Hereditary and acquired p53 gene mutations in
childhood acute lymphoblastic leukemia.
C A Felix, … , J J Letterio, J Whang-Peng
J Clin Invest. 1992;89(2):640-647. https://doi.org/10.1172/JCI115630.
The p53 gene was examined in primary lymphoblasts of 25 pediatric patients with acute lymphoblastic leukemia by the RNase protection assay and by single strand conformation polymorphism analysis in 23 of 25 cases. p53 mutations were found to occur, but at a low frequency (4 of 25). While all four mutations were identified by single strand conformation polymorphism, the comparative sensitivity of RNase protection was 50% (2 of 4).
Heterozygosity was retained at mutated codons in 3 of 4 cases. One pedigree was consistent with the Li-Fraumeni syndrome, and bone marrow from both diagnosis and remission indicated a germline G to T transversion at codon 272 (valine to leucine).
Although members of another family were affected with leukemia, a 2-bp deletion in exon 6 was nonhereditary. The other two nonhereditary p53 mutations included a T to G
transversion at codon 270 (phenylalanine to cysteine) and a G to C transversion at codon 248 (arginine to proline). These data support the role of both hereditary and acquired p53 mutations in the pathogenesis and/or progression of some cases of childhood acute lymphoblastic leukemia.
Research Article
Find the latest version:
Hereditary and
Acquired
p53 Gene
Mutations
in
Childhood Acute Lymphoblastic Leukemia
Carolyn A. Felix,* Marion M. Nau,t TakashiTakahashi,*TetsuyaMitsudomi,*ItsuoChiba,t David G. Poplack,*
Gregory H.
Reaman,*
Diane E. Cole,* John J. Letterio,* Jacqueline Whang-Peng,11 Turid Knutsen,11 and John D.Minna"*Pediatric, WNavy Medical Oncology, and
IlMedicine
Branches, National Cancer Institute, National Institutes ofHealth, Bethesda, Maryland 20892; Division ofHematology-Oncology, Children's National Medical Center, and Department ofPediatrics,George Washington University School ofMedicine, Washington, District ofColumbia 20010; and 'Simmons Cancer Center, University of Texas Southwestern School ofMedicine, Dallas, Texas 75235
Abstract
The p53 gene was examined in primary lymphoblasts of 25
pediatric patients with acute lymphoblastic leukemia by the
RNase protection assay and by single strand conformation polymorphismanalysisin23 of25cases.p53 mutationswere
foundtooccur,butatalowfrequency(4of25).While allfour
mutationswere identified by singlestrand conformation
poly-morphism,thecomparative sensitivityof RNaseprotectionwas
50%(2 of4).Heterozygositywasretainedatmutated codons in 3 of 4cases.Onepedigreewasconsistent with the Li-Fraumeni syndrome, and bonemarrowfrom bothdiagnosisand remission indicatedagermline Gto Ttransversionatcodon 272(valineto
leucine). Although members of another family wereaffected
with leukemia, a 2-bp deletion in exon6 was nonhereditary.
The othertwononhereditaryp53mutations includedaTtoG
transversionatcodon270
(phenylalanine
tocysteine)
andaGtoCtransversionatcodon248
(arginine
toproline).
Thesedatasupportthe role of bothhereditaryandacquired p53mutations
inthepathogenesis and/or progressionofsome casesof
child-hood acute
lymphoblastic
leukemia.(J.
Clin. Invest. 1992.89:640-647.) Keywords: B-cellprecursor *germline*
Li-Frau-meni syndrome*T cell* tumor suppressor gene
Introduction
Afterthediscovery ofthe 8;14 translocation and the
conse-quent activation of the c-myc geneinBurkitt'slymphoma(1), studiesofthe molecular basisofchildhood acutelymphoblastic leukemia(ALL)'haveconcentrated uponsearchingfor poten-tial dominant oncogenes at breakpoint regions of
chromo-somal translocations(2).Insolidtumors of both children and
adults,retinoblastomabeingtheparadigm,anadditional focus
hasbeen theidentificationof genesofadifferentclass,which
functionintheirwild-typeform as recessiveoncogenesor
tu-Addressreprintrequests to Dr. Felixather current address: Division of
Oncology, Department ofPediatrics,WoodBuilding,4th Floor,
Chil-dren'sHospitalofPhiladelphia, 34th Street and Civic Center
Boule-vard, Philadelphia,PA 19104.
Receivedfor publication2July1991 and inrevisedform27
Sep-tember1991.
1.Abbreviationsused in thispaper:ALL,acutelymphoblastic
leuke-mia;BM, bone marrow; CML, chronic myelogenous leukemia; ORF,
openreading frame;PB,peripheralblood; PCR, polymerase chain
reac-tion; SSCP, singlestrandconformation polymorphism.
TheJournal of ClinicalInvestigation,Inc.
Volume89, February 1992, 640-647
morsuppressorgenes (3).Onesuchrecessiveoncogene isp53 (4-12), located on chromosome 17 at band p13.1 (13, 14).
Inactivation ofthe human p53 gene,whetherby gross
struc-tural change, homozygous deletion, or point mutation, has
sincebeenimplicatedin thepathogenesisoflung, breast, colon,
brain, and liver cancers, chronic myelogenous leukemia
(CML) and childhood osteogenic and rhabdomyosarcomas
(15-26).Moreover,recentstudieshavedemonstratedthe
pres-enceof germline p53 mutations in Li-Fraumeni pedigrees
af-fected with breast cancers, sarcomas, and braintumors (27,
28). The observation of Li-Fraumeni syndrome-type cancers,
including lymphomas, in transgenic mice overexpressing a
mutantp53hassuggestedapotentialroleofp53 inactivationin
thepathogenesis ofhuman lymphoid malignanciesaswell (29).
