• No results found

Site-directed mutations altering the CAAX box of Ste18, the yeast pheromone-response pathway G gamma subunit.

N/A
N/A
Protected

Academic year: 2020

Share "Site-directed mutations altering the CAAX box of Ste18, the yeast pheromone-response pathway G gamma subunit."

Copied!
10
0
0

Loading.... (view fulltext now)

Full text

(1)

Copyright 0 1994 by the Genetics Society of America

Site-Directed

Mutations

Altering

the

CAAX

Box

of

Stel8,

the

Yeast

Pheromone-Response Pathway

G y

Subunit

M.

S.

Whiteway

and

D.

Y.

Thomas

Eukaryotic Genetics Group, Biotechnology Research Institute, National Research Council of Canada, Montreal H4P 2R2, Canada

Manuscript received April 23, 1994

Accepted for publication May 5, 1994

ABSTRACT

The STEl8gene encodes the y subunit of the G protein which functions in the Saccharomyces cerevisiae

pheromone-response pathway. The STEl8 gene product undergoes a post-translational processing at the carboxyl terminus directed by the CCAAXbox motif CCTLM,,,. Avariety of site-directed mutations of this sequence have been constructed to test the role of this motif on Stel8 function. Mutations which change or eliminate the cysteine at position 107 abolish StelMependent mating, and thus the cysteine (C107) is essential for Stel8 function. However, inactivation of the prenylmansferase by disruption of DPRl has only a minor effect on StelMependent mating. Mutation of cysteine 106 to serine significantly reduces but does not eliminate Stel8 function. Deletion of the Gterminal TLM sequence or modification of the ultimate methionine to lysine, arginine or leucine, all changes which do not affect the CAAXbox cysteines, have only minor effects on StelMependent mating. Intriguingly, these latter mutations dramatically compromise Stel8 function in cells which are deleted for Gpal, the (Y subunit of the G protein. In addition,

overexpression of these mutant versions of STEZ 8 causes a dominant negative phenotype and inhibits the constitutive mating response generated by GPA Z deletion in cells which contain a functional STEZ 8 gene. These results suggest that the C terminus of Stel8 and the Gpal protein have overlapping roles in some aspect of yeast G protein function such as membrane targeting.

A

NUMBER of proteins involved in eukaryotic signal transduction pathways have been found to be modified by the addition of an isoprenoid lipid at or near their carboxyl terminus. Such lipid-modified pro- teins include RAS and a variety of other small GTP- binding proteins, as well as the a and ? subunits of some heterotrimeric G proteins (CHOW et al. 1992; COX and DER 1992; SINENSKY and LUTZ 1992). Because these pro- teins are typically associated with cellular membranes, it has been proposed that one role of these modifications is to provide a membrane anchor (HANCOCK et al. 1990; SIMONDS et al. 1991; SPEIGEL et al. 1991).

Recently it has been found that the particular lipid added to the modified proteins can be either a C,, far- nesyl group, or a C,, geranylgeranyl group. The signal that specifies which lipid is added appears to reside within the C terminus of the protein to be modified. A

specific Gterminal motif, the CAAX box (where C is cysteine, A is an aliphatic residue, and X is a variety of residues) or, more generally, the CXXX box, appears to direct the particular lipid modification to a subset of proteins (COX and DER 1992). The further distinction between the C,, and C,, isoprenoid group is determined at least in part by the ultimate residue of this motif; when Xis methionine, alanine, serine, cysteine o r glu- tamine a farnesyl moiety is added (REISS et al. 1991;

MOORES et al. 1991), whereas when X is leucine or phenylalanine, a geranylgeranyl group is added

(MOORES et al. 1991). A second C-terminal motif, ei-

Genetics 137: 967-976 (August, 1994)

ther CC or CXC, together with certain other residues, also directs the addition of a geranylgeranyl lipid (KHOSRAVI-FAR et al. 1991; SEABRA et al. 1992; Cox and DER 1992). This relatively complex situation has been further complicated by the recent finding that the distinction between farnesylated proteins and gera- nylgeranylated proteins is not absolute; it appears that in the case of the mammalian rhoB gene prod- uct, either farnesyl or geranylgeranyl can be added

(ADAMSON et al. 1992), and that a similar cross- specificity exists for the yeast Ras (TRUEBLOOD et al.

1993) and a-factor proteins (CALDWELL et al. 1994). Genetic studies in yeast and biochemical studies in mammalian cells have led to the suggestion that there are at least three different enzymes (each an a / p het- erodimer) for the addition of Gterminal lipids. One en- zyme, farnesyltransferase ( R a s e ) , adds C,, lipids to CAAXbox proteins (CHEN et al. 1991; KOHL et al. 1991), while two geranylgeranyltransferases (GGTase I and GGTase 11) add C,, lipids to CAAL and to CC or CXC proteins respectively (MOORES et al. 1991; SEABRA et al.

1992). The yeast farnesyltransferase activity depends on two gene products; DPRl (RAMI, STEl6, SGP2)

(GOODMAN et al. 1990), and RAM2 (KOHL et al. 1991; HE et al. 1991). The DPRl gene product has sequence simi- larity to the

p

subunit of the purified mammalian ITase (GOODMAN et al. 1988; CHEN et al. 1991), while the

RAM2 gene product has sequence similarity to the a

(2)

968 M. S. Whiteway and D. Y. Thomas

The yeast CAAL box-recognizing geranylgeranyltrans- ferase activity also requires the activity of the RAM2 gene product, as well as the product of the C D C 4 3 ( C A L I ) gene (KOHL et al. 1991; FINEGOLD et al. 1991). CDC43 has sequence similarity to both DPRl and the mamma- lian mase

p

subunit (JOHNSON et al. 1991; OHYA et al.

1991). Consistent with a model based on the genetic evidence that R a s e and GGTase I share a common a subunit and have different specificitydetermining

p

subunits, the purified mammalian ETase shares a com- mon a subunit with the mammalian GGTase I (SEABRA et al. 1991). Finally, a third yeast gene, BET2 has been identified with sequence similarity to DPRl (ROSSI et al. 1991). This gene is required for the functioning of the SEC4 and YPTl gene products, both of which are small RASlike proteins ending in the GGTase I1 target se- quence CC (ROSSI et al. 1991). RAM2 is not required for GGTase I1 activity in yeast (KOHL et al. 1991), but a Ram2-like protein encoded by the MAD2 gene has re- cently been identified to be required for this activity (LI et al. 1993; JIANG et al. 1993).

