohesion genes promote sister-chromatid cohesion and their func-tional relationships with one another remains unclear. Genes-encoding members of the Ctf18 replication factorC(RFC)-like complex were among the first non-essential genes reported to have roles in sister-chromatid cohesion. Ctf18, Dcc1, and Ctf8 physically interact with the Rfc2-Rfc3-Rfc4-Rfc5 core, but do not interact with the large subunit of the canonical RFC, Rfc1 (Hanna
et al. 2001; Mayeret al. 2001; Naikiet al. 2001). Removal
of any of the nonessential Ctf18-RFC components re-sults in precocious dissolution of cohesion, and double and triple deletions fail to display any additive effects, suggesting that the three subunits work together as a complex to promote cohesion (Mayeret al. 2001).
Ctf18-RFC catalyzes both loading and unloading of the sliding 1These authors contributed equally to this work.
2Corresponding author:CCBR, University of Toronto, 160 College St.,
Room 1206, Toronto, ON M5S 3E1, Canada. E-mail: [email protected]
clamp PCNA around DNAin vitro(Bermudezet al. 2003;
Shiomi et al. 2004; Bylund and Burgers 2005) and
deletion ofCTF18results in a reduction in the levels of PCNA at arrested replication forks in early S phase (Lengronneet al. 2006). Ctf18-RFC is also involved in
S-phase checkpoint activation. Althoughctf18Dhas no detectable checkpoint defect, the double mutantsctf18D rad24Dandctf18Drad9Dare checkpoint defective (Naiki
et al. 2001; Bellaoui et al. 2003; Pan et al. 2006). In
addition, mutants in genes encoding Ctf18 complex members are sensitive to the DNA-damaging agents camptothecin and methyl methanesulfonate (MMS) and the replication inhibitor HU (Naiki et al. 2001;
Changet al. 2002; Bellaouiet al. 2003; Kanelliset al.
2003; Parsonset al. 2004), further suggesting a role in
the DNA damage response.
In addition to its role in sister-chromatid cohesion (Hanna et al. 2001), Ctf4 has close links to DNA
rep-lication. It binds to DNA polymeraseawith high affinity (Milesand Formosa1992; Zhouand Wang2004) and
is found in a high-molecular-weight complex with the GINS and MCM complexes, Cdc45, Mrc1, Tof1, and Csm3, and the histone chaperone FACT (Gambuset al.
2006; Lengronne et al. 2006). Recent data indicate
that Ctf4 is a component of elongating replication forks (Lengronne et al. 2006). Although not essential in
budding yeast, its homolog in fission yeast,mcl11 , is es-sential for viability, and overexpression ofmcl11
causes an S-phase delay (Williamsand Mcintosh2002). The
ctf4deletion mutant displays genetic interactions with mutants in DNA replication genes, DNA damage check-point response genes, spindle assembly checkcheck-point genes, and genes involved in sister-chromatid cohesion, micro-tubule function, and chromosome structure (Tonget al.
2004), further suggesting that Ctf4 functions in diverse chromosome metabolism pathways.
Like Ctf4, the nonessential cohesion genes Mrc1, Tof1, and Csm3 also have intimate connections to DNA replication. All three proteins are present at replication forks during normal S-phase progression (Katouet al.
2003; Osbornand Elledge2003; Gambuset al. 2006).
Mrc1 and Tof1 are thought to be important in stabilizing stalled replication forks, as deletion ofMRC1orTOF1 leads to the uncoupling of replication fork proteins from sites of DNA synthesis when replication is arrested by hydroxyurea (Katouet al. 2003). Although Mrc1, Tof1,
and Csm3 have common cellular roles, there are im-portant differences between Mrc1 and Tof1/Csm3. De-letion ofMRC1has a more dramatic effect on activation of the replication checkpoint than deletion ofTOF1, whereas Tof1 and Csm3, but not Mrc1, are critical for replication fork pausing at replication fork barriers (Calzadaet al. 2005; Tourriereet al. 2005).
Chl1 is involved in the establishment, but not the main-tenance, stage of sister-chromatid cohesion (Petronczki
et al. 2004). It is a putative DNA helicase, having an es-sential ATP-binding site, and is localized to the nucleus
(Skibbens2004). In addition to being required for the
establishment of sister-chromatid cohesion (Petronczki
et al. 2004; Skibbens2004), Chl1 has a role in
transcrip-tional silencing, rDNA recombination, and aging (Das
and Sinha2005). Unlike other nonessential cohesion
genes (CTF4, CTF18,CTF8, andDCC1), which are re-quired for transcriptional silencing at both HMR and telomeres (Suteret al. 2004), the absence ofCHL1
re-sults in increased silencing at HMR and, conversely, in decreased silencing at the telomere (Das and Sinha
2005). The different phenotypes of these cohesion fac-tors in transcriptional silencing could reflect the differ-ent mechanisms by which the corresponding proteins establish cohesion and affect chromatin structure.
A number of other nonessential cohesion factors have been discovered by genetic screens:BIM1,KAR3,CHL4, RAD27, RRM3,RAD50,SRS2, SGS1,RSC2, and RAD61 (Mayeret al. 2004; Warrenet al. 2004). In addition to
their roles in sister-chromatid cohesion, they all have other cellular roles.BIM1 and KAR3encode microtu-bule-binding proteins involved in spindle assembly and spindle orientation (Endowet al. 1994; Pageet al. 1994;
Schwartzet al. 1997; Bloom2000). The gene product
of CHL4 is an outer kinetochore protein (Mythreye
and Bloom2003; Pot et al. 2003). RAD50,XRS2, and
MRE11are involved in DNA damage repair (Nakada
et al. 2003) while RAD27plays roles in both DNA rep-lication and repair (Gary et al. 1999; McHugh et al.
2000; Boiteuxand Guillet2004; Torreset al. 2004).
RRM3,SRS2, andSGS1are all DNA helicases involved in DNA replication, repair, and recombination (Ivessa
et al. 2002; Barbourand Xiao2003; Macrisand Sung
2005).RAD61is involved in resistance to ionizing radi-ation (Game et al. 2003) and RSC2 encodes a
non-essential subunit of the RSC chromatin-remodeling complex (Baetzet al. 2004). These connections between
sister-chromatid cohesion and diverse cellular functions suggest that sister-chromatid cohesion impinges on mul-tiple cellular processes and that diverse functions are important for sister-chromatid cohesion.
Although the list of nonessential genes that are in-volved in sister-chromatid cohesion continues to grow, little is known about how these genes contribute to sister-chromatid cohesion. To understand the cohesion role of nonessential cohesion genes, and their relation-ship to each other, we created a series of double mutants and performed cohesion assays on these double mu-tants. Taking advantage of the data from large-scale synthetic-lethal screens (Tonget al. 2004), we were able
MATERIALS AND METHODS
Strains:Strains used in this study are listed in supplemental Table S1 at http://www.genetics.org/supplemental/. Standard yeast media and growth conditions were used (Sherman
1991).