Sinceacuteleukemiasareconsideredcomponenttumorsofthe
Li-Fraumenisyndrome,weundertooktostudythe p53 genein
childhoodALL.
Methods
Samplecollection. Materialswerecollectedperprotocol or as part of
standardcare.Lymphoblasts from 80children withBcell precursor
ALL, 21withTcell ALL, and three infants, aged 0-21 yr at diagnosis,
wereobtainedandcharacterizedaspreviously described (30, 31).
Sam-pling timeswere atdiagnosis,atbone marrow (BM) relapse, or at
fail-ure ofinduction chemotherapy. BM collectedduring remissionwas alsoavailableinonecase.Cytogenetic analysiswasby standard meth-ods(32).
DNAandRNApreparationand Southern analysis.High molecular
weightDNA and total cellular RNA were isolated as described (30, 31).
For standard Southernanalysis 10,gofgenomicDNAsdigestedby
BamHI(Bethesda Research Laboratories,Bethesda, MD),EcoRI
(Be-thesdaResearchLaboratories),orHindIII(Boehringer Mannheim
Bio-chemicals, Indianapolis, IN)washybridized witha1.8-kbhumanp53 cDNA-containing XbaI fragment derived fromclonephp53c I(12,15).
Three chromosome 17ppolymorphic regionswereassessed byusing
pBHP53(33), pMCT35.1(34),andpYNZ22(35) fragmentsasprobes
andBamHIorMspI (BethesdaResearchLaboratories)cleaved DNA.
Both thepBHP53andMCT35.1 probeswerepreassociatedwithan
5,000-fold excessofsonicated, alkali-denatured human placental
DNA(SigmaChemical Company, St. Louis, MO) for 2 hbefore hybrid-ization,andnitrocellulose filterswereprehybridizedovernightin a
so-lutioncontaining100
gsg/ml
ofthe same reagent.Screeningformutations. RNaseprotectionassayswereperformed
aspreviously described usingthreeriboprobes(p53XP, p53PA, p53M)
spanningthep53openreadingframe(ORF;reference15).The
poly-merase chain reaction/single strand conformation polymorphism
(PCR/SSCP)method(36-38),asmodifiedtoscreen forpoint
muta-tionsof thep53gene ingenomicDNA, also has been described (39),
Characterization of abnormalities suggested by screening. RNase protection abnormalitieswere verified by cDNA sequencing.
First-strand cDNA wassynthesized using5 ,ug of total cellular RNA and a
p53-specific primer, followedby PCRamplification oftheentirep53 ORF(15).PCR products were cleaved with EcoRI, agarosegel-purified
by the Geneclean method(Bio101, La Jolla, CA), andligatedinto the
EcoRI site of pGEM-7Zf+ (Promega Corp., Madison, WI) for transfor-mation of DH5a cells (Bethesda Research Laboratories). The entire
p53 ORFof individualcDNA subclones was sequencedusing
Seque-naseVersion 2.0 (U.S.Biochemical Corp., Cleveland, OH), SP6 and
T7sequencing primers, and four sense oligonucleotides which have
beendescribed(15). Mutationswereconfirmedbysequencingthe ap-propriate portionof the ORF in the opposite direction.
Mutationswerealsoconfirmedbyrestrictionenzyme digestionof
cDNAsubclonesifarestriction sitewasaltered and byrestriction
en-zymedigestionordirect sequencing ofgenomic DNA/PCR products. 1
;igofgenomicDNA wasPCR-amplifiedand 1/20 to 1/250 ofthese
products was used as template in a second heminested PCRreaction
forsequencing.30cyclesat95°Cfor 1min,58°Cfor 1min,and72°C
for 3 minwereutilized.PCRproductswereagarosegelisolated,
Gene-clean-purified (Bio 101), and 500 ngwas directly sequenced using
nestedoligonucleotides.
Family studies. Familyand medical histories were obtained by
chartreview orinterview. Peripheral whiteblood cells were used in the
studies ofparents,siblings,and normalindividualsand were collected
after explanation of studiestobeperfoimed. Restrictionenzyme
diges-tion or directsequencing of genomicDNA/PCR products, and SSCP
analyses wereperformedasappropriatetoindividual cases.
Results
Identification
ofpS3mutations by RNase protection and SSCP analysis. Whilethesensitivityof the RNaseprotectionassay is - 50%,it isspecific and avoids PCR artifact (40) andwasthusemployed as a method ofdetecting small mutations. 25
pa-tientsincluding 12 children andtwoinfantsdiagnosed withB
cellprecursor ALLand11 children withTcellALL were stud-ied. Theirleukemiccellswereobtainedatdiagnosis(15of25),
at BM relapse (8 of 25), orboth(1 of25), and inone case at
failureof induction chemotherapy. 2 of 25 childrenwere iden-tified with RNaseprotectionpatternssuggestive of mutations. SSCPanalysiswasperformed in 23 of 25casesand,consistent with the 50% sensitivity ofRNaseprotection, verifiedthose two
mutations and alsoidentifiedtwoothers (Table I). Unlikethe
RNaseprotectionassay,under theexperimental conditions
de-scribed above 90% (36 of 39) of knownpointmutations of the
p53gene aredetectablebySSCP(39).