We have exploited the nonessential nature and easy quantification of the Saccharomyces cerevisiae phero- mone response pathway to investigate the role of the Gterminal modification of the yeast Gy subunit STEl8. We have constructed a variety of site-directed mutations in the C A A X box of this protein to test the roles of the various amino acids of the CAAX box in the pheromone response of yeast. In particular, we have asked whether changing the farnesyldirecting CAAXbox CTLM to the geranylgeranyldirecting CTLL motif affects the biologi- cal function of the yeast S T E l 8 gene product, and we have investigated the influence of other subunits of the heterotrimeric G protein on the function of the mutant Gy subunits.

MATERIALS AND METHODS

Plasmid constructions: To facilitate site directed mutagen- esis, the STEl8 gene was cloned in the high copy 2p-based vector pVT100-U (VERNET et al. 1987) to create plasmid M70p2

(WHITEWAY et al. 1992). Plasmid M135p3 was constructed as described previously (WHITEWAY et al. 1992). Versions of plas- mid M70p2 containing the mutations C106S, C107S, TlOSter, M110K and M11OL were changed into integrating plasmids by deleting a HpaI fragment that removes the 2p origin of replication.

Site-direeted mutagenesis: Mutagenesis was performed as

described by FINECoLD et al. (1990). The oligonucleotides used for each modification are listed in Table 1; changes from the target sequence are shown in lower case. The mutant ClO6ter (termination codon) was derived from the wild-type sequence and included the addition of a SalI site (underlined). The mutants C106S, C107S and the double mutant C106S,C107S were derived from ClO6ter and identified through the loss of the SalI site. The mutant T108ter (termination codon) was derived from the wild-type sequence and identified through formation of a NdeI site (underlined). The mutant M1 lOKwas also derived from the wild-type sequence and identified through the formation of an AfzII site (underlined). Finally, the MllOL mutant was derived from the MllOK mutant and

TABLE 1

Oligonucleotides

Wild type AACTCAAATAGTGTTTGTTGTACGCTTATGTAATGATAGTA ClO6ter ACTCAAATAGTGTTTagTcgACGCTTATGTAATGA C106S TCAAATAGTGTTTcGTgtACGCTTATGTAA C107S CTCAAATAGTGTTTgtTCGACGCTTAT C106S,C107S CTCAAATAGTGTTTcaTCGACGCTTATG

T108ter ATAGTGTTTGTTGTtaGCaTATGTAATGATAGTA

MllOK TTGTACGCTTAaGTAATGATAGTA

MllOL AACTCAAATAGTGTTTGTTGTACGCTTttGTAATGATAGTA

identified through the loss of the AfzII site. The mutants were confirmed by DNA sequencing (SANGER et al. 1977).

Mating assays: Patch matings were performed by replica plating the tester strain and the patches of strains to be mated to a single YPD plate, and the plate was incubated overnight at 30" and then replica plated to minimal medium to detect the presence of prototrophic diploids. Quantitative matings were performed as described (WHITEWAY et al. 1988).

Pheromone response assays: Pheromone response assays were performed as described (WHITEWAY et al. 1989), except that the medium was "ura to select for plasmid carrying cells.

Strains: Strains used in this study are listed in Table 2.

Transposon mutagen& Plasmid pBR322DPR1 (GOODMAN

et al. 1988) was mutagenized using the mini TnlO LUKsystem as described by HUISMAN et al. (1987). Insertions in the DPRl gene were identifed by restriction analysis and cut with BamHI and SalI to target disruption to the chromosome. One inser- tion (1.10) was found to give a URA3' linked temperature- sensitive phenotype and MATa-specific sterility when used to generate one-step disruptions; this mutation mapped to the middle of the DPRl locus and was used for all subsequent manipulations.

Transformations: The lithium acetate transformation pro- tocol (ITO et al. 1983) was used.

Strain construction: The strain Dlll(M135p3) was con-

structed by transforming strain Dl11 with partially BstXI cleaved M135p3 to target the plasmid to the HIS3 locus. Trans- formants were selected on medium lacking histidine, and screened for those which could generate haploid spores that arrest cell division and form morphologically aberrant cells when grown on galactose medium.

Strains containing the Gterminal mutant versions of the STE18 gene were constructed by a two-step procedure. The integrating versions of plasmid M70p2 containing the Gterminal mutations C106S, C107S and MllOK were linear- ized with BstXI, then transformed into strain W3031A and URA3' transformants were selected. Subsequently ura3- de- rivatives were selected by growth in the presence of 5-fluoroorotic acid (5-FOA) (BOEKE et al. 1986), and colonies that had become simultaneously ura3- and mating defective were selected. To ensure that the totally sterile strains derived from the C107S allele contained the replacement and not some unrelated sterile mutation, the STE18 region was am- plified by the polymerase chain reaction (SAIKI et al. 1988) using oligonucleotides STE18 5'-(l'TACCAGTITTACT- GCAGCC) and STE18 3 ' - ( C G T A G C A A G M C C A ) , with a reaction cycle as described (CLARK et al. 1993) and the amplified products were sequenced directly (SANGER et al.