Assessing sister-chromatid cohesion: Strains used for co-hesion assays are in the W303 background. The wild-type strain was YPH1477 (MATaade2-1 trp1-1 can1-100 his3-11, 15 leu2T LEU2tetR-GFP ura3T3xURA3tetO112 PDS1-13myc-TRP1), which contains the tet operator array inserted 35 kb from CEN5. Mutants used in cohesion assays were all created in YPH1477. For cohesion assays, strains were grown to midexponential phase in YPD, collected by centrifugation, resuspended in pH 3.9 YPD medium containing 2mg/mla-factor and grown for 2–3 hr at 30°. The G1block was monitored by the formation of shmoos. Cells were then collected by centrifugation and washed with normal-pH YPD medium once before releasing into YPD medium containing 15mg/ml nocodazole for 1.5 hr at 30°(or other temperatures as indicated). Cell pellets were collected by centrifugation and fixed in 4% paraformaldehyde for 5 min, washed once with SK buffer (1msorbitol, 0.05m
K2PO4), and resuspended in SK for cohesion assessment. Cells were briefly sonicated prior to microscopic examination. One GFP spot per cell indicates closely linked sister chromatids. Two GFP spots within one cell in the presence of nocodazole indicates premature separation of sister chromatids. For temperature-sensitive (ts) alleles, the G1 block was carried out at 26°for 3 hr, followed by release into YPD1nocodazole at 37°for 1.5 hr before fixation.
To quantify sister-chromatid cohesion, the percentage of cells with two GFP dots from at least 200 cells was calculated. Each experiment was repeated two to three times with different transformants for each genotype, and the average and standard deviation was plotted. To rule out effects of aneuploidy, G1cells (blocked ina-factor) were tested in every cohesion assay. Statistical analysis (t-test) was performed for some cohesion assays to identify significant differences in sister-chromatid separation.
Pds1 assay:Cells were arrested in G1witha-factor, released in the presence of nocodazole, and fixed with paraformalde-hyde after 90 min. GFP and PDS1-13myc were detected by indirect immunofluorescence in nocodazole-arrested, para-formaldehyde-fixed cells using GFP (Abcam) and anti-myc (9E10; Roche) antibodies, respectively, as described (Mayeret al. 2004).
Immunoprecipitation and immunoblotting: Immunopre-cipitation was performed essentially as described (Naikiet al.
2001). Briefly, 25 OD600of midlog phase cells were lysed in 50 mmHEPES, pH 7.5, 100 mmNaCl, 10% glycerol, 1 mm
EDTA, 1 mm DTT containing protease inhibitors (5 mg/ml
leupeptin, 2mg/ml pepstatin A, 1 mmPMSF, 5mg/ml
1-chloro-3-tosylamido-7-amino-2-heptanone, 2.5mg/ml aprotinin, 1 mm
DTT). Equal amounts of cell lysate were immunoprecipitated using anti-myc antibody (9E10; Roche) followed by incubation with protein G agarose. Ten percent of the input extract and 50% of the immunoprecipitate were fractionated by 7.5% SDS– PAGE and tagged proteins were detected on Western blots with anti-myc antibodies or peroxidase–antiperoxidase (Sigma, St. Louis). Immunoblots were developed using Supersignal ECL (Pierce, Rockford, IL). Protein samples for Rad53 activation assays were prepared by trichloroacetic acid fixation and ana-lyzed on immunoblots as described (Bellaouiet al. 2003).
Synchronization and flow cytometry:Cells were arrested in G1with 2mg/mla-factor for 2–3 hr at 30°(or 26°for ts strains) in pH 3.9 YPD. Cells were released into the cell cycle by har-vesting, washing, and resuspending in normal pH YPD. Flow cytometry was performed as described (Changet al. 2002).
Creating temperature-sensitive mutants: Temperature-sensitive mutants were generated by random PCR mutagenesis with the PCR random mutagenesis kit from BD Biosciences. CSM3 was amplified with the primers 59-TGATATACTGG ATTAAAATGCCATGAAAACGTGAACAGAAACTTTTATTGA GGTC39 and 59-GGGACGAGGCAAGCTAAACAGATCTCTG CCGGTGCTGATAATACGG-39. TheURA3cassette was ampli-fied by regular PCR with the primers 59-TAGATGCCCACACG CACGTTTGGATTATTACCTTCAATGACATTGGAATTCGA GCTCGTTTAAACTGGA-39and 59-AGATCTGTTTAGCTTGC CTCGT-39. Homologous sequences were designed in the CSM3andURA3PCR primers to ensure that these two PCR products could recombine byin vivohomologous recombina-tion in yeast. MutagenizedCSM3and regular amplifiedURA3 were cotransformed into yeast strain Y4681 (MATactf18DT natR can1DTMFA1pr-HIS3-MFa1pr-LEU2 his3D0 leu2D0 ura3D0 lys2D0) and selected on SD–URA plates. Temperature-sensitive transformants were screened by replica plating to 37° and further confirmed by PCR and tetrad analysis.
TheCTF8ts allele was created with the same method asCSM3 in the strain Y4413 (tof1DTnatR can1DTMFA1pr-HIS3-MFa 1pr-LEU2 his3D0 leu2D0 ura3D0 lys2D0) with the primers 59-AG TGATAGAAAAAAGAATTATCACTATCATTCAGCCCAATAAA CAGCTGAAAAGA-39 and 59-GGGACGAGGCAAGCTAAACA GATCTACAACTCCGAACAATAACTAAGTAC-39for PCR muta-genesis. The URA3 cassette was amplified by regular PCR with the primers 59-ACACTTTACACAGAGCGTGAAGTCTGCGCC AAATAACATAAACAAGAATTCGAGCTCGTTTAAACTGGA-39 and 59-AGATCTGTTTAGCTTGCCTCGT-39. When ts alleles were moved between different strain backgrounds, transform-ants with the ts phenotype were selected and further confirmed by PCR and sequence analysis.
RESULTS
Physical interactions among Mrc1, Tof1, and Csm3: Mrc1, Tof1, and Csm3 share common roles in DNA replication, S-phase checkpoint, and sister-chromatid cohesion. Genetic interactions with SRS2 suggest that these three genes may also be important for homologous recombination (Xuet al. 2004). Physical interaction
be-tween Tof1 and Csm3 has been described (Mayeret al.
2004), suggesting that these proteins function in a com-plex. To explore a physical link between Mrc1 and Tof1/ Csm3, we tagged the C terminus of Mrc1p with 13 myc epitopes in a Csm3-TAP-tagged strain. Immunoprecipi-tation of Mrc1-13myc specifically co-immunoprecipitated Csm3-TAP from extracts prepared from Mrc1-13myc Csm3-TAP cells (Figure 1A). The association of Mrc1 with Csm3 was also observed when the immunoprecip-itation was carried out with rabbit IgG to pull down Csm3-TAP (data not shown). These results are in agree-ment with mass spectrometric analysis of affinity-purified Csm3 and Mrc1 (Nedelcheva et al. 2005), which also
interacts with Mrc1, this interaction is not required for Csm3 and Tof1 to interact.
Mrc1 promotes sister-chromatid cohesion in a pathway that is parallel to Tof1 and Csm3: Despite the physical interactions among Mrc1, Tof1, and Csm3 and the common roles shared by these three proteins, synthetic genetic data suggested that they function in parallel pathways: there are synthetic-sick interactions betweenmrc1Dandcsm3Dand betweenmrc1Dandtof1D, suggesting that they may function distinctly, but not betweentof1Dandcsm3D, further suggesting that these genes may function within the same pathway (Tonget al.