Absence of obvious rearrangement or deletion of the p53
gene in childhoodALL. Cytogenetic studies of the p53 gene
wereperformed intheleukemiccellsof33patients,including 7
of the 25 screenedbyRNaseprotection, and revealed an ab-sence of obvious structural abnormalities of chromosome 1 7p
and,in one case, a triploid karyotype. Southern analysisofthe p53 gene was performed in 101 casesincluding 22 of the 25
screened by RNase protection and showed only normal pat-terns and no evidence of rearrangement or deletion (not
shown). LymphoblastDNAofasinglechild withBcell precur-sor ALL atdiagnosis manifestedafragmentof alteredsize in EcoRI, butnotineitherBamHIorHindIIIdigests. Although
exons 5-8appeared normal by SSCPanalysis, eitherasmall mutationorpolymorphismin anotherregionofthep53geneis
possibleinthiscase.
Characterization ofap53mutation in a caseofchildhood T
cellALL.RNaseprotectionassayofperipheralblood(PB)
lym-phoblastmRNAofachild withrelapsedTcellALL(T-ALL
Pt.16)revealed relatively abundant p53messageand suggested thepresenceofbothanormal allele andapointmutationon
the other allele whichlocalizedtothe PA fragment inaregion 3'oftheMprobe (not shown). SSCP analysis also suggesteda
mutation which localizedto exon 8(Fig. 1). cDNAsequencing
ofthep53 ORF revealedapoint mutation(TTTtoTGT,
phe-nylalaninetocysteine)atcodon 270, thus confirming the
find-ings ofboth RNaseprotectionandSSCP (Fig. 2). This
muta-tioncreates anovel PvuIIrestrictionsite,andPvuIIdigestion
ofa PCR-amplified fragment oflymphoblast genomic DNA
and of additional cDNA subclones verified the presence of
bothmutantandwild-typealleles (not shown).
Characterization oftwo p53 abnormalities in a case of
childhood B-cellprecursor ALL.RNaseprotectionassayofPB
lymphoblast mRNAofachild with relapsedBcellprecursor
ALL(Pre-BALLPt.4) showeda relatively low level ofp53
mRNA. The absence of mRNAsfullyprotected byeitherthe
PA or Mprobessuggestedtheabsenceofanormal allele.
Pro-tectionoffourfragments bythe 3'PAprobewhosesumlength
exceededthe sizeof complete
protection
suggestedthepres-enceofmorethanonemRNA(notshown). Oneabnormality
was presentin theregion ofthe M probeoverlappingPAand
was morespecificallylocalizedto exon6 by SSCP(Fig. 1). The
presenceoftwo mRNA species,both witha2-bpdeletion at
p53 codons214/215 whichwouldcause aframe shiftanduse
ofapremature TGAtermination codon in exon 6 was
con-firmedby cDNAsequencing (Fig. 2).Directsequencing of this
area in PCR-amplified lymphoblast genomic DNA revealed
thatonlythemutantallelewaspresent.
One cDNAsubclone contained not only the codon 214/
215deletion,but alsoa133-bp insertionatthe precise junction
oftheunaltered3'and5'endsofexons9 and 10,respectively
(Fig. 2). This cDNA insertion sequence matched that of
se-TableI.Summary ofMutations inthep53Gene inChildhoodALL
Amino acid RNase
Patient Exon Codon Type Mutation change Zygosity Origin Time protection SSCP
T-ALL16 8 270 tv TTT to TGT phetocys hetero non-hered relapse + +
Pre-B 4 6 214/215 del/fs na na homo non-hered relapse + +
Infant 3 7 248 tv CGG to CCG arg to pro hetero non-hered relapse (notatdx) - +
Pre-B80 8 272 tv GTG toTTG val toleu hetero germline dx(remission) - +
Abbreviations: tv, transversion; del, deletion; fs, frameshift; na, not applicable; hetero, heterozygous; homo, homozygous; non-hered,
Pre-B
ALL
Pt. 4
Z 4
... 't 0
kwok
Infant
ALL
Pt.
3
x =
4.C 0
Pre-B
ALL
Pt. 80
.E
I I c& X -G)
7
L .. ..
8
L
wresti.
E4..
*IP
126 187 187 22
AatI1
271 bp 167 bp
!25 261 261 30'
Dra I
I
425 bp 245 bp
Figure 1. Identification and
localization of mutationsto
specificexonsof thep53gene
by the PCR/SSCP method
(39). Patientswerestudiedat
diagnosis, relapse,or
remis-sionasindicated, and DNAs
offamily membersor
indi-vidualswithout p53
muta-tionsservedascontrols. Sites
7 ofrestrictionenzyme
cleav-ageingenomic DNA and
re-4 sultantnormalsizesof
geno-micDNA/PCR fragments
containing individualexons
areshownby schematic.
quencebeginningatnucleotide(nt)196of the 2.5-kb intron9
in normal genomic DNA. The intron 9 genomic DNA se-quenceof thispatient's lymphoblasts wasidenticalto that of
eightnormalindividuals and didnotcontainamutationwhich
would favor alternativesplicing (41)in regions including: (a) the 133alternativelysplicednucleotides(nt196-328 ofintron 9) (see Fig. 2); (b) targetsequences 30 bp upstreamof this
re-gion (taactaac)and upstream ofexon 10(tacttac);and(c) splice
T-ALL
Pt.
16
0
CLL >
5
6
l0
270
21...2-
:::::A.- ...Jo::
::
~~~~~~~~~~~~~~~~.
... ... ... .-.--:::-:::-.--...:---::.ATG TTT1-1TGT
Pre-B ALL Pt. 4
TAdeletion214/215
TGA
,.,,, 4 ~~~~~~~~..._.. .
.12::.:
:0
31...1
ATG TGA TGA
TA deletion 214/215
2
I
....
....
... ....8
.
2 1~~~~~~~~:4: ..2
[3
1
7 8 9 | 10 |1...
