pastoris Can Enhance the Resistance of This Yeast to H
2
O
2
-Mediated
Oxidative Stress by Stimulating the Glutathione-Based Antioxidative
System
Yang Yang,a,bFangfang Fan,a,bRui Zhuo,a,bFuying Ma,aYangmin Gong,bXia Wan,bMulan Jiang,band Xiaoyu Zhanga
College of Life Science and Technology, Huazhong University of Science and Technology, Wuhan, China,aand Key Laboratory of Oil Crops Biology of Ministry of Agriculture in China, Oil Crops Research Institute of Chinese Academy of Agricultural Sciences, Wuhan, Chinab
Laccase is a copper-containing polyphenol oxidase that has great potential in industrial and biotechnological applications.
Previ-ous research has suggested that fungal laccase may be involved in the defense against oxidative stress, but there is little direct
evidence supporting this hypothesis, and the mechanism by which laccase protects cells from oxidative stress also remains
un-clear. Here, we report that the expression of the laccase gene from white rot fungus in Pichia pastoris can significantly enhance
the resistance of yeast to H
2O
2-mediated oxidative stress. The expression of laccase in yeast was found to confer a strong ability
to scavenge intracellular H
2O
2and to protect cells from lipid oxidative damage. The mechanism by which laccase gene
expres-sion increases resistance to oxidative stress was then investigated further. We found that laccase gene expresexpres-sion in Pichia
pasto-ris could increase the level of glutathione-based antioxidative activity, including the intracellular glutathione levels and the
enzy-matic activity of glutathione peroxidase, glutathione reductase, and
␥-glutamylcysteine synthetase. The transcription of the
laccase gene in Pichia pastoris was found to be enhanced by the oxidative stress caused by exogenous H
2O
2. The stimulation of
laccase gene expression in response to exogenous H
2O
2stress further contributed to the transcriptional induction of the genes
involved in the glutathione-dependent antioxidative system, including PpYAP1, PpGPX1, PpPMP20, PpGLR1, and PpGSH1.
Taken together, these results suggest that the expression of the laccase gene in Pichia pastoris can enhance the resistance of yeast
to H
2O
2-mediated oxidative stress by stimulating the glutathione-based antioxidative system to protect the cell from oxidative
damage.
W
hite rot fungus has a strong ability to degrade lignin because
this kind of fungus can produce extracellular and
nonspe-cific ligninolytic enzymes, which mainly include lignin peroxidase
(LiP), manganese peroxidase (MnP), and laccase (
10
,
21
,
22
,
26
,
46
). Laccase belongs to a group of copper-containing polyphenol
oxidases that can catalyze the four-electron reduction of O
2to
H
2O, with the concomitant oxidation of phenolic compounds.
Due to its special characteristics, such as its wide range of
sub-strates, its ability to oxidize many different phenolic compounds,
and its use of molecular oxygen as the final electron acceptor,
laccase has seen wide application in industry and biotechnology,
including paper pulping and bleaching, bioremediation, and
tex-tile dye decolorization (
1
,
4
,
8
,
13
,
25
,
27
,
31
,
42
,
44
,
48
,
59
).
Although laccase has great potential for industrial and
biotech-nological applications, the biological function of laccase has
not been fully determined or confirmed. Previous research has
indicated that fungal laccase may play a role in lignin
degrada-tion, the development of fruiting bodies, fungal
morphogene-sis, fungal pathogenicity, and the synthesis of pigments (
3
,
11
,
14
,
45
,
51
,
52
,
61
).
Recent research has suggested that laccase may play an
impor-tant role in fungal defense against oxidative stress, which acts as an
element of the stress response. It has been observed that oxidative
stress can induce the expression of ligninolytic enzymes in some
basidiomycetes (
6
,
33
,
41
). The extracellular laccase activity of
some white rot basidiomycetes such as Fomes fomentarius,
Tyro-myces pubescens, Trametes versicolor, and Abortiporus biennis can
be stimulated by the oxidative stress caused by exogenous
mena-dione and paraquat. Enhanced extracellular laccase activity is
con-sidered part of the system for the adaptive response of white rot
fungus to paraquat- and menadione-caused oxidative stress
con-ditions (
33
,
34
). A notable increase in the laccase activity of two
fungal species, Trametes versicolor and Abortiporus biennis, can be
observed after treatment with oxidative stress factors such as
men-adione, paraquat, and hydrogen peroxide (
12
). The laccase
activ-ity of some other species such as Cerrena unicolor, Abortiporus
biennis, Ganoderma lucidum, and Ceriporiopsis subvermispora can
also be significantly induced by other oxidative stress factors, such
as Cd ions (
32
), the herbicides bentazon and diuron (
16
), and
hydroquinone (
2
). These stress factors, which induce oxidative
stress, can increase extracellular laccase activity and enhance both
superoxide dismutase (SOD) and catalase (CAT) activity. This
implies that laccase can participate in the adaptive response to
oxidative stress in white rot fungus (
33
,
34
).