2004). These genetic interactions could reflect redun-dancy betweenMRC1andTOF1/CSM3in the establish-ment of sister-chromatid cohesion. To test this possibility, all pairwise double mutants were created withmrc1D, tof1D, andcsm3Dand the strains were assayed for defects in sister-chromatid cohesion. To perform the cohesion analysis, single and double deletions were constructed in YPH1477, which contains a Tet repressor-GFP fusion as well as Tet operator repeats located 35 kb from the
centromere of chromosome V. Strains containing these deletions were grown logarithmically, arrested in G1for
2–3 hr, and then released into nocodazole for 1.5 hr. Cells were then fixed and the number of GFP foci per cell was scored (Figure 2, A and B). In the wild-type control, two GFP foci were evident in 5% of cells. Deletion ofMRC1,TOF1, orCSM3caused mild cohesion defects with 20% of cells exhibiting two GFP foci (Figure 2B). This level of precocious sister-chromatid separation was similar to previous reports (Mayeret al.
2004; Xuet al. 2004). Bothmrc1Dtof1Dandmrc1Dcsm3D
double mutants exhibited an additive cohesion defect relative to the relevant single mutants (Figure 2B), with
40% of cells displaying two GFP foci. By contrast, the tof1Dcsm3Ddouble mutant had only 20% of cells with two GFP foci, a level similar to that seen in the single mu-tants. Although high levels of cohesion loss were scored formrc1Dtof1Dandmrc1Dcsm3D, these double mutants had not entered anaphase, as evidenced by the high percentage of cells (.85%) that displayed Pds1 staining, as assessed by indirect immunofluorescence (Figure 2C). Moreover, we found that .90% of the cells with separated sister chromatids had high levels of Pds1, indicating that these cells had not initiated anaphase (Figure 2C).
To examine the effect of nocodazole in the cohesion assays, the timing of sister-chromatid separation in wild-type and mutant cells was scored after first arresting cells in G1phase witha-factor and then releasing them into
rich medium without nocadazole. In mrc1D tof1D and mrc1Dcsm3Dmutant strains, cells with two GFP dots ac-cumulated 40 min after a-factor release, which was at least 20 min earlier than wild type (Figure 2, D–F). Ad-ditionally, Pds1 degradation in the double mutants was delayed compared to wild-type cells. Therefore, inmrc1D tof1D andmrc1Dcsm3D, a high percentage of cells dis-played separated sister chromatids in the presence of Pds1 (i.e., prior to the initiation of anaphase). Thus, the high level of precocious separation of sister chro-matids that we observed in themrc1Dtof1Dandmrc1D csm3Ddouble mutants was not dependent on the use of a nocodazole arrest.
In addition to promoting sister-chromatid cohesion, MRC1andTOF1also play roles in DNA replication and in S-phase checkpoint activation. We testedmrc1Dtof1D double mutants for defects in S-phase progression and checkpoint activation (Figure 3). Flow cytometric anal-ysis of DNA contents during progression through S phase indicated thatmrc1Dtof1Dcompleted DNA rep-lication with kinetics that were almost identical totof1D and slightly accelerated relative tomrc1D(Figure 3A). In all strains, DNA replication was completed 60 min after release from the G1 arrest. Although the checkpoint
function ofMRC1is not required forMRC1to promote sister-chromatid cohesion (Xuet al. 2004), we assessed
S-phase checkpoint activation in themrc1Dtof1Ddouble mutant by detecting the characteristic mobility shift of Figure1.—Mrc1 physically interacts with Csm3. (A) Extracts
phosphorylated Rad53 on immunoblots following treat-ment with MMS (Figure 3B). Themrc1D tof1D double mutant displayed a Rad53 mobility shift similar to that seen inmrc1D. Therefore, in contrast to the additive co-hesion defect seen in the double mutant, we did not observe either an additive defect in S-phase progression or a defect in S-phase checkpoint activation in mrc1D tof1Ddouble mutants.
Together, these data support two conclusions: First, nonessential cohesion mutants, when combined, can result in additive cohesion defects. Second, Mrc1 and Tof1/Csm3 appear to promote sister-chromatid cohe-sion via distinct pathways, as deletion ofMRC1andTOF1 or ofMRC1andCSM3resulted in an additive cohesion defect, whereas deletion ofTOF1andCSM3did not.
Examining a temperature-sensitive conditional allele ofCSM3inctf18Dcells:Cohesion epistasis analysis with mrc1D,tof1D, andcsm3Dindicated that Mrc1 had a role in cohesion distinct from that of Tof1 and Csm3. This
suggested that there were at least two pathways to pro-mote sister-chromatid cohesion, one involving the Tof1/Csm3 complex and the other involving Mrc1. We next sought to understand the relationship of other nonessential cohesion genes with respect to these two putative pathways. In particular, we were interested in examining the relative contributions of Tof1/Csm3 and the Ctf18 complex to sister-chromatid cohesion.
Large-scale genetic analysis identified similarities be-tween the genetic interaction profiles of Csm3/Tof1 and those of genes encoding components of the Ctf18 complex (Tonget al. 2004), suggesting that these two
complexes function in similar cellular processes. How-ever, double mutants carrying mutations in CSM3 or TOF1and mutations in genes encoding members of the Ctf18 complex generally show a synthetic-lethal pheno-type, implying a parallel relationship between these two complexes. Due to this synthetic lethality, we were un-able to perform cohesion epistasis with deletion alleles. Figure 2.—mrc1D tof1D
andmrc1Dcsm3Dexhibit ad-ditive cohesion defects rela-tive to single mutants. (A) Micrographs ofmrc1Dtof1D in which one sister-chroma-tid locus was visualized with TetR-GFP. (Top) DIC image. (Bottom) Fluorescence im-age. (B) Analysis of cohesion in wild-type and mutant strains at 30°in nocodazole-arrested cells. The relevant genotypes are indicated, and the number of GFP signals in each cell was scored for at least two independent strains in independent ex-periments. At least 200 cells were scored for each strain. (C) The percentage of cells with Pds1 signal was deter-mined for all cells, and for cells with two GFP foci. Pds1-18myc protein was de-tected by indirect immuno-fluorescence. (D–F) Analysis of cohesion in wild-type (D), mrc1Dtof1D (E), and mrc1D
To examine the relative contributions of Tof1/Csm3 and the Ctf18 complex to sister-chromatid cohesion, random mutagenic PCR was used to generate acsm3ts allele in actf18Ddeletion mutant. By screening5000 transformants, one allele (csm3-9) was isolated that dis-played a ts conditional-lethal phenotype in thectf18D deletion strain background. Sequence analysis revealed four mutational alterations in thecsm3-9mutant: Tyr95 changed to His, Lys105 to Thr, Ile275 to Ser, and Asp307 to Gly. To assess the cellular morphology of the ts strain csm3-9 ctf18D, log-phase cultures of wild-type and single and double mutants were shifted from the permissive temperature (26°) to the restrictive temperature (37°) for 4 hr. At 37°,csm3-9 ctf18Ddisplayed an accumulation of large-budded cells when compared to wild type (Figure 4A). The relative fractions of unbudded cells,
cells with a small bud, cells with a large bud and a single nucleus at or near the bud neck, large-budded cells with an elongated nucleus spanning the bud neck, or large-budded cells with divided nuclei were measured follow-ing fixation and DAPI stainfollow-ing of wild-type, sfollow-ingle-, and double-mutant cells grown at 37°for 4 hr (Figure 4B). The csm3-9 ctf18D double mutant accumulated a high fraction of large-budded cells with a single nucleus close to or across the bud neck (Figure 4B), indicating a mi-totic delay, most likely pre-anaphase. Flow cytometric analysis of asynchronously growing csm3-9 ctf18D re-vealed accumulation of cells with 2C DNA content even at the permissive temperature (26°) (Figure 4C).