(3)

Gy CAAX Box Mutations

TABLE 2

Strains

969

Strain Genotype Source

s11 a leu2 ura3 his3 stel8::LacZ

M200-6C a ura3 adel sstl sst2 ilu3

M200-6C stel 8::ura3 a ura3 adel sstl sst2 ilu3 stel8::ura3

DM306

DM221

M307-1A

Dl11

D l l l ( M 1 3 5 p 3 ) DC17

YELl69 W3031A HC 106s HC107S HT108* HMllOK HMllOL

DClOGS

DC107S

DT108

DMllOK

DMllOL

a ura3 adel sstl sst2 ilu3

a ura3 adel sstl sst2 ilu3

a ura3adel sstl sst2 ilu3ste18-1

a ura3 adel sstl sst2 ilv3 +-

a has3 ura3 leu2 stel8::LacZ gpal::LEU2

a ade2 his3 leu2 trbl ura3 canl rba1::LEUZ 0 1

a ade2 his3 leu2 trpl ura3 canl i

D l 1 1 with plasmid M135p3 integrated at H I S 3 a his1

a ade2 his3 leu2 trpl ura3 canl gpal::LEU2 (pEL38)

a ade2 his3 leu2 trpl ura3 canl STE18

a ade2 his3 leu2 trpl ura3 canl stel8 "06'

a ade2 his3 leu2 trpl ura3 canl stel8 "07'

a ade2 his3 leu2 trpl ura3 canl stel8 T108tm

a ade2 his3 leu2 trpl ura3 canl stel8 M1loK

a ade2 his3 leu2 trpl ura3 canl stel8

a ade2 his3 leu2 trpl ura3 canl gpa1::LEUZ +-

a ade2 his3 leu2 trpl ura3 canl +- ste18c1n6s

a a d e 2 h i s 3 l e u 2 t r b l u r a 3 c a n l ~ b a l : : L E U 2

+

a ade2 his3 leu2 trpl ura3 canl

+

ste18c1n7s

a ade2 his3 leu2 trpl ura3 canl gpal::LEU2

+

a ade2 his3 leu2 trpl ura3 canl

+

~ t e l 8 ~ ' ~ ~ ' "

a ade2 his3 leu2 trpl ura3 canl gpal::LEU2 -+

a ade2 his3 leu2 trpl ura3 canl -+ ~ t e l 8 ~ " ' ~

a ade2 his3 leu2 trpl ura3 canl gpal::LEU2 i

a ade2 his3 leu2 trpl ura3 canl i- ~ t e l 8 ~ " ' ~

FINECOLD et al. (1990)

WHITEWAY et al. (1988)

WHITEWAY et al. (1992)

This work

WHITEWAY et al. (1989)

This work

J. KURJAN

This work

J. HICKS E. LEBERER

J. KURJAN This work This work This work This work This work

This work

This work

This work

This work

This work

defective. URA3' mating-competent transformants were se- lected, and then 5-FOA-resistant derivatives were identified that had retained mating competence.

Diploids heterozygous for the various STEl8 C-terminal mutations as well as the gpal::LEU2 disruption were con- structed by crosses. The W3031A strains containing the STEl8

alleles were transformed with plasmid M70p2, and these trans- formants were crossed on galactose containing medium to strain YELl69, which is W3031B containing the gpa1::LEUZ

allele as well as GPAl under gal control on a centromere- containing HZS3' plasmid. Diploids were grown on YEPD, and colonies that had lost both the URA3' and HIS3' plasmid markers were identified. These diploids were sporulated and dissected to determine if the STEl8 allele could suppress the cell cycle arrest created by the gpa1::LEUZ insertion.

RESULTS

The role of the STEl8 CAAXbox in mating: The wild- type yeast Gy protein encoded by the STEl8 gene ter- minates with the sequence C,,,CTLM,,,. Derivatives of plasmid M70p2 containing various alleles of STEl8 modified in the CAAX box sequences were introduced on high copy plasmids into strain S11, which contains a

LacZ insertional mutation in the chromosomal STE18 gene, and thus lacks STEl8 function. In addition, de- rivatives of strain W303-1A were constructed that had replaced the chromosomal copy of the gene with a copy containing representative Cterminal mutant alleles. These replacement alleles allowed assessment of the phenotype of the mutations expressed at a single copy in the genome, while the plasmid-borne versions al- lowed assessment of the phenotype of high level expres- sion of the mutant genes.

The high copy and single copy replacement mutants were tested for mating ability in both qualitative and quantitative mating assays. As can be seen in Table 3, the C107S replacement allele was totally sterile. Similarly, high copy versions of the three mutations which affect the C107 position (C107S, C106S,C107S and ClO6ter) totally eliminate STE18 function (Figure 1). Thus, as previously noted (FINEGOLD et al. 1990), this cysteine residue is essential for proper functioning of the G

(4)

970 M. S. Whiteway and D. Y. Thomas

TABLE 3

Mating efficiency

Relative

Strain Mating efficiency' mating

W303-1A 7.0 x 10" (6.0, 8.0) HCl06S 1.5 X (0.85.2.2)

HC107S 0 (<2 x 0

HT108*

HMllOK

1.0 X lo-: (0.7, 1.3) 0.14

3.5 X 10- (1.6, 5.4) 0.05 HMllOL 4.5 X 10" (3.0, 6.1) 0.64

" Matings were performed with the tester strain DC17. Efficiencies

are the average of two independent determinations; the two values averaged are listed in the parentheses and have the same order of magnitude as the average value.

1 .0

0.0002

important in STE18 function, but is not essential. Modification of this residue to serine greatly reduced mating ability of cells containing a single (Table 3) or multiple (Figure 1) copies of the mutant gene, but the cells were not completely sterile.

The noncysteine residues in the C A A X box are much less important for STE18 function than are the cys-

teines. Quantitative matings of strains containing the replacement alleles established that the M110K replace- ment reduced mating to about 5 % of the wild-type level, while the MllOL replacement had at most a twofold effect on mating (Table 3). Removal of the last three amino acids, leaving a Gterminal CC motif also had little effect on the mating of the strain with the single copy replacement (Table 3). Qualitative mating determina- tions of the multicopy versions of these alleles also es- tablished that the gene products were close to wild type in function (Figure 1).

Pheromone responsiveness in supersensitive strains:

The high copy plasmids containing the Gterminally modified alleles of the S T E I 8 gene were introduced into a potentially highly pheromone sensitive strain that lacked the STE18 function. This allowed analysis of more subtle consequences of the Gterminal mutations than could be detected by mating assays in wild-type strains. M200-6C s t e l 8 : : u r a 3 is a derivative of the sstl s s t 2 pheromone supersensitive strain M200-6C contain- ing a disrupted STE18 locus. Transformants containing the various alleles of S T E I 8 were tested for pheromone responsiveness using the a-factor halo assay. All the al- leles which removed the cysteine at position 107 were found to be totally nonresponsive to pheromone (Fig- ure 2C shows representative response for C107S). The change at position 106 of a cysteine to a serine, which significantly reduced mating, also greatly reduced, but did not eliminate, pheromone responsiveness (Figure 2B).