ATG
/~~~~~~~~~~~~~~~~ TGA
gaccagaccagctttcaaaaagaaaa ttgttaaagagagcatgaaaatggtt ctatgactttgcctgatacagatgcta ct(g)cttacgatggtgttacttcctg
|ataaactcgtcgtaagttgaaaatatt
248
CGG -*CCG
Pre-B ALL Pt. 80
---..---...---..---...---...--...---..---...---...--...---...--...;;,;;;...;;...;...-;----;;;--
....-.;.-;;--... .. .. ..
...3
ATG
272
GTG -*TTG
Figure2. Schematic of
ab-normalities in thep53 ORF
identified inlymphoblastsby
cDNA(T-ALLPt.16,Pre-B
ALLPt.4)and/or direct
(Pre-B ALL Pt.4, InfantALL
Pt.3, Pre-B ALL Pt.80)
methodsofsequencing.The
shadedregionsrepresent
ORFsequences.Datawere
consistent with the presence
ofboth normal and mutant
allelesinlymphoblast DNA
in allcasesshown except
Pre-B ALL Pt.4 whereonly
the mutant allele is present. The lymphoblast genomic
sequencesurroundingthe
in-tron9insertion in Pre-B ALL
Pt. 4is as follows:
5'-ccaact-K
tataccataatatatattttaaagGAC-CAG... .AATATTgtaatgtt-gaaaatggatttaatacaccta-3'.
consensus sequences attheexon9/intron9 boundary (donor: TCAGgtacta) and the intron 9/exon 10 boundary (acceptor:
ctgcagATCC) and sequencesflankingthe 133-bpintron 9 in-sertion. (For genomicsequencessurrounding this insertion,see
legendtoFig. 2.) Thesedatacorroborate all RNase protection
fragmentsidentifiedand areconsistent withp53 allele loss and
low-leveltranscriptionoftworelated, butdifferentmRNA
spe-cies by alternative splicing fromasingle mutantallele.
Characterization ofap53 mutation in a case ofALL of
infancy. Although RNase protection assay of lymphoblast
mRNAofaninfant withBcellprecursor ALL at relapse(Infant
ALL Pt.3) showed full-length protection with all three ribo-probes (not shown), SSCPanalysis ofgenomicDNAfromthe
samesamplingsuggested bothanormal alleleand an abnormal
allelewith amutation in exon 7 (Fig. 1), whichbydirect
se-quencingwasfoundtobe a G toCtransversionatp53 codon
248(CGG to CCG, arginine to proline) (Fig. 2). Incontrast,
repeated SSCP analyses oflymphoblast genomic DNA
sam-pledatdiagnosisrevealed exon7-containingPCRfragments of onlythe normal size, suggesting that the mutation had been
acquiredatsometime duringthe courseoftherapy.
Agermlinep53mutationinchildhoodBcellprecursorALL.
The leukemic cellsofanadolescentmale (Pre-B ALL Pt.80)
showed atriploidkaryotype.Nop53mutation was detected by theRNaseprotection assay (not shown), but SSCP analysis of BM lymphoblast genomicDNAsuggested thatamutationin exon 8 was present at diagnosis (Fig. 1). At least one normal sequence and a G to Ttransversionatp53 codon272(GTGto
TTG, valinetoleucine)werefoundbydirectsequencing(Fig. 2). Thus, heterozygosity appeared to be retained, although somecontribution to the normal sequence by nonleukemic cells is possible. Both SSCP analysis and direct sequencing showed that mutantand normalalleleswerealsopresent in a
remission BM sample where morphological examination showed no evidence of disease (Fig. 1). These data indicate that themutation atp53codon 272 wasgermline and likely heredi-tary(c.f. subsection Familystudies below).
Southernanalysisofpolymorphic regions.Southern analy-sisof thepBHP53, pMCT35.1,andpYNZ22polymorphicloci wasperformedonlymphoblastgenomicDNAs inall 25 cases
studied byRNaseprotectionandin the caseshowinganovel EcoRI site.Homozygouspatterns were found in two ofthe four caseswith definitive mutations and in the case with a novel EcoRIsite.Incontrast,heterozygouspatternswereobserved at one or moreoftheseloci in the other 23 casesincludingtwo
where mutationswere present. These findings support
chro-T-ALL Pt. 16
ATG TGA
Infant
ALL
Pt. 3
... ... ... ...
...X...
... ... ...
---mosome 17p allele loss in one case with evidence of mutation of the
p53
genewhereonly
themutantp53
allelewasidentified (Pre-B ALL Pt. 4) and verify heterozygosity at chromosome 17p in two cases where both normal and mutant p53 alleles werefound(InfantALL Pt. 3 and Pre-B ALL Pt. 80). In the caseof T-ALL Pt. 16, the leukemic cells showed one normal p53 sequence and an abnormal sequence with a mutation at p53 codon 270, yethomozygouspatternsatall three polymor-phic loci. Based upon the expectedfrequenciesofheterozygos-ityattheseloci (49%, 38%, and 86%,respectively),thechance that all would behomozygous in the same individual is 4% (33-35). Despite the small chance ofthis combination, and since both normal andmutantalleles were present,these
find-ingsareconsistentwith retention ofbothalleleswhichwere by
chance
homozygous
ateachof the three 17ppolymorphic
loci.Family studies. Medical and family histories were available
on 18 of the 25patients studied byRNaseprotectionand on thechild whoselymphoblastDNAshowed a novel EcoRI site. The younger brotherofthepatient with a germline mutation at p53 codon 272 was recently diagnosed with osteogenic sar-coma, and the mother ofthepatientandfivematernal grand-parentsortheirsiblingswere affectedatagesasyoungas30 years withlungandother cancers.This kindredmay thus repre-sent aLi-Fraumenifamily (Fig. 3, top). However,in the three
othercasesofchildhoodALLanalysis ofp53sequence in
paren-talgenomicDNAindicatedthat thep53 mutationswere
nonhe-reditary (not shown). Despite
theacquired
natureof thesemu-tations,thepatientwhoselymphoblastscontainedap53 codon
214/215deletionhad abrotheranddistant cousin with
child-hood acute leukemia and a family history of leukemia and
breast,gastrointestinal,and prostatecancers overfour
genera-tions ofadults(Fig. 3, bottom).Thefamilies of the othertwo
children whose lymphoblasts contained p53 mutations were
affectedbycanceronly during adulthood,and thuswere not
suggestive of the Li-Fraumeni syndrome. Thefamilies of 14
patients
whoselymphoblast p53
geneswerenormal andof thepatient-with a novel EcoRIrestriction site wereeither
unaf-fected bycancer(10 of15),oraffected only
during
adulthood(5of15). Inaddition,onechild with normallymphoblast p53
genes had apast
history
ofEwing's
sarcoma, and another ahistoryremoteby 14 yearsofpreviousALL.