This mitotic delay could have arisen by activation of the DNA damage checkpoint pathway or the spindle assembly checkpoint pathway. To determine the mech-anism of this mitotic delay, triple mutants were con-structed in combination with eitherrad9Dto inactivate the DNA damage checkpoint pathway ormad2Dto in-activate the spindle assembly checkpoint pathway. De-letion of RAD9 had no effect on the mitotic delay of csm3-9 ctf18Dat the restrictive temperature (Figure 4D). By contrast, there was a reduction in the fraction of large-budded cells in the csm3-9 ctf18D mad2D triple mutant (Figure 4D). These results indicated that the mi-totic delay in thecsm3-9 ctf18Ddouble mutant requires a functional spindle assembly checkpoint.
Csm3/Tof1 and Ctf18-RFC complexes function in parallel cohesion pathways: We examined the relative contributions of Csm3 and the Ctf18-RFC complex to sister-chromatid cohesion. We transferredcsm3-9to the wild-type cohesion testing strain and to the cohesion testing strain carryingctf18D. At the permissive temper-ature, thecsm3-9 ctf18Ddouble mutant displayed a level of separated sister chromatids that was similar to that seen in thectf18Dsingle mutant (Figure 5A). By con-trast, at the restrictive temperature, there was a sub-stantial increase in the frequency of separated GFP dots incsm3-9 ctf18D. This increase was additive when com-pared to the single mutants and therefore suggested that Csm3 and Ctf18 function in parallel cohesion path-ways. It is worth noting that the high fraction of cells displaying separated sister chromatids (almost 60%) was similar to that seen in mutants in essential cohesion genes (Guacciet al. 1997; Michaeliset al. 1997; Toth
et al. 1999; Ciosk et al. 2000). To further confirm this
result,csm3-9was transferred to a cohesion testing strain carrying ctf8D. As in csm3-9 ctf18D, there was a much higher premature separation of sister chromatids in csm3-9 ctf8Dthan incsm3-9orctf8Dsingle mutants at the restrictive temperature (Figure 5A). Similarly, when csm3-9 dcc1Dwas constructed, this double mutant also showed an additive cohesion defect relative to the single mutants (Figure 5A). These data indicate that Csm3 and the three nonessential members of the Ctf18-RFC com-plex function in parallel pathways to promote sister-chromatid cohesion.
Figure3.—mrc1Dtof1Ddoes not exhibit additive replication
To define the relationship between Tof1 and Ctf18-RFC in promoting cohesion, we again required a conditional allele because of the synthetic-lethal genetic interactions between tof1D and deletion mutants of genes encoding Ctf18-RFC members (Mayeret al. 2004).
As was done with Csm3, mutant forms of CTF8 were created by random PCR mutagenesis and transformed into a tof1D strain. Temperature-sensitive alleles were isolated by replica plating to high temperature. Using this approach, ninectf8mutant alleles were generated, andctf8-17was selected for further analysis because of its Figure5.—(A)csm3-9exhibits additive cohesion defects when
combined with mutants inctf8,ctf18, ordcc1. Sister-chromatid cohesion assays were performed at both the permissive (26°) and the restrictive temperature (37°) in nocodazole-arrested cells. The relevant genotypes are indicated, and the number of GFP signals in each cell was scored for at least two indepen-dent strains in indepenindepen-dent experiments. At least 200 cells were scored for each strain. (B)ctf8-17has an additive cohesion defect withcsm3Dandtof1D. Cohesion assays were performed at the restrictive temperature (37°) following arrest in nocoda-zole. The number of GFP signals in each cell was scored for at least two independent strains in independent experiments and at least 200 cells were scored for each strain.
Figure4.—csm3-9 ctf18Daccumulates large-budded cells at
the restrictive temperature. (A) DIC images of wild type (left) andcsm3-9 ctf18D(right) after growth at the restrictive tem-perature (37°) for 4 hr. (B) Nuclear morphology of wild-type, csm3-9,ctf18D, andcsm3-9 ctf18Dstrains was scored by staining with DAPI after 4 hr at the restrictive temperature (37°). Nu-clear morphology was classified into five categories as
tight ts phenotype in thetof1Dbackground. Sequence analysis identified four point mutations inctf8-17:Asp7 changed to Glu, Gln62 to Arg, Arg69 to Gln, and Ile103 to Thr.
We then transferred ctf8-17 into cohesion testing strains carryingtof1Dorcsm3D. When cohesion analysis was performed at the restrictive temperature, bothtof1D ctf8-17andcsm3Dctf8-17showed higher levels of sepa-rated sister chromatids than did the single mutants (Figure 5B). Taken together with the results from the co-hesion analysis of csm3-9 double mutants, these data indicate that the Ctf18-RFC complex functions in a co-hesion pathway that is distinct from the Tof1/Csm3 complex.
Mrc1 functions in the same cohesion pathway as the Ctf18-RFC complex: Cohesion analysis with double mutants indicated that Csm3/Tof1 and the Ctf18-RFC complex were in different cohesion pathways and that Csm3 and Mrc1 were in different cohesion pathways. These data raised two possibilities: either Mrc1 acts in the same pathway as the Ctf18-RFC complex members or there are more than two nonessential pathways that promote sister-chromatid cohesion. To distinguish be-tween these possibilities, we created an mrc1D ctf8-17 cohesion testing strain. Strikingly, when cohesion was analyzed at the restrictive temperature, mrc1D ctf8-17 exhibited a level of cohesion defect similar to that seen in themrc1Dsingle mutant (Figure 6A). This suggested that Mrc1 was in the same cohesion pathway as the Ctf18-RFC complex. To verify this result, ctf8-54, an allele ofctf8that displayed a slow-growth phenotype, was tested in combination withmrc1D. As was seen with ctf8-17 mrc1D,ctf8-54 mrc1Dalso showed a level of separated sister chromatids that was not significantly different from that displayed by the single mutants (Figure 6A). Given thatmrc1Ddisplayed an additive cohesion defect withcsm3Dandtof1D, but not withctf8-17, we concluded that Mrc1 and the Ctf18-RFC complex were in the same sister-chromatid cohesion pathway, in parallel with the Csm3/Tof1 cohesion pathway.
One possibility raised by these data was that a defect in sister-chromatid cohesion could have been masked by the inability of themrc1Dctf8-17double mutant to com-plete S phase and produce sister-chromatid DNA. How-ever, flow cytometric analysis of DNA contents during progression through S phase indicated thatmrc1D ctf8-17completed DNA replication with kinetics that were almost identical to mrc1D (Figure 6B). In all strains, DNA replication was completed by 50 min aftera-factor release; therefore, at the time that the cohesion assay was performed (90 min aftera-factor release), the sister chromatids were fully replicated. Thus, failure to com-plete DNA replication was not likely to be the cause of the absence of an additive cohesion defect inmrc1Dctf8-17.
Ctf4 and Chl1 function in the Csm3/Tof1 cohesion pathway:Our results indicated that there are two sister-chromatid cohesion pathways: one pathway mediated by
Csm3 and Tof1 and another pathway containing the Ctf18-RFC complex and Mrc1. Genes encoding mem-bers of both the Csm3 complex and the Ctf18 complex display genetic interactions with additional genes in-volved in sister-chromatid cohesion (Mayeret al. 2001,
2004; Tonget al. 2004). We tested whether these genes
define additional cohesion pathways.