The other modifications had more subtle effects on pheromone response. The MllOK mutation created a ring of responding cells at a distance from the point of pheromone addition (Figure 2E). This is identical to the response of the ste18-1 allele, which had been found to be a M110R change (WHITEWAY et al. 1988). The T108ter

pVT100-u M70p2 WT c106ter c106s C107S c106sc107s

1

TlO8ter

~ MllOK

MllOL

FIGURE 1.-Mating ability of various Gterminal mutants. Plasmid M70p2 or derivatives containing Gterminal mutations transformed into stpl8mutant strain S11 were mated on YEPD plates to strain DC17 (MATa hisl). The mating mixtures were then replicated to minimal plates to allow the growth of pro- totrophs. Transformants containing the vector PVT100-U were sterile (no prototrophs), as were transformants with the plas- mids containing the ClOGter, C107S and ClOGS,C107S muta- tions. Plasmids containing the wild-type STEI 8 gene (M70p2) and the mutants T108ter, M110K and M11OL all mated well. The transformants containing the M70p2 derivative with the C106S mutation exhibited weak mating, as shown by the in- frequent prototrophic colonies formed.

mutation allowed a virtually wild-type response, but the zone of clearing was found to exhibit a faint inner zone of improved growth, and thus the response was inter- mediate beween that found for the M1 1OKmutation and the wild-type allele (Figure 2D). Finally, the zone of re- sponsiveness for the M11OL allele was indistinguishable from wild type (Figure 2F).

(5)

C y CAAX Box Mutations 971

. "'

methionine at position 110 to an arginine or lysine are phenotypically identical. This idea was tested directly by transforming haploid strains M200-6C and M200-6C s t e l 8 - 1 with the dprl::URA3 construction. Strains M200-6C s t e l 8 - 1 , M200-6C dprl::URA3 and M200-6C s t e l 8 - 1 dprl::URA3 gave identical rings when grown at 18" and spotted with a-factor (data not shown).

The wild-type STE18 C terminus is critical for signal transduction in cells which lack the Ga subunit: We as- sessed the importance of the normal Stel8 C terminus in strains that were lacking a functional GPA

I

( S C G I ) gene. Such strains are unable to form colonies because the pheromone response pathway is constitutively acti- vated in the absence of the G a subunit (DIETZEL and K u R ~ 1987; MIYAJIMA et d l . 1987). Diploids were con- structed that were heterozygous for both a GPAI dis- ruption and the various S T E 1 8 Cterminal alleles as de- scribed in MATERIALS AND METHODS. These diploids were

sporulated and dissected. Diploid Dl11 was only het- erozygous at the G P A l locus; dissection of this dipoid generated only two viable spores per tetrad, none of which contained the gpal::LEU2 allele. However, as can be seen in Table 4, all of the diploids that were also heterozygous at the S T E 1 8 locus generated frequent LEU2' spores. Therefore, all of the C terminal muta- tions were capable of suppressing the cell cycle arrest created by the gpa1::LEUZ disruption.

The ability of the Cterminal mutations to suppress the gpa1::LEUZ mutation when they were carried on high copy plasmids was also assessed. Strain M307-1A contains a LEU2 insertion in the GPAI gene, and a LacZ insertion in S T E 1 8 . This strain was transformed with the series of plasmids containing the various alleles of STE18. As expected, all the mutant versions of the S T E 1 8 gene gave healthy transformants after 2 days of growth, while the STEI 8' plasmid gave visible transfor- mants approximately one week after the transformation.

L"

. 7 2 . :

F

FIGURE 2.-Pheromone respon- siveness of Gterminal mutations in sstl s s t 2 s t e l 8 strain. Strain M200-6C ste18::uru3 was trans- formed with M70p2 and various Gterminal mutant derivatives of M70p2. These transformed strains were embedded in agarose and the response was tested by spot- ting 1 11g of synthetic a-factor. Panel A, M70p2; B, C106S; C, C107S; D, T108ter; E, MllOK; F,

M11OL.

TABLE 4

Suppression of GPAI disruption by Gterminal mutations of STE18

Diploid Tetrads k u 2 + spores

Dl11 8

DCl06S 7 DC107S 7 DTI OR 9 DMllOK 10 DMllOL 10

0 4 7

7

1 1 10 Diploid strains were sporulated and dissected. A l l the diploids that were heterozygous for the STE18 alleles generated viable spores containing the gpnl::LEU2 disruption; no viable gpaI::LEU2 spores were obtained from the strain homozygous for the wild-type STE18 gene.

The colonies resulting from transformation with the wild-type S T E I 8 contained morphologically aberrant cells, and overnight growth in nonselective medium re- sulted in all the viable colonies having lost the STE18- containing plasmid (Table 5).

(6)

972 M. S. Whiteway and D. Y. Thomas

TABLE 5

Stability of plasmids containing Gtenninal mutants of Stel8

Plasmid Plasmid stability

pvT 1 00-u 75-91 (4)

M70p2W 0 (2)

M70pZC106ter M70p2C106S M70p2C107S

M70p2T108TER 82-87 (3)

M70p2MllOK M70p2MllOL

89-92 (3) 84-93 (4)

12-40 (7) 85-95 (3)

77-91 (3)

Plasmid containing cells (strain M307-1A) were grown overnight in rich medium, and then suitable dilutions were spread on YEPD plates. After two days growth the resulting colonies (typically 100-150 per assay) were replica plated to "ura medium to distinguish those colonies which had arisen from cells containing plasmids from those which had arisen from cells that had lost the plasmid. The range of plasmid stabilities measured as the percent of plasmid bearing cells is shown for each plasmid; number of independent cultures assayed to give the range is noted in parentheses.