Discussion
Theimpetus for this investigation of p53 mutationsin
child-hood ALL, whetherhereditaryoracquired,wasthereported
findingthatmice transgenic fora mutantp53genedeveloped
lymphoid tumors as well as other Li-Fraumeni syndrome
cancers (29). This syndrome of
multiple
primary
cancers, which occur at an early age in either individuals or infamilies,was firstdescribed in 1969 (42). Softtissue sarcomas, bone,
brain,andbreast cancers, adrenal corticalcarcinomas,and
leu-kemias are considered component tumors of this syndrome in thehuman. In pedigrees with breast cancers, sarcomas, and brain tumors, the presence ofgermline p53 mutations in a
regioncontainingcodons 245, 248, 252,and258 has suggested
that p53 may be the cancersusceptibilitygene(27, 28). The present study demonstrates that in childhoodALL, another component tumor, the p53 genesometimesmay be alteredby
small mutationswhichareeitherhereditary oracquiredand which would lead to changes in predicted p53 peptides (Ta-bleI).
Thelymphoblastsofonechild withrelapsedTcell ALL and
an acquired p53 mutation showed a TtoG transversion at
codon 270 that would result in amino acid substitution
(phenyl-alanineto cysteine) anda change in charge inahighly
con-servedregioninvolved inSV40 largeT antigen binding (5,12).
In another child with B cell precursorALL,whosep53
muta-tionwashereditary,acodon in thissameregion, codon272,
was abnormal (GTG to TTG, valine to leucine). Although these specific mutations have not been observed in other cancers, many mutations clusterin regions of the gene
con-servedin evolution and it has been speculated that theydisrupt
theregulatoryinteraction ofp53withaputativecellular
coun-terpartof large T (15, 17, 18, 19,22).
Thelymphoblasts of another child with relapsed B-cell
pre-cursorALL showedanonhereditaryhomo-orhemizygous
2-bpdeletionatp53 codons 214/215. The resultant frame shift and premature termination inexon6shortens the length ofthe p53 protein product by 44% and eliminates two of the evolu-tionarily conserved domains,oneof the two SV40 large T anti-genbinding sites, and the nuclear localization signal (5, 12, 43). This mutation in exon 6 may also have changed the conforma-tion of the DNA and thus the accessibility of target sequences and/or splice junctions downstream, as a unique mRNAwas
identified which contained both the codon 214/215 deletion and a 133-bp insertion alternatively spliced between exons 9 and 10. This alternatively spliced p53 mRNA is distinct from anypreviously described (16, 17) because it arose by splicinga
region whichwasalready flanked at its 5' end inwild-typeform by the 5'-ag-3' sequence of a splice acceptor and thus began 196 bp internaltothe start of the 2.5-kb intron 9. No mutation in intron 9 favoring alternative splicing was found. The intron 9 sequenceatthe 3'insertion/intron boundary (5'-gtaagt-3')may be a better splice donorconsensusthanthatnormallyfound at theexon9/intron 9boundary (5'-gtacta-3') (41).This 5'-gtaagt-3' may contain acommonpolymorphismwhich results in al-ternative splicing in that itwasalso found in genomic DNA from several normal individuals. In the leukemic cells witha more5' terminationcodon inexon6 theinsertionin the p53 ORF isinconsequential (Fig. 2). However,thesameinsertion containsaninframe TGA 82bpdownstream that would
elimi-nate exons 10 and 11 from thereadingframe and 62 amino acids from thep53protein if present alone. The alternatively spliced mRNA may also reflectincomplete processingoran undeterminedabnormalityintranscriptionalregulation.
Despitetheearlyage ofaninfant with B cell precursor ALL,
thep53codon 248 mutation observedatrelapsewasalso
non-hereditary and,moreover,presumablyacquiredat sometime
during the course ofor perhapsas aresult oftherapy. This
mutation wouldcause anamino acidsubstitution (arginineto
proline)at aresidue of theproteinknowntobe abnormal in
someindividuals with theLi-Fraumeni syndrome.This residue
again falls in aconserved regionofp53 involved in murine
SV40 largeTantigen binding (5, 12).Therefractorynatureof
the disease ofthis infantatrelapsemayattest tothe importance ofaputativeregulatoryfunction(15, 17-19,22).