In particular,CTF4has genetic interactions with both theCSM3and theCTF18pathway:ctf4Dis synthetically sick withcsm3Dandtof1Dand synthetically lethal with ctf8Dandmrc1D(Tonget al. 2004). To understand the
relationship betweenCTF4and the two cohesion pathways, Figure6.—CTF8is in the same cohesion pathway asMRC1.
double mutants were constructed betweenctf4Dand mu-tants in each pathway. The cohesion analysis demon-strated thatctf4D had no additive cohesion defect with csm3D, but did display an additive cohesion defect with ctf8-17(Figure 7A). This result placedCTF4in theCSM3/ TOF1cohesion pathway, in parallel with theCTF18-RFC/ MRC1pathway.
CHL1, which encodes a DNA helicase, is another nonessential gene that promotes sister-chromatid co-hesion (Mayeret al. 2004).chl1Dis synthetically lethal
with deletion mutants in genes encoding Ctf18-RFC members and is synthetically sick withmrc1D, but has no genetic interaction withcsm3Dor tof1D, implying that CHL1may be in the same cohesion pathway asTOF1and
CSM3. To test this hypothesis, a series of double mutants were created in cohesion testing strains: chl1D csm3D, chl1D ctf8-17, ctf4D chl1D, and chl1D mrc1D. Cohesion analysis with these strains demonstrated thatchl1Dhad no additive cohesion defect withcsm3Dorctf4D, but dis-played additive cohesion defects with bothctf8-17and mrc1D(Figure 7B). Since the difference in cohesion loss betweenmrc1Dchl1Dand each single mutant was small, a statistical analysis (t-test) was performed. The differ-ence in cohesion loss was statistically significant for mrc1Dchl1Dandchl1D(P,0.05) and formrc1Dchl1D andmrc1D(P,0.01). These data placedCHL1in the CSM3cohesion pathway, together withTOF1andCTF4. Nonessential cohesion pathways are required before M phase: Establishment of sister-chromatid cohesion occurs during S phase (Uhlmannand Nasmyth1998)
and must be maintained during G2/M (Nasmyth1999).
We tested whether the function of the nonessential co-hesion pathways was required at G2/M by introducing
the temperature-sensitive mutants ctf8-17 tof1D and csm3-9 ctf8Dinto a cohesion test strain in which Cdc20 was expressed under the control of the GAL1-10 pro-moter. Repressing the expression of Cdc20 by growth in glucose medium leads to the accumulation of cells at the metaphase-to-anaphase transition (Visintin et al.
1997). When cells were incubated at the permissive tem-perature (25°) before and after arrest, bothctf8-17 tof1D and csm3-9 ctf8D displayed a background level of co-hesion loss due to the single gene deletion (Figure 8, open bars). When cells were arrested at 37°, high levels of cohesion loss were observed (Figure 8, shaded bars). By contrast, when cells were arrested at the metaphase-to-anaphase transition at the permissive temperature and then shifted to the restrictive temperature, cohesion loss remained at background levels (Figure 8, solid bars). The scc1-73 strain displayed increased cohesion loss when shifted to the restrictive temperature either before or after arrest, as would be expected for a gene that functions in both the establishment of cohesion in S phase and the maintenance of cohesion in G2phase.
Thescc2-4 strain exhibited loss of cohesion when Scc2 was inactivated before, but not after, arrest at the metaphase-to-anaphase transition, consistent with the role of Scc2 in the loading of cohesin but not in the maintenance of sister-chromatid cohesion (Ciosket al.
2000). Since the pattern of cohesion loss for bothctf8-17 tof1D and csm3-9 ctf8D most closely resembled that of scc2-4, we conclude that the nonessential cohesion path-ways described by Ctf8 and Csm3 were not required for the maintenance of cohesion during G2/M.
DISCUSSION
In recent years, the number of nonessential cohesion genes found to have important roles in sister-chromatid cohesion has steadily increased (Stead et al. 2003;
Baetzet al. 2004; Mayeret al. 2004; Warrenet al. 2004;
Figure7.—Ctf4 and Chl1 are additional members of the
Xuet al. 2004). In contrast to essential cohesion
com-ponents, mutants in nonessential cohesion genes show only mild precocious sister-chromatid separation. By analyzing double mutants, we found that nonessential cohesion mutants, when combined, lead to increased levels of sister-chromatid separation and that the levels of sister-chromatid separation in the double mutants are similar to those seen in essential cohesion gene mu-tants. This indicates that nonessential cohesion genes make critical and redundant contributions to sister-chromatid cohesion.
Although some double cohesion mutants had addi-tive cohesion defects, this was not the case for every pos-sible pairwise combination of double mutants, which indicated that there are different pathways or categories for the genes in sister-chromatid cohesion. By classifying the genes without additive cohesion defect into the same pathway and the genes with additive cohesion de-fect into different cohesion pathways, we found that
there were two pathways by which nonessential genes promote sister-chromatid cohesion. The classification of these two pathways by cohesion analysis was largely correlated with the genetic interaction data: there were mostly synthetic-lethal interactions between members of the different pathways, while there were either no interactions or only synthetic-sick interactions between members of the same pathway (Figure 9).
The two cohesion pathways identified in this study were mediated through two complexes: the Tof1/Csm3 complex and the Ctf18-RFC complex. In addition to these two complexes, each pathway consists of additional members, with Ctf4 and Chl1 in the same pathway as the Tof1/Csm3 complex and Mrc1 in the same pathway as the Ctf18-RFC complex. One reasonable possibility is that the additional pathway members have physical interactions with the known Tof1/Csm3 or Ctf18-RFC complexes. Indeed, Ctf4 was found to be in a high-molecular-weight complex with Tof1/Csm3 (Gambus
et al. 2006). However, we were unable to detect physical Figure9.—Cohesion analysis correlates with genetic
inter-actions between two cohesion pathways. Results of cohesion analysis are represented by straight blue lines. Solid blue lines indicate additive cohesion defects in double mutants; dashed blue lines indicate an absence of an additive cohesion defect in double mutants. Genetic interactions are represented by curved red lines. Solid red lines indicate synthetic-lethal inter-actions; dashed red lines indicate synthetic-sick interactions. Where there is no red line between two genes, a genetic inter-action was not evident. The genetic interinter-actions for each sub-unit of the Ctf18 complex, and for Tof1 and Csm3, are the same; therefore only one line is used to link each complex with other genes. Genetic interaction data are from Tong
et al. (2004). Figure 8.—The nonessential cohesion genes are not
interactions between Tof1/Csm3 and Chl1 or between Mrc1 and Ctf18-RFC (data not shown). It is possible that physical links among components in the same cohesion pathway are indirect or transient.
Curiously, although Mrc1 was classified into a co-hesion pathway parallel to Tof1/Csm3, we detected a physical interaction between Mrc1 and Csm3. Our co-hesion analysis indicates that the function of Mrc1 in promoting sister-chromatid cohesion is unlikely to re-quire complex formation with Tof1/Csm3 as Mrc1 and Tof1/Csm3 make independent contributions to cohe-sion. Consistent with this, analysis of Tof1/Csm3/Mrc1 complexes indicates that Mrc1 is a substoichiometric component of a stoichiometric Tof1/Csm3 complex (Nedelchevaet al. 2005). Additional evidence suggests
that Mrc1 and Tof1/Csm3 reside in separate pathways. The Tof1/Csm3 complex, but not Mrc1, is specifically required for fork pausing in the rDNA and at other natural pausing sites (Tourriereet al. 2005).