Dominant negative suppression of GPAl null muta- tions: Mutant versions of the RAS gene defective in C-terminal processing can interfere with functioning of the normally prenylated RAS protein (GIBBS et al. 1989;

MICHAELI et al. 1989). We examined whether high level expression of the various Gterminal mutations of Stel8 could interfere with normal Stel8 function by assessing whether the mutant plasmid could suppress the growth defects and morphological changes characteristic of

STEl8' strains that lacked the GPA 1 gene product. D i p loid strain Dl11 is heterozygous for the gpal::LEU2 dis- ruption and when sporulated and dissected gives two

healthy, leu2- spore colonies, and two inviable or slowly growing LEU2' spores. This strain was transformed with the various S T E l 8 mutants as well as M70p2 ( STEl8')

and pVT100-U (vector control). The two control plas- mids did not affect the typical pattern of spore viability in Dl1 1. In contrast, all the mutant versions of S T E l 8

allowed LEU2' spores to grow (Table 6), and eliminated the extreme morphological defects characteristic of di- viding gpal mutant cells. However, the LEU2' spores containing the C106S mutant plasmid did not grow as fast as the other LEU2+ segregants, and the cells were detectably larger than those containing the other mu- tant versions of S T E l 8 .

These viable gpal mutant strains were tested for their mating ability. All the gpal disruption mutants which contained the modified S T E l 8 genes mated at a low level with the tester strain, and there were no significant differences in the mating levels of the various transfor- mants (data not shown).

Effect of Ste4 overproduction: The interference by the Stel8 mutants with the constitutive signaling usually found in the absence of the Gpal protein may have been caused by sequestration of the Ste4 protein (the GP sub- unit) in an ineffective location. We assessed the phero- mone responsiveness of transformants containing the various C-terminal mutations of S T E l 8 when the cells

TABLE 6

Dominant negative properties of Gterminal Stele mutants

Plasmid Tetrads LEU2 URA3 spores

Control 7

STEl8'

0

12 0

ClO6ter 7 12

C 106s 7 11

C106S,C107S 7 11

C107S 7 13

T108ter 7 12

MllOK 6 9

MllOL 8 10

Strain Dl11 was transformed with various plasmids and tetrads were dissected after transformation. The number of LEU2' spores is noted for each plasmid; all the plasmids containing C-terminal mu- tations of the S T E I 8 gene were able to allow the gpal::LEU2 spores to grow.

lacked the Gpal protein and were overexpressing the

GO subunit. Strain Dl 11 was transformed with plasmid M135p3 to integrate a galactose inducible STE4 gene, and this version of D l 11 was transformed with the vari- ous pVT100-based plasmids containing the Stel8 Gterminal mutants. These transformants were sporu- lated and dissected on glucose medium, and sister spores were selected that contained the gpal knockout and the interfering C-terminal mutations but which dif- fered in the presence or absence of the galactose in- ducible STE4 gene. These colonies were replica plated to -ura galactose medium, and the growth of the cells was monitored. In the case of the plasmid containing the C106S mutation, overexpression of Ste4 prevented the interference, and the colonies failed to grow on the ga- lactose medium (Figure 3). Microscopic analysis showed that all galactose-arrested cells exhibited the character- istic morphology of pheromone-arrested cells. The other mutants prevented the cellular arrest caused by the loss of Gpal even in the presence of the overpro- duced Ste4 protein (Figure 3).

DISCUSSION

(7)

Gy C A A X Box Mutations 973

c106*

c106s

C107S

c106sc

T108*

MllOK

MllOL

GLU

GAL

” + +

thus CTLR and CTLK may be nonfunctional signals in directing prenylation of the yeast Stel8 protein. In the case of yeast Ras proteins, blockage of the prenylation reaction also blocks the subsequent steps of Gterminal maturation, which involves proteolytic cleavage of the last three residues leaving a Gterminal cysteine, and the carboxyl methylation of that cysteine (CLARK 1992). Thus the unprenylated protein would be expected to remain completely unprocessed.

In the case of Stel8, changing the Gterminal methio- nine to leucine, which is found in other systems to direct geranylgeranylation (Cox and DER 1992), produced a protein whose function was indistinguishable from wild type. In other systems replacement of the farnesyl ad- dition signal with the geranylgeranylationdirecting sig- nal has permitted continued function of prenylated pro- teins (CHOW et al. 1992; HANCOCK et al. 1991). Thus it is likely that the CCTLL C terminus directed gera- nylgeranylation of the Stel8 protein, and this gera- nylgeranylated protein functioned well in the signal transduction process.

It is interesting that loss of the farnesylation machin- ery has only minor effects on Stel8 function, whereas mutation of the farnesylated cysteine (C107) totally abolishes function. This result suggests that the function of the cysteine at position 107 must be more than simply to serve as an amino acid to which the farnesyl moiety is attached. It is possible that in the absence of the farnesyltransferase the C107 position is modified by geranylgeranylation, and thus is at least partially preny- lated. The observation that the human RhoB protein

(ADAMSON et al. 1992), the yeast Ras2 protein (TRUEBLOOD et al. 1993) and yeast a-factor (CALDWELL et al. 1994) have the potential to be either farnesylated or geranylgeranylated would be consistentwith this idea. However, no prenylated Stel8 protein was detected in the dprl mutant cells (FINEGOLD et al. 1990), suggesting only a minor fraction of the Stel8 product is gera- nylgeranylated under normal conditions. In addition, the M l l O K and M110R mutants, which may be unable

FIGURE 3.-Gpal disruptant strains containing M70p2 derivatives with the various Cterminal mutations were identified which contained a ga- lactose inducible STE4 gene through dissection of Dlll(M135p3) transformants containing the various STEl8 mutant derivatives of M70p2. Two independent segregants without the inducible

STE4 gene (-) and two with the galactose in- ducible STE4 (+) were tested. These strains were replica plated to galactose medium. The cells containing the C106S mutation were not able to

grow on galactose, and the arrested cells were all morphologically aberrant. The other swains were able to grow on galactose, and thus these plasmids were able to prevent arrest of the @a1 disrupted cells even in the presence of high levels of the

+ +

Ste4 protein.

to direct either farnesylation or geranylgeranylation, mimicked the loss of

DPRl

function. This supports the idea that the Stel8 protein in d p r l mutant cells can func- tion quite well in the signal transduction cascade even though it lacks normal prenylation.