Findingsof loss ofheterozygosityare often suggestive of
mutations intumorsuppressor genes.Intheheritable form of
retinoblastoma,forexample,asmallmutation inonealleleis
usuallygermlineandprecedestheloss of thesecondallele in
tumorcells(3,44).Consistent witharecessive
model,
in theB-II(1
IL
Lung -50y
40y
0
0
Lung
-O5y
Bone
33y
37y
Uterus Dx 35y
20y ALL 17y
Dx17y Osteogenic
Death19y Sarcoma
p53Codon 272
GTG-.TTG
26y 24y Acute ALL Leukemia Dx5y
Dx5y Death By
DeathSy p53 Codon 2141215 del.
Figure3.Pedigreesofcancerpronefamilies of children with ALL andgermline (top)ornonhereditary(bottom) p53mutations.(o, o) livingmale
orfemale;(i,*) deceased; (\)affectedwithcancer;(U)cancer,typeunknown.
19, 45-49), there is also clear evidence ofloss of the normal allele.In contrast,childhoodALLsometimesmaydifferfrom
othercancerswherep53 behavesas aclassictumorsuppressor
gene since thelymphoblasts of three other children retained
heterozygosity. Such cases instead suggest the postulated "trans-dominant negative" mechanism, where both alleles
-W
X
LProstate
-50y
U
40y
0
u u n=5 n=4
)
)
L
u u
4
produce proteins, butmutationof a single allelecontributesto
transformation because thereissequestrationandinactivation
of wild-type protein by the mutantform(50, 5 1).
By two independent screening tests, this study indicates that thefrequencyof p53mutationsinchildhoodALL is rela-tively low (4 of 25). Thislow frequency is in contrastto muta-tions reported in 5 of 10 T cell ALL celllineswhere in vitro selection has been suggested (52).However,this lowfrequency
ofdetectable mutationsdoes not precludeinvolvementof p53
by othermechanisms including transcriptional inactivationor
posttranslational modification.
We also searchedfor thepresence ofgermline p53 muta-tions andexamined medical andfamily historiesfor cancers
characteristicof theLi-Fraumeni syndrome(42). The
Li-Frau-meni family which weidentifieddiffers from others reported to
have hereditary p53 mutations in both the range of tumors
which occurred(childhoodALL,osteogenicsarcoma, and lung cancer) and the codon 272 location of thegermlinep53 muta-tion. Thispoint mutation isalso incontrasttomajor structural
rearrangementsof the p53 gene which have beendescribedin
osteogenicsarcoma(21). These findings predictthatadditional
heterogeneity in tumor types and specific mutations will be
foundasadditional Li-Fraumeni familiesareinvestigated.
The pedigree of another child withBcell precursor ALL
also seems consistent withacancer-prone
family, having
two other cases ofchildhood leukemia and leukemia and other cancersoverfour generations ofadults. Thep53
codon214/215deletion which wasfound,
nonetheless,
wasnonhereditaryand occurred inaregion ofthe genedistinct fromthat involved
inpreviously reported Li-Fraumeni families.
Moreover,
intwootherpatientswhere ALLrepresentedasecond cancer,nop53
mutationwasidentified atall.These data suggest thata p53
mutationmay notalwaysbeinheritedor evenpresentin
cer-tain cancer-prone individuals and that a mutantgene other
thanp53may beinheritedinfamilieswith
multiple
members affectedby leukemia.Thus,
inchildhoodALLvariantcancersusceptibility
syndromes anda more multifactorialpathoge-neticprocessarepossible.
Acknowledaments
WewishtothankA.Chauvenet and Y. Ravindranath for patient
re-ferrals;J. Fedorko and W.Goldschmidtsforpreparation
ofoligonucleo-tides; P. Chumakovforproviding the entire sequence of thehuman
p53 gene; and F. Li, D. D'Amico,L.Goldstein,D.Jones,and K.Bhatia
for helpful discussions.
CarolynA.Felix isrecipient of the American Society ofPediatric
Hematology-OncologyYoungInvestigator Award(1990).
References
1.Battey, J., C. Moulding, R. Taub, W. Murphy, T. Stewart, H. Potter, G. Lenoir, and P. Leder. 1983. The human c-myc oncogene: structural conse-quences of translocation into the IgH locus inBurkitt lymphoma.Cell. 34:779-787.
2. Testa, J. 1990. Chromosome translocations in human cancer.CellGrowth
Differ. 1:97-101.
3. Ponder, B. 1988. Gene losses in humantumours.Nature(Lond.). 335:400-402.
4. Lane, D., and S. Benchimol. 1990. p53: oncogene oranti-oncogene?Genes Dev. 4:1-8.
5. Soussi, T., C. Caron de Fromentel, and P. May. 1990. Structural aspects of the p53 protein in relation to gene evolution. Oncogene. 5:945-952.
6. Lamb, P., and L. Crawford. 1986.Characterizationof the human p53 gene.
Mol.Cell. Biol.6:1379-1385.
7.Buchman, V.,P.Chumakov,N.Ninkina,0.Samarina,and G.Georgiev.
1988. A variation in thestructureoftheprotein-coding regionofthe humanp53
gene.Gene. 70:245-252.
8.Finlay,C.,P.Hinds,and A. J. Levine. 1989. Thep53 protooncogenecan
actas asuppressoroftransformation.Cell.57:1083-1093.
9.Eliyahu,D.,D.Michalovitz,S.Eliyahu,0.Pinhasi-Kimhi,and M. Oren. 1989. Plasmidsencodingwildtypep53caninhibitoncogene-mediated transfor-mation. Proc.Natl.Acad. Sci. USA.86:8763-8767.
10.Parada, L.,H.Land,R.Weinberg,D.Wolf,and V. Rotter. 1984.
Coopera-tion betweengeneencodingp53tumourantigenandrasin cellular transforma-tion.Nature(Lond.).312:649-651.