Further-more, Tof1/Csm3 and Mrc1 function in redundant pathways in the response to DNA damage induced by topoisomerase I poisons (Redonet al. 2006). It will be of
great interest to determine the architecture of the pro-tein complexes that underlie our genetic observations. Several lines of evidence support a direct link between DNA replication and sister-chromatid cohesion. The recruitment of the cohesin loading factor Scc2 onto chromatin requires DNA replication licensing in Xen-opus egg extracts (Gillespie and Hirano 2004). In
mammalian cells, stably bound cohesin, which is specu-lated to form the topological links between sister chro-matids, can be established only co-replicationally (Gerlich
et al. 2006). InSchizosaccharomyces pombe, mutant forms ofhsk11
anddfp11
, which are essential for the initiation of replication initiation, have cohesion defects (Takeda
et al. 2001; Bailiset al. 2003). InS. cerevisiae, the origin
recognition complex components Orc5 and Orc2, which are essential for replication, promote cohesion in a pathway parallel to cohesin (Suteret al. 2004; Shimada
and Gasser 2007). Additionally, direct physical links
have been found between the cohesin subunit Smc1 and DNA replication proteins inS. cerevisiae(Ryuet al. 2006)
and also between Eco1 and PCNA, a cofactor of DNA polymerase (Moldovanet al. 2006). Like the essential
genes, a number of nonessential cohesion genes also have links with DNA replication. Mrc1, Tof1, Csm3, Ctf4, and Ctf18 are all found at DNA replication forks (Katouet al.
2003; Osborn and Elledge2003; Gambus et al. 2006;
Lengronneet al. 2006). Mrc1 functions constitutively to
promote normal replication fork progression (Szyjka
et al. 2005; Tourriereet al. 2005) and Tof1/Csm3 is
critical for replication fork pausing (Tourriereet al.
2005; Mohantyet al. 2006). These data support models
in which the establishment of sister-chromatid cohesion is coupled with DNA replication during S phase and is intimately connected to the progression of DNA repli-cation forks.
Two models of cohesion establishment have been described, one in which cohesion is established passively by passage of the replication fork through a cohesin ring that encircles the DNA (Haering et al. 2002; Gruber
et al. 2003) and one in which interactions between co-hesin complexes on sister chromatids establish cohe-sion (Campbell and Cohen-Fix2002; Milutinovich
and Koshland2003; Huanget al. 2005). Roles for the
nonessential cohesion pathways that we have described can readily be envisaged in the context of either model. In the first model, a role for appropriate replisome ar-chitecture has recently been proposed (Lengronne
et al. 2006), alluding to the possibility that the replisome might have to be the correct shape to pass through the cohesin ring without disrupting it. Replisomes lacking certain fork components, such as the nonessential co-hesion proteins studied here, might cause a partial phenotype in which not every cohesin ring is disrupted, which could account for those components being non-essential and for mutants in single components not re-sulting in detectable disruption or redistribution of bound cohesin (Lengronneet al. 2006). Since we have
found that two nonessential cohesion pathways make redundant contributions to sister-chromatid cohesion, it will be of particular interest to determine whether the cohesin redistribution or disruption that this model pre-dicts can be detected in double mutants in which both nonessential cohesion pathways are disrupted. Another possible function of the nonessential cohesion pathways that is relevant to this first model is that they are important primarily as determinants of replisome integ-rity (Lengronneet al. 2006). When replisome integrity
sister chromatid. In this view, the nonessential cohesion proteins could function as redundant factors that facil-itate loading and unloading of cohesin during passage of the replication fork.
Recent work has identified additional unique path-ways that contribute to sister-chromatid cohesion: one at chromosome arm sites that is mediated by the con-densin chromosome condensation complex (Lamet al.
2006) and one that is mediated by the origin recognition complex in a pathway parallel to the cohesin pathway (Shimada and Gasser 2007). Here we have classified
eight nonessential cohesion genes into two pathways that contribute to the establishment of sister-chromatid sion. As additional nonessential sister-chromatid cohe-sion genes are identified, it will be of interest to determine if they define additional pathways to promote cohesion or if they can be placed in either of the two pathways that we have identified or into the condensin- or ORC-dependent pathways. This determination will be greatly facilitated by the availability of the conditional alleles ofcsm3andctf8.
We thank Phil Hieter and Kim Nasmyth for strains and Bri Lavoie for valuable discussions and advice on cohesion assays and Pds1 staining. This work was supported by grants from the Canadian Institutes of Health Research to G.W.B. and to C.B., Genome Canada to C.B., and Genome Ontario to C.B. G.W.B. is a Research Scientist of the National Cancer Institute of Canada.
LITERATURE CITED
Alcasabas, A. A., A. J. Osborn, J. Bachant, F. Hu, P. J. Werleret al.,
2001 Mrc1 transduces signals of DNA replication stress to acti-vate Rad53. Nat. Cell Biol.3:958–965.
Baetz, K. K., N. J. Krogan, A. Emili, J. Greenblattand P. Hieter,
2004 The ctf13–30/CTF13 genomic haploinsufficiency modi-fier screen identifies the yeast chromatin remodeling complex RSC, which is required for the establishment of sister chromatid cohesion. Mol. Cell. Biol.24(3): 1232–1244.
Bailis, J. M., P. Bernard, R. Antonelli, R. C. Allshireand S. L.
Forsburg, 2003 Hsk1-Dfp1 is required for
heterochromatin-mediated cohesion at centromeres. Nat. Cell Biol.5:1111–1116. Barbour, L., and W. Xiao, 2003 Regulation of alternative
replica-tion bypass pathways at stalled replicareplica-tion forks and its effects on genome stability: a yeast model. Mutat. Res.532:137–155. Bellaoui, M., M. Chang, J. Ou, H. Xu, C. Booneet al., 2003 Elg1
forms an alternative RFC complex important for DNA replication and genome integrity. EMBO J.22:4304–4313.
Bermudez, V. P., Y. Maniwa, I. Tappin, K. Ozato, K. Yokomoriet al.,
2003 The alternative Ctf18-Dcc1-Ctf8-replication factor C complex required for sister chromatid cohesion loads proliferating cell nuclear antigen onto DNA. Proc. Natl. Acad. Sci. USA100:10237–10242. Bloom, K., 2000 It’s a kar9ochore to capture microtubules. Nat. Cell
Biol.2:E96–E98.
Boiteux, S., and M. Guillet, 2004 Abasic sites in DNA: repair and
bio-logical consequences in Saccharomyces cerevisiae. DNA Rep.3:1–12. Bylund, G. O., and P. M. Burgers, 2005 Replication protein
A-directed unloading of PCNA by the Ctf18 cohesion establishment complex. Mol. Cell. Biol.25:5445–5455.
Calzada, A., B. Hodgson, M. Kanemaki, A. Bueno and K. Labib,
2005 Molecular anatomy and regulation of a stable replisome at a paused eukaryotic DNA replication fork. Genes Dev. 19(16): 1905–1919.
Campbell, J. L., and O. Cohen-Fix, 2002 Chromosome cohesion:
Ring around the sisters? Trends Biochem. Sci.27(10): 492–495. Chang, M., M. Bellaoui, C. Booneand G. W. Brown, 2002 A
genome-wide screen for methyl methanesulfonate-sensitive mutants reveals genes required for S phase progression in the presence of DNA damage. Proc. Natl. Acad. Sci. USA99:16934–16939.