The adjacent cysteine residue, C106, also must play a significant role in the function of Stel8. Mutation of this residue to serine greatly reduces Stel8 function, but does not appear to qualitatively affect the behavior of Gy. Cells containing the mutation are reduced in mat- ing and in pheromone arrest. Thus the C106S StelS protein behaves exactly as would be expected for a poorly functioning Gy subunit. Based upon analogy with other isoprenylated proteins, the C106 residue could be a target for palmitylation (HANCOCK et al. 1991). This would imply that palmitylation of the StelS protein en- sures its efficient activity.

Finally, removal of the last three amino acids (TLM) produces a protein which functions more efficiently than does the MllOK mutation. It is possible that the remaining CC Gterminal amino acids direct gera- nylgeranylation through the action of the type I1 gera- nylgeranyltransferase (MOORES et al. 1991). However, the GGTase I1 enzyme requires more than simply the CC motif to direct activity (MOORES et al. 1991; KHOSRAVI-FAR et al. 1992). Thus it seems most likely that the improved function of the ATLM mutation relative to the MllOK mutation reflects a reduced function of a Stel8 that re- tains the last three amino acids.

(8)

974 M. S. Whiteway and D. Y. Thomas

provides functions that are redundant with the Gy C terminus. Thus only in cells lacking the Gpal protein does the essential function of the post-translational modification of Gy become evident. This result is con- sistent with the identification of the DPRl (SGP2) gene as a suppressor of the growth arrest phenotype of gpal- disrupted cells (NAKAYAMA et al. 1988).

There are several possible functions for the Stel8 C terminus that may be overlapping with Gpal function. One obvious possibility is that of membrane localization. The Gpal protein is myristoylated (STONE et al. 1991) and membrane-localized in the absence of the other G protein subunits ( BLUMER and THORNER 1990), and therefore has intrinsic localization signals. Thus a mutant Stel8 protein that lacked its own localization signal may be properly membrane-localized through its association with Gpal as

part of the G protein heterotrimer. In strains that lacked the Gpal protein, such a “hitchhiking”1ocalization mecha- nism would not be available. It is interesting to note that mutations that block prenylation of yeast Ras2 completely block function except when Ras2 is overexpressed, sug- gesting that Ras2 does not have a redundancy to its local- ization signals (DESCHENES and BROACH 1987).

A defect in proper membrane localization could also explain the observation that, when overexpressed, these Gterminally defective Gy subunits act dominantly to shut off signaling in gpal mutants even in the presence of wild-type Stel8. This dominant interference pheno- type created even by the nonfunctional C107S allele im- plies that all the constructs are producing proteins, and that these proteins are capable of interacting with other components of the signaling machinery. A similar dominant negative phenotype has been found for Ras mutants which affect the farnesylation process (GIBBS et al. 1989; MICHAELI et al. 1989). This phenotype could arise because the Stel8 protein lacking a membrane localization signal could sequester some other active component of the signaling pathway into a nonfunc- tional complex. A plausible candidate for this element is the Ste4 protein, which physically associates with the Stel8 protein (CLARK et al. 1993) and which is limiting for the mating signal pathway (WHITEWAY et al. 1990). This hypothesis would predict that overexpression of the Ste4 protein may overcome the block in signaling created by the STEl8alleles. In fact, the C106S mutant failed to suppress the inviability of a GPAl null allele in the presence of excess Ste4 protein, suggesting that the C106S mutation may act by sequestering Ste4. However the other mutations were still able to inter- fere with the constitutive signal even in the presence of excess Ste4 protein.

A second possibility for the requirement of proper C-terminal processing of the Stel8 protein would be for interaction with another protein in the signaling path- way. Association with either the effector of the response pathway or with the pheromone receptor proteins may

be influenced by farnesylation of the Stel8 protein. Although in yeast the activation of the “effector” mol- ecule is achieved by the free Py complex, proper in- teraction with this component may require more than just the P y element itself. Inactivation of the Gpal

protein activates the mating response pathway in a receptor-independent manner, but the mating re- sponse triggered in ste2 g b a P mutants at the restric- tive temperature is not as efficient as that created by pheromone treatment of wild-type cells (JAHNC et al.

1988). G protein association with the receptor protein is necessary for the formation of high affinity ligand binding (BLUMER and THORNER 1990), and this re- quires a functional Stel8 protein. As well, proper dis- crimination of mating partners requires elements that are not part of the G protein (JACKSON et al. 1991), so there are many components that may interact in some manner with a receptor/(; protein complex. Direct attempts to suppress other dominant negative STE18 alleles (WHITEWAY et al. 1992) by overproduction of random gene products led to the identification of the STES gene product as a high copy suppressor (M. S. WHITEWAY, unpublished observations). Thus it is possible that the Ste5 protein is limiting in strains which overexpress the dominant negative versions of the Stel8 protein.

The mutagenesis described in this work has identi- fied the cysteines at positions 106 and 107 of the Stel8 protein as playing important or essential roles in the functioning of the Gy subunit. Intriguingly, muta- tions which affect the last three amino acids of the CAAXbox create only subtly misfunctional proteins in cells which contain the Ga subunit Gpal, but are es- sentially nonfunctional in strains which lack the Gpal protein. This is most striking in the case of the M11OL mutation, which creates a protein that acts as wild type in a GPAl’ strain, but cannot create a functional sig- naling molecule in a gbal::LEU2disruption strain. Be- cause Gpal normally functions to repress the signal- ing pathway (DIETZEL and KURJAN 1987; MIYAJIMA et al. 1987), its requirement to allow signaling in strains which contain the CAAX box mutations of Stel8 points to complex functional interactions among the G protein subunits. Further work will be necessary to define these interactions more fully.

We would like to thank DANIEL DIGNARD for sequencing. We would

also like to thank KAREN CLARK and THIERRY VERNET for comments on the manuscript. This is National Research Council of Canada publi- cation number 36833.

LITERATURE CITED

ADAMSON, P., C. J. MARSHALL, A. HALL and P. A. TILBROOK, 1992 Post- translational modifications of p21rh” proteins. J. Biol. Chem. 267:

20033-20038.

BLUMER, K. J., and J. THORNER, 1990 p and y subunits of a yeast gua- nine nucleotide-binding protein are not essential for membrane association of the CY subunit but are required for receptor cou-

(9)

Cy CAAX Box Mutations 975

BOEKE, J. D., F. LACROUTE and G . R. FINK, 1984 A positive selection for mutants lacking orotidine-5'phosphate decarboxylase activity in yeast: 5-fluoroorotic acid resistance. Mol. Gen. Genet. 197:

345-346.