1 1.Chen, P.-L.,Y.Chen,R.Bookstein,andW.-H. Lee. 1990. Genetic
mecha-nismsoftumor suppression bythehuman p53 gene. Science(Wash. DC).
250:1576-1580.
12.Zakut-Houri,R.,B.Bienz-Tadmaor,D.Givol,andM. Oren. 1985.
Hu-manp53cellulartumorantigen:cDNA sequence andexpressioninCOS cells.
EMBO(Eur.Mol.Biol.Organ.)J.4:1251-1255.
13.McBride,O.,D.Merry,and D. Givol. 1986. The gene for humanp53
cellular tumorantigenis locatedonchromosome 17 shortarm(17pI3).Proc. Natd.Acad.Sci. USA. 83:130-134.
14.Isobe, M.,B. S.Emanuel,D.Givol,M.Oren,and C. M. Croce. 1986.
Localizationof gene for humanp53 tumourantigentoband 17pl3.Nature
(Lond.).320:84-85.
15.Takahashi,T.,M.Nau,I.Chiba,M.Birrer,R.Rosenberg,M.Vinocour,
M.Levitt,H.Pass,A.Gazdar,andJ. Minna. 1989.p53:afrequenttargetfor geneticabnormalitiesinlungcancer.Science(Wash. DC).246:491-494.
16.Takahashi, T.,D.D'Amico,I.Chiba,D.Buchhagen,and J. Minna. 1990.
Identificationofintronicpointmutationsasanalternative mechanism forp53
inactivationinlungcancer.J.Clin.Invest. 86:363-369.
17.Chiba, I.,T.Takahashi,M. M.Nau,D.D'Amico,D. T.Curiel,T.
Mitsu-domi,D. L.Buchhagen,D.Carbone,S.Piantadosi,H.Koga,etal.(FortheLung CancerStudy Group).1990. Mutations in thep53genearefrequentinprimary,
resected non-small celllungcancer.Oncogene.5:1603-1610.
18.Nigro,J.,S.Baker,A.Preisinger,J.Jessup,R.Hostetter,K.Cleary,S.
Bigner,N.Davidson,S.Baylin,P.Devilee,etal. 1989.Mutationsin thep53gene
occurindiverse humantumourtypes. Nature(Lond.).342:705-708.
19.Baker, S.,E.Fearon,J.Nigro,S.Hamilton,A.Preisinger,J.Jessup,P.
vanTuinen,D.Ledbetter,D.Barker,Y.Nakamura,etal.1989. Chromosome17
deletionsandp53gene mutations incolorectal carcinomas. Science (Wash.DC).
244:217-221.
20.Baker, S.,S.Markowitz,E.Fearon,J.Willson,and B.Vogelstein. 1990.
Suppressionofhuman colorectal carcinoma cellgrowthbywild-type p53.Science
(Wash. DC).249:912-915.
21.Masuda, H.,C.Miller,H. Koeffler,H.Battifora,andM. Cline. 1987. Rearrangementofthep53gene inhumanosteogenicsarcomas.Proc. Nati. Acad.
Sci. USA.84:7716-7719.
22.Mulligan, L.,G.Matlashewski,H.Scrable,andW. Cavanee. 1990.
Mecha-nismsofp53loss inhumansarcomas.Proc.Nati.Acad. Sci. USA.87:5863-5867.
23.Ahujia, H.,M.Bar-Eli,S.Advani,S.Benchimol,andM. Cline. 1989.
Alterations in thep53gene and the clonal evolution of the blastcrisis of chronic myelocyticleukemia.Proc.Nati.Acad.Sci.USA. 86:6783-6787.
24.Mashal, R.,M.Shtalrid,M.Talpaz,H.Kantarjian,L.Smith,J.Beran,A.
Cork,J.Trujilo,J.Gutterman,andA.Deisseroth. 1990.Rearrangementand
expressionofp53in chronicphaseand blast crisis ofchronicmyelogenous
leuke-mia.Blood. 75:180-189.
25.Hsu, I.,R.Metcalf,T.Sun,J.Welsh,N.Wang,andC. Harris. 1991.
Mutationalhotspotin thep53gene in humanhepatocellularcarcinomas. Nature
(Lond.).350:427-428.
26.Bressac, B.,M.Kew,J.Wands,and M. Ozturk. 1991. Selective G to T
mutations ofp53gene inhepatocellularcarcinoma from southern Africa. Nature
(Lond.).350:429-431.
27.Malkin, D.,F.P.Li,L. C.Strong,J. J.Fraumeni,C. E.Nelson,D. H.Kim,
J.Kassel,M. A.Gryka,F. Z.Bischoff,M. A.Tainsky,etal. 1990. Germ linep53
mutations inafamilialsyndromeof breast cancer, sarcomas, and other
neo-plasms.Science(Wash. DC).250:1233-1238.
28.Srivastava, S.,A.Zou,K.Pirollo,S.Blattner,andE.Chang.1990.
Germ-linetransmission ofamutatedp53gene inacancer-prone family with
Li-Frau-menisyndrome. Nature (Lond.). 348:747-749.
29.Lavigueur, A.,V.Maltby,D.Mock,J.Rossant,T. Pawson, and A. Bern-stein. 1989. High incidence of lung, bone, andlymphoidtumorsin transgenic
miceoverexpressingmutantalleles ofthep53oncogene.Mol. Cell. Biol.
9:3982-3991.
30.Felix,C.A.,J. J.Wright, D. G.Poplack,G. H. Reaman, D. Cole,P.
Goldman,andS. J.Korsmeyer.1987. T cell receptor a-, b-, andg-genesin T cell andpre-Bcell acutelymphoblasticleukemia. J. Clin. Invest.80:545-556.