Ciosk, R., W. Zachariae, C. Michaelis, A. Shevchenko, M. Mann
et al., 1998 An ESP1/PDS1 complex regulates loss of sister chro-matid cohesion at the metaphase to anaphase transition in yeast. Cell93:1067–1076.
Ciosk, R., M. Shirayama, A. Shevchenko, T. Tanaka, A. Tothet al.,
2000 Cohesin’s binding to chromosomes depends on a sepa-rate complex consisting of Scc2 and Scc4 proteins. Mol. Cell5:
243–254.
Das, S. P., and P. Sinha, 2005 The budding yeast protein Chl1p has a
role in transcriptional silencing, rDNA recombination, and ag-ing. Biochem. Biophys. Res. Commun.337(1): 167–172. Endow, S. A., S. J. Kang, L. L. Satterwhite, M. D. Rose, V. P. Skeen
et al., 1994 Yeast Kar3 is a minus-end microtubule motor pro-tein that destabilizes microtubules preferentially at the minus ends. EMBO J.13:2708–2713.
Foss, E. J., 2001 Tof1p regulates DNA damage responses during S
phase inSaccharomyces cerevisiae. Genetics157:567–577. Gambus, A., R. C. Jones, A. Sanchez-Diaz, M. Kanemaki, F. van
Deursenet al., 2006 GINS maintains association of Cdc45 with
MCM in replisome progression complexes at eukaryotic DNA replication forks. Nat. Cell Biol.8:358–366.
Game, J. C., G. W. Birrell, J. A. Brown, T. Shibata, C. Baccariet al.,
2003 Use of a genome-wide approach to identify new genes that control resistance of Saccharomyces cerevisiae to ionizing radia-tion. Radiat. Res.160(1): 14–24.
Gary, R., M. S. Park, J. P. Nolan, H. L. Cornelius, O. G. Kozyreva
et al., 1999 A novel role in DNA metabolism for the binding of Fen1/Rad27 to PCNA and implications for genetic risk. Mol. Cell. Biol.19:5373–5382.
Gerlich, D., B. Koch, F. Dupeux, J. M. Petersand J. Ellenberg,
2006 Live-cell imaging reveals a stable cohesin-chromatin inter-action after but not before DNA replication. Curr. Biol.16(15): 1571–1578.
Gillespie, P. J., and T. Hirano, 2004 Scc2 couples replication
li-censing to sister chromatid cohesion in Xenopus egg extracts. Curr. Biol.14(17): 1598–1603.
Gruber, S., C. H. Haeringand K. Nasmyth, 2003 Chromosomal
cohesin forms a ring. Cell112(6): 765–777.
Guacci, V., D. Koshlandand A. Strunnikov, 1997 A direct link
be-tween sister chromatid cohesion and chromosome condensation re-vealed through the analysis of MCD1 in S. cerevisiae. Cell91:47–57. Haering, C. H., J. Lowe, A. Hochwagen and K. Nasmyth,
2002 Molecular architecture of SMC proteins and the yeast co-hesin complex. Mol. Cell9(4): 773–788.
Hanna, J. S., E. S. Kroll, V. Lundbladand F. A. Spencer, 2001
Sac-charomyces cerevisiae CTF18 and CTF4 are required for sister chromatid cohesion. Mol. Cell. Biol.21:3144–3158.
Hartman, T., K. Stead, D. Koshlandand V. Guacci, 2000 Pds5p is
an essential chromosomal protein required for both sister chro-matid cohesion and condensation in Saccharomyces cerevisiae. J. Cell Biol.151:613–626.
Huang, C. E., M. Milutinovichand D. Koshland, 2005 Rings,
bracelet or snaps: fashionable alternatives for Smc complexes. Philos. Trans. R. Soc. Lond. B Biol. Sci.360(1455): 537–542. Ivessa, A. S., J. Q. Zhou, V. P. Schulz, E. K. Monsonand V. A.
Zakian, 2002 Saccharomyces Rrm3p, a 59to 39DNA helicase
that promotes replication fork progression through telomeric and subtelomeric DNA. Genes Dev.16:1383–1396.
Kanellis, P., R. Agyeiand D. Durocher, 2003 Elg1 forms an
alter-native PCNA-interacting RFC complex required to maintain ge-nome stability. Curr. Biol.13:1583–1595.
Katou, Y., Y. Kanoh, M. Bando, H. Noguchi, H. Tanakaet al.,
2003 S-phase checkpoint proteins Tof1 and Mrc1 form a stable replication-pausing complex. Nature424:1078–1083.
Lam, W. W., E. A. Peterson, M. Yeungand B. D. Lavoie, 2006
Con-densin is required for chromosome arm cohesion during mitosis. Genes Dev.20(21): 2973 –2984.
Lengronne, A., J. McIntyre, Y. Katou, Y. Kanoh, K. P. Hopfner
et al., 2006 Establishment of sister chromatid cohesion at the S. cerevisiae replication fork. Mol. Cell23(6): 787–799. Macris, M. A., and P. Sung, 2005 Multifaceted role of the
Saccharomy-ces cerevisiae Srs2 helicase in homologous recombination regula-tion. Biochem. Soc. Trans.33:1447–1450.
Mayer, M. L., S. P. Gygi, R. Aebersoldand P. Hieter, 2001
complex required for sister chromatid cohesion in S. cerevisiae. Mol. Cell7:959–970.
Mayer, M. L., I. Pot, M. Chang, H. Xu, V. Aneliunas et al.,
2004 Identification of protein complexes required for efficient sister chromatid cohesion. Mol. Biol. Cell15:1736–1745. McHugh, P. J., W. R. Sonesand J. A. Hartley, 2000 Repair of
in-termediate structures produced at DNA interstrand cross-links in Saccharomyces cerevisiae. Mol. Cell. Biol.20:3425–3433. Michaelis, C., R. Cioskand K. Nasmyth, 1997 Cohesins:
chromo-somal proteins that prevent premature separation of sister chro-matids. Cell91(1): 35–45.
Miles, J., and T. Formosa, 1992 Evidence that POB1, a
Saccharomy-ces cerevisiae protein that binds to DNA polymerase alpha, acts in DNA metabolism in vivo. Mol. Cell. Biol.12:5724–5735. Milutinovich, M., and D. E. Koshland, 2003 Molecular biology.
SMC complexes—wrapped up in controversy. Science 300
(5622): 1101–1102.
Mohanty, B. K., N. K. Bairwaand D. Bastia, 2006 The
Tof1p-Csm3p protein complex counteracts the Rrm3p helicase to con-trol replication termination of Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA103(4): 897–902.
Moldovan, G. L., B. Pfanderand S. Jentsch, 2006 PCNA controls
establishment of sister chromatid cohesion during S phase. Mol. Cell23(5): 723–732.
Mythreye, K., and K. S. Bloom, 2003 Differential kinetochore
pro-tein requirements for establishment versus propagation of cen-tromere activity in Saccharomyces cerevisiae. J. Cell Biol.160:
833–843.
Naiki, T., T. Kondo, D. Nakada, K. Matsumotoand K. Sugimoto,
2001 Chl12 (Ctf18) forms a novel replication factor C-related complex and functions redundantly with Rad24 in the DNA rep-lication checkpoint pathway. Mol. Cell. Biol.21:5838–5845. Nakada, D., K. Matsumotoand K. Sugimoto, 2003 ATM-related
Tel1 associates with double-strand breaks through an Xrs2-dependent mechanism. Genes Dev.17:1957–1962.