CALDWELL, G . A., S. H. WANG, F. NMDER and J. M. BECKER, 1994 Con- sequences of altered isoprenylation targets on a-factor export and BIOACTIVITY. PROC. NATL. ACAD. SCI. USA 91:

CHEN, W.-J., D. A. ANDRES, J. L. GOLDSTEIN, D. W. RUSSELL and M. S.

BROWN, 1991 cDNA cloning and expression of the peptide- binding p subunit of rat p21" farnesyltransferase, the counter- part of yeast D P R l / R A M l . Cell 66: 327-333.

CHOW, M., C. J. DER and J. E. Buss, 1992 Structure and biological effects of lipid modifications on proteins. Curr. Opin. Cell Biol.

C mK., D. DIGNARD, D. Y. THOMAS and M. WHITEWAY, 1993 Inter- actions among the subunits of the G protein involved in Saccha- romyces cerevisiae mating. Mol. Cell. Biol. 13: 1-8.

CLARK, S., 1992 Protein isoprenylation and methylation at carboxyl-terminal cysteine residues. Annu. Rev. Biochem. 61:

Cox, A. D., and C. J. DER, 1992 Protein prenylation: more than just glue? Curr. Opin. Cell Biol. 4 1008-1016.

DESCHENES, R. J., and J. R. BROACH, 1987 Fatty acylation is important but not essential for Saccharomyces cerevisiae R A S function. Mol. Cell. Biol. 7: 2344-2351.

DIETZEL, C., and J. KURJAN, 1987 The yeast SCGl gene: a Gdlike pro- tein implicated in the a- and a-factor response pathway. Cell 50:

1001-1010.

FINECOLD. A. A,, W. R. SCHAFER, J. RINE, M. WHITEWAY and F. TAMANOI, 1990 Common modifications of trimeric G proteins and ras protein: involvement of polyisoprenylation. Science 249:

FINEGOLD, A. A,, D. I. JOHNSON, C. C. FARNSWORTH, S. POWERS, M. H. GELB

et al., 1991 Protein geranylgeranyltransferase of Saccharomyces

cerevisiae is specific for Cys-Xaa-Xaa-Leu motif proteins and re- quires the CDC43 gene product but not the D P R l gene product. Proc. Natl. Acad. Sci. USA 88: 4448-4452.

GIBBS, J. B., M. D. SCHABER, T. L. SCHOFIELD, E. M. SCOLNICK and I. S.

SIGAL, 1989 Xenopus oocyte germinal-vesicle breakdown in- duced by [vall2]ras is inhibited by a cytosol-localized ras mutant. Proc. Natl. Acad. Sci. USA 86: 6630-6634.

GOODMAN, L. E., C. M. PEROU, A. FuJNAMAand F. TAMANOI, 1988 Struc- ture and EXPRESSION OF YEAST D P R l , a gene essential for the pro- cessing and intracellular localization of ras proteins. Yeast 4:

GOODMAN, L. E., S. R. JUDD, C. J. FARNSWORTH, S. POWERS, M. H. GELB et al., 1990 Mutants of Saccharomyces cerevisiae defective in the farnesylation of Ras proteins. Proc. Natl. Acad. Sci. USA 87:

HANCOCK, J. F., H. PATERSON and C. J. MARSHALL, 1990 A polybasic domain or palmitoylation is required in addition to the CAAX motif to localize ~ 2 1 " ~ to the plasma membrane. Cell 63:

133-139.

HANCOCK, J. F., K. CADWALLADER and C. J. MARSHALL, 1991 Methylation and proteolysis are essential for efficient membrane binding of prenylated p21""('). EMBO J. 10: 641-646.

HE, B., P. CHEN, S. Y. CHEN, K. L. VANCURA, S. MICHAELIS et al., 1991 R a m 2 an essential gene of yeast and ram1 encode the two polypeptide components of the farnesyltransferase that preny- lates a-factor and ras proteins. Proc. Natl. Acad. Sci. USA 88:

11373-11377.

HUISMAN, O., W. RAYMOND, IC-U. FROEHLICH, P. ERRADA, N. KLECKNER

et al., 1987 A T n l O - l a d - K a n R - U R A 3 gene fusion transposon for insertion mutagenesis and fusion analysis of yeast and bacte- rial genes. Genetics 116: 191-199.

ITO, H., Y. FUKUDA, K. MURATA and A. KIMURA, 1983 Transformation of intact yeast cells treated with alkali cations. J. Bacteriol. 153:

JACKSON, C. L., J. B. KONOPKA and L. H. HARTWELL, 1991 S. cerevisiae

a pheromone receptors activate a novel signal transduction path- way for mating partner discrimination. Cell 67: 389-402. JAHNC IC-Y., J. FERCUSON and S. I. REED, 1988 Mutations in a gene

encoding the a subunit of a Saccharomyces cerevisiae G protein 1275-1279.

4: 629-636.

355-386.

165-169.

271-281.

9665-9669.

163-168.

indicate a role in mating pheromone signaling. Mol. Cell. Biol. 8:

JIANG, Y., G . ROSSI and S. FERRCFNOVICK, 1993 Bet2p and Mad2p are components of a prenyltransferase that adds geranylgeranyl onto Yptlp and Sec4p. Nature 366: 84-86.

JOHNSON, D. I., J. M. O'BRIAN and C. W. JACOBS, 1991 Isolation and sequence analysis of CDC43, a gene involved in control of cell polarity in Saccharomyces cerevisiae. Gene 9 8 149-150.

KHOSRAVI-FAR, R., R. J. LUTZ, A. D. Cox, L. CONROY, J. R. BOURNE

et al., 1991 Isoprenoid modifications of Rab proteins

terminating in CC/CXC motifs. Proc. Natl. Acad. Sci. USA 88:

KOHL, N. E., R. E. DIEHL, M. D. SCHABER, E. RANDS, D. D. SODERMAN et al. 1991 Structural homology among mammalian and Saccharomy- ces cerevisiae isoprenyl-protein transferases. J. Biol. Chem. 2 6 6

18884-18888.