31.Felix,C.A.,D. G.Poplack,G. H. Reaman, S. M. Steinberg, D. E.Cole,
B.J.Taylor,C.G.Begley,andI. R. Kirsch. 1990.Characterizationof
immuno-globulinand T-cell receptorgene patterns in B-cell precursor acutelymphoblastic
leukemia of childhood. J. Clin. Oncol. 8:431-442.
cells without priorinvitro cultureorin vivocolchicine administration. Stain
Tech. 37:17-20.
33.Hoyheim,B., Y. Nakamura, and R. White. 1989. A
BamHI-polymor-phism is detected byagenomic p53-clone (pBHP53).NucleicAcids Res.21:8898.
34. Carlson, M., Y. Nakamura, R. Payson, P.O'Connell, M.Leppert, G. Lathrop, J. Lalouel, and R. White. 1988.Isolationandmapping ofapolymorphic
DNAsequence pMCT35.1 on chromosome 17p[D17S31]. Nucleic Acids Res. 16:783.
35. Nakamura,Y., L. Ballard, M. Leppert, P.O'Connell,G. Lathrop, J.-M. Lalouel, and R. White. 1988.Isolationandmapping of apolymorphicDNA sequence(pYNZ22)onchromosome 17p[D17S30].NucleicAcidsRes.16:5707.
36.Orita,M., H. Iwahana, H. Kanazawa, K.Hayashi,and T.Sekiya. 1989.
Detection of polymorphisms ofhuman DNA gelelectrophoresisassingle strand
conformationpolymorphisms.Proc.Natl.Acad. Sci. USA. 86:2766-2770.
37.Orita, S., Y.Suzuki,T.Sekiya,and K. Hayashi. 1989.Rapidandsensitive
detection of point mutationsand DNApolymorphisms usingthepolymerase
chain reaction.Genomics.5:874-879.
38.Suzuki,Y., M. Orita,M.Shiraishi, K. Hayashi,and T.Sekiya. 1990.
Detection ofras genemutationsin human lung cancers bysinglestrand
confor-mation polymorphism analysis ofpolymerasechainreactionproducts.
Onco-gene.5:1037-1043.
39.Mitsudomi,T., S. M.Steinberg,M. M.Nau, D. Carbone, D.D'Amico,S.
Bodner, H. K.Oie,I. Linnoila,J.S.Mulshine,J. D.Minna,et al. 1991. p53 gene
mutationsinnon-small cell lung cancer cell lines and theircorrelation withthe presenceofrasmutationsandclinical features.Oncogene. In press.
40. Winter, E., F. Yamamoto, C. Almoguera,and M. Perucho. 1985. A
method to detect andcharacterize pointmutations intranscribedgenes:
amplifi-cationandoverexpression ofthe mutant c-Ki-ras allele in human tumor cells.
Proc.Natl.Acad. Sci. USA.82:7575-7579.
41.Mount,S. 1982.Acatalogue ofsplicejunctionsequences. NucleicAcids
Res. 10.
42.Li,F., and J.Fraumeni. 1969. Rhabdomyosarcomainchildren.J.Natl.
CancerInst.43:1365-1373.
43.Addison,C., J. Jenkins, and H.-W. Sturzbecher. 1990. Thep53nuclear
localisation signal isstructurallylinkedto a p34cdc2 kinase motif. Oncogene.
5:423-426.
44.Cavenee, W., T. Dryja, R. Phillips, W. Benedict, R. Godbout, B. Gallie, A. Murphree, L. Strong, and R. White. 1983. Expression of recessive alleles by chromosomal mechanisms in retinoblastoma. Nature(Lond.).305:779-784.
45.Cattoretti,G., F. Rilke, S. Andreola, L. D'Amato, and D. Delia. 1988.p53
expressionin breast cancer. Int.J.Cancer. 41:178-83.
46. Weston, A., J. Willey, R. Modali, H. Sugimura, E. McDowell, J. Resau, B. Light, A. Haugen, D. Mann, B. Trump, et al. 1989.DifferentialDNAsequence
deletionsfrom chromosome 3, 11, 13 and 17 insquamous-cell, large-cell
carci-noma, andadenocarcinoma ofthe human lung. Proc. NatL. Acad. Sci. USA.
86:5099-5103.
47.D'Amico,D., D.Carbone, T.Mitsudomi,M.Nau, J. Fedorko, E. Russell,
B.Johnson, D. Buchhagen, S. Bodner, A. Phelps, et al. 1991. High frequency of
somatically acquiredp53 mutations in small cell lung cancer celllinesand
tu-mors.Oncogene. In press.
48.Varley, J. M., W. J.Brammer,D. P.Lane, J. E.Swallow,C. Dolan, and R. A.Walker. 1991. Lossofchromosome17p13 sequences and mutation of p53 in human breast carcinomas. Oncogene. 6:413-421.
49. Yokota, J., M. Wada, Y.Shimosato,M.Terada, and T.Sugimura. 1987. Loss of heterozygosity on chromosomes 3, 13, 17 in small cell carcinoma and on chromosome 3 in adenocarcinoma ofthelung. Proc.NatL. Acad.Sci. USA.
84:9252-9256.
50.Eliyahu,D., N.Goldfinger,0.Pinhasi-Kimhi,Y.Skurnik, N. Arai, V.
Rotter, and M. Oren. 1988. Meth A fibrosarcoma cells express two transforming mutant p53 species. Oncogene. 3:313-321.
51.Hinds,P.,C. Finlay, and A. Levine. 1989.Mutationisrequiredtoactivate
thep53genefor cooperationwith the ras oncogene andtransformation.J.Virol.
63:739-746.