Nasmyth, K., 1999 Separating sister chromatids. Trends Biochem.
Sci.24(3): 98–104.
Nedelcheva, M. N., A. Roguev, L. B. Dolapchiev, A. Shevchenko,
H. B. Taskovet al., 2005 Uncoupling of unwinding from DNA
synthesis implies regulation of MCM helicase by Tof1/Mrc1/ Csm3 checkpoint complex. J. Mol. Biol.347:509–521. Osborn, A. J., and S. J. Elledge, 2003 Mrc1 is a replication fork
component whose phosphorylation in response to DNA replica-tion stress activates Rad53. Genes Dev.17:1755–1767. Page, B. D., L. L. Satterwhite, M. D. Roseand M. Snyder, 1994
Lo-calization of the Kar3 kinesin heavy chain-related protein requires the Cik1 interacting protein. J. Cell Biol.124:507–519.
Pan, X., P. Ye, D. S. Yuan, X. Wang, J. S. Baderet al., 2006 A DNA
integrity network in the yeast Saccharomyces cerevisiae. Cell124:
1069–1081.
Panizza, S., T. Tanaka, A. Hochwagen, F. Eisenhaber and K.
Nasmyth, 2000 Pds5 cooperates with cohesin in maintaining
sister chromatid cohesion. Curr. Biol.10:1557–1564.
Parsons, A. B., R. L. Brost, H. Ding, Z. Li, C. Zhang et al.,
2004 Integration of chemical-genetic and genetic interaction data links bioactive compounds to cellular target pathways. Nat. Biotechnol.22(1): 62–69.
Petronczki, M., B. Chwalla, M. F. Siomos, S. Yokobayashi, W.
Helmhartet al., 2004 Sister-chromatid cohesion mediated by
the alternative RF-CCtf18/Dcc1/Ctf8, the helicase Chl1 and the polymerase-alpha-associated protein Ctf4 is essential for chromatid disjunction during meiosis II. J. Cell Sci.117:3547–3559. Pot, I., V. Measday, B. Snydsman, G. Cagney, S. Fields et al.,
2003 Chl4p and iml3p are two new members of the budding yeast outer kinetochore. Mol. Biol. Cell14:460–476.
Redon, C., D. R. Pilchand W. M. Bonner, 2006 Genetic analysis
of Saccharomyces cerevisiae H2A serine 129 mutant suggests a functional relationship between H2A and the sister-chromatid cohesion partners Csm3-Tof1 for the repair of topoisomerase I-induced DNA damage. Genetics172:67–76.
Ryu, M. J., B. J. Kim, J. W. Lee, M. W. Lee, H. K. Choi et al.,
2006 Direct interaction between cohesin complex and DNA replication machinery. Biochem. Biophys. Res. Commun.
341(3): 770–775.
Schwartz, K., K. Richardsand D. Botstein, 1997 BIM1 encodes
a microtubule-binding protein in yeast. Mol. Biol. Cell8:2677–2691. Sherman, F., 1991 Getting started with yeast. Meth. Enzymol.194:
3–21.
Shimada, K., and S. M. Gasser, 2007 The origin recognition
com-plex functions in sister-chromatid cohesion in Saccharomyces cerevisiae. Cell128:85–99.
Shiomi, Y., A. Shinozaki, K. Sugimoto, J. Usukura, C. Obuseet al.,
2004 The reconstituted human Chl12-RFC complex functions as a second PCNA loader. Genes Cells9(4): 279–290.
Skibbens, R. V., 2004 Chl1p, a DNA helicase-like protein in budding
yeast, functions in sister-chromatid cohesion. Genetics166:33–42. Skibbens, R. V., L. B. Corson, D. Koshland and P. Hieter,
1999 Ctf7p is essential for sister chromatid cohesion and links mitotic chromosome structure to the DNA replication machin-ery. Genes Dev.13:307–319.
Stead, K., C. Aguilar, T. Hartman, M. Drexel, P. Meluhet al.,
2003 Pds5p regulates the maintenance of sister chromatid co-hesion and is sumoylated to promote the dissolution of coco-hesion. J. Cell Biol.163(4): 729–741.
Strunnikov, A. V., V. L. Larionovand D. Koshland, 1993 SMC1:
an essential yeast gene encoding a putative head-rod-tail protein is required for nuclear division and defines a new ubiquitous pro-tein family. J. Cell Biol.123:1635–1648.
Suter, B., A. Tong, M. Chang, L. Yu, G. W. Brownet al., 2004 The
origin recognition complex links replication, sister chromatid co-hesion and transcriptional silencing inSaccharomyces cerevisiae. Genetics167:579–591.
Szyjka, S. J., C. J. Viggianiand O. M. Aparicio, 2005 Mrc1 is
re-quired for normal progression of replication forks throughout chromatin in S. cerevisiae. Mol. Cell19(5): 691–697.
Takeda, T., K. Ogino, K. Tatebayashi, H. Ikeda, K. Araiet al.,
2001 Regulation of initiation of S phase, replication checkpoint signaling, and maintenance of mitotic chromosome structures during S phase by Hsk1 kinase in the fission yeast. Mol. Biol. Cell
12:1257–1274.
Tong, A. H., G. Lesage, G. D. Bader, H. Ding, H. Xu et al.,
2004 Global mapping of the yeast genetic interaction network. Science303:808–813.
Torres, J. Z., S. L. Schnakenbergand V. A. Zakian, 2004
Sac-charomyces cerevisiae Rrm3p DNA helicase promotes genome integrity by preventing replication fork stalling: viability of rrm3 cells requires the intra-S-phase checkpoint and fork restart activities. Mol. Cell. Biol.24(8): 3198–3212.
Toth, A., R. Ciosk, F. Uhlmann, M. Galova, A. Schleifferet al.,
1999 Yeast cohesin complex requires a conserved protein, Eco1p(Ctf7), to establish cohesion between sister chromatids during DNA replication. Genes Dev.13:320–333.
Tourriere, H., G. Versini, V. Cordon-Preciado, C. Alabertand
P. Pasero, 2005 Mrc1 and Tof1 promote replication fork
pro-gression and recovery independently of Rad53. Mol. Cell 19:
699–706.
Uhlmann, F., and K. Nasmyth, 1998 Cohesion between sister
chro-matids must be established during DNA replication. Curr. Biol.
8(20): 1095–1101.
Visintin, R., S. Prinzand A. Amon, 1997 CDC20 and CDH1: a
fam-ily of substrate-specific activators of APC-dependent proteolysis. Science278(5337): 460–463.
Warren, C. D., D. M. Eckley, M. S. Lee, J. S. Hanna, A. Hugheset al.,
2004 S-phase checkpoint genes safeguard high-fidelity sister chromatid cohesion. Mol. Biol. Cell15(4): 1724–1735. Williams, D. R., and J. R. McIntosh(Editors), 2002 mcl11, the
Schizosaccharomyces pombe homologue of CTF4, is important for chromosome replication, cohesion, and segregation. Eukaryot. Cell1(5): 758–773.
Xu, H., C. Booneand H. L. Klein, 2004 Mrc1 is required for sister
chromatid cohesion to aid in recombination repair of spontane-ous damage. Mol. Cell. Biol.24(16): 7082–7090.
Zhou, Y., and T. S. Wang, 2004 A coordinated temporal interplay of
nucleosome reorganization factor, sister chromatin cohesion fac-tor, and DNA polymerase alpha facilitates DNA replication. Mol. Cell. Biol.24(21): 9568–9579.