LEBERER, E., D. DICNARD, D. HARcus, L. HOUGAN, M. WHITEWAY et al.,

1993 Cloning of Saccharomyces cerevisiae STE5 as a suppressor of a StePO protein kinase mutant: structural and functional simi- larity of Ste5 to Farl. Mol. Gen. Genet. 241: 241-254.

LI, R., C. HAVEL, J. A. WATSON and A. W. MURRAY, 1993 The mitotic feedback control gene MAD2 encodes the a subunit of a pre- nyltransferase. Nature 3 6 6 82-84.

MICHAELI, T., J. FIELD, R. BUSTER, K. O'NEILL and M. WICLER, 1989 Mutants of H-ras that interfere with RAS effector function in Saccharomyces cerevisiae. EMBO J. 8 3039-3044.

MNAJIMA, I., M. NAKAFUKU, N. N A K A Y A M A , C. BREWER, A. MNAJIMA et al., 1987 G P A l , a haploid essential gene, encodes a yeast homolog of mammalian G protein which may be involved in mating factor signal transduction. Cell 5 0 1011-1019.

MOORES, S. L., M. D. SCHABER, S. D. MOSSER, E. RANDS, M. B. O'HARA et al., 1991 Sequence dependence of protein isoprenylation. J. Biol. Chem. 266: 14603-14610.

NAKAYM, N., K-I. ARAJ and K. MATSUMOTO, 1988 Role of SGP2, a

suppressor of a g p a l mutation, in the mating-factor signaling pathway of S. cerevisiae. Mol. Cell. Biol. 8 5410-5416.

O m , Y., M. GOEBL, L. E. GOODMAN, S. PETERSEN-BJORN, J. D. FRIESEN et al., 1991 Yeast C A L l is a structural and functional homolog to the D P R l ( R A M I ) gene involved in Wprocessing. J. Biol. Chem. 2 6 6 12356-12360.

REISS, Y., S. J. STRADLEY, L. M. GIERASCH, M. S. BROWN and J. L. GOLDSTEIN,

1991 Sequence requirement for peptide recognition by rat brain p21" protein farnesyltransferase. Proc. Natl. Acad. Sci. USA

ROSSI, G . , Y. JIANC, A. P. NEW and S. FERRCFNOVICK, 1991 Depen- dence of Yptl and Sec4 membrane attachment on Bed. Nature

351: 158-161.

SAIKI, R. J., D. H. GELFAND, S. STOFFEL, S. J. SCHARF, R. HICUCHI et al., 1988 Primerdirected enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239: 487-491.

SANCER, F., S. NICKLEN and A. R. COULSON, 1977 DNA sequencing with chain terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:

SEABRA, M. C., Y. REISS, P. J. CASEY, M. S. BROWN and J. L. GOLDSTEIN,

1991 Protein farnesyltransferase and geranylgeranyltransferase

share a common a subunit. Cell 6 5 429-434.

SEABRA, M. C., J. L. GOLDSTEIN, T. C. SUDHOF and M. S. BROWN, 1992 Rab geranylgeranyl transferase. A multisubunit enzyme that prenylates GTP-binding proteins terminating in Cys-X-Cys or Cys-Cys. J. Biol. Chem. 267: 14497-14503.

SINENSKY, M., and R. J. LUTZ, 1992 The prenylation of proteins. BioEssays 14: 25-31.

SPIECEL, A. M., P. S. BACKLUND, J. E. BLJTRYNSKI, T. L. Z. JONES and W. F. SIMONDS, 1991 The G protein connection: molecular basis of membrane association. Trends Biochem. Sci. 1 6 338-341. SIMONDS, W. F., J. E. BUTRYNSKI, N. GAUTAM, C. G . UNSON and A. M.

SPIEGEL, 1991 Gprotein Py dimers. Membrane targeting re- quires subunit coexpression and intact y GA-A-Xdomain. J. Biol. Chem. 266: 5363-5366.

STONE, D. E., G . M. COLE, M. B. LOPES, M. GOEBL and S. I. REED, 1991 N-Myristoylation is required for function of the pheromone-responsive G , protein ofyeast: conditional activation of the pheromone response by a temperature-sensitive N-myristoyl transferase. Genes Dev. 5: 1969-1981.

TRUEBLOOD, C. E., Y. OHYA and J. R I N E , 1993 Genetic evi- 2484-2493.

6264-6268.

88: 732-736.

(10)

976 M. S. Whiteway and D. Y. Thomas

dence for in vivo cross-specificity of the CaaX-box protein prenyltransferases farnesyltransferase and geranylgeranyl- transferase in Saccharomyces cereuisiae. Mol. Cell. Biol. 13:

VERNET, T., D. DIGNARD and D. Y. THOMAS, 1987 A family of yeast expression vectors containing the phage fl intergenic re-

gion. Gene 52: 225-233.

WHITEWAY M. S., L. HOUGAN, D. DIGNARD, L. BELL, G . C. SAARI et al., 1988 Function of the STE4 and STEZB genes in mating p h e r e mone signal transduction in Saccharomyces cerevisiae. Cold Spring Harbor Symp. Quant. Biol. 53: 585-590.

WHITEWAY M. S., L. HOUGAN, D. DIGNARD, D. Y. THOMAS, L. BELL et al., 4260-4275.

1989 The STE4 and STEZB genes of yeast encode potential /3

and y subunits of the mating factor receptor-coupled G protein. Cell 5 6 467-477.

WHITEWAY, M., L. HOUCAN and D. Y. THOMAS, 1990 Overexpression of the STE4 gene leads to mating response in haploid Saccharomyces cerevisiae. Mol. Cell. Biol. 10 217-222.

WHITEWAY, M., D. DIGNARD and D. Y. THOMAS, 1992 Mutagenesis of STEZB, a putative Gy subunit in the S. cerevisiae pheromone response pathway. Biochem. Cell Biol. 7 0 1230-1237.

Figure

TABLE 2 Strains
FIGURE 1.-Mating The transformants  containing the M70p2 derivative with the transformed into  stpl8mutant strain S11 were mated on YEPD and  the mutants  T108ter, M110K and M11OL all mated well
FIGURE 2.-Pheromone siveness of Gterminal mutations
TABLE 6
+2

References

Related documents