The study of plant-pathogenic fungi has also suggested that
laccase is involved in defense against oxidative stress in other fungi
besides white rot fungus. One study on the plant-pathogenic
fun-Received 23 January 2012 Accepted 5 June 2012 Published ahead of print 15 June 2012
Address correspondence to Yang Yang, yangyang@mail.hust.edu.cn, or Xiaoyu Zhang, zhangxiaoyu@mail.hust.edu.cn.
Copyright © 2012, American Society for Microbiology. All Rights Reserved.
gus Rhizoctonia solani has revealed that copper, paraquat, and
alcohol treatments, which are known to cause oxidative stress by
promoting the formation of free radicals, can induce laccase
ac-tivity and increase the level of lipid peroxidation. A
straightfor-ward link between oxidative stress and laccase induction was
found in the case of paraquat treatment (
20
). A genetic study on
another plant-pathogenic fungus, Fusarium oxysporum, has also
suggested that laccase may have a role in protection against
oxi-dative stress. Strains with null mutations in laccase genes showed
higher sensitivity to oxidative stress than the wild-type strain,
in-dicating the importance of laccase in the defense against oxidative
stress (
18
,
19
).
As mentioned above, fungal laccase may be involved in the
adaptive response to oxidative stress. However, the hypothesis
that laccase plays an important role in defense against oxidative
stress is mainly based on the phenomenon that laccase activity can
be induced by various oxidative stress factors (
2
,
12
,
16
,
20
,
32
–
34
). To our knowledge, there is little direct evidence supporting
the involvement of laccase in the defense against oxidative stress.
Therefore, additional efforts are needed to prove that laccase
con-tributes to defense against oxidative stress. More direct
experi-mental data are required to confirm that the induction of laccase is
an element of the oxidative stress response. In addition, the
mech-anism by which laccase protects cells from oxidative stress has yet
to be elucidated. Recently Kim et al. reported that expression of
the laccase gene from the fungus Coprinellus congregatus in
Sac-charomyces cerevisiae could increase the survival rate of yeast
un-der the oxidative stress caused by H
2O
2. Laccase expression was
found to increase the survival rate of yeast exposed to oxidative
stress. This study provides evidence that laccase is involved in
resistance to oxidative stress (
37
). However, the mechanism
un-derlying this protection remains unclear.
In order to determine the function and mechanism of laccase
in the defense against oxidative stress, we expressed the laccase
gene from white rot fungus in the heterologous yeast host Pichia
pastoris and investigated the mechanism of resistance to oxidative
stress conferred. Pichia pastoris has seen widespread use as a
pro-tein expression system because it has the advantages of higher
eukaryotic expression systems such as protein processing, protein
folding, and posttranslational modification (
47
,
49
,
50
). Pichia
pastoris is a methanolotrophic yeast with the ability to metabolize
methanol as its sole carbon source. High levels of hydrogen
per-oxide are produced during the first step of the yeast methanol
metabolism process. This causes strong oxidative stress. The
glu-tathione redox system, which includes synthesis and recycling, has
been found to play an important role in scavenging hydrogen
peroxide, detoxifying reactive oxygen species, and protecting
against oxidative stress in Pichia pastoris (
55
,
56
,
58
). We have
previously cloned and characterized a laccase gene, lac5930-1, and
its corresponding full-length cDNA from white rot fungus
Trame-tes sp. 5930, isolated from Shennongjia Nature Reserve in China
(
54
). In this study, we found that the expression of this laccase
gene in Pichia pastoris could significantly increase the resistance of
yeast to H
2O
2-mediated oxidative stress. Laccase gene expression
in yeast was found to confer a strong ability to scavenge
intracel-lular H
2O
2and protect cells from lipid oxidative damage. The
mechanism by which the expression of the laccase gene increases
the resistance to the oxidative stress was then investigated. Our
research demonstrates that the expression of the laccase gene in
Pichia pastoris can enhance the resistance of yeast to H
2O
2-medi-ated oxidative stress by stimulating the glutathione-based
antioxi-dative system. Our findings provide strong and direct evidence for
the importance of laccase in the defense against oxidative stress.
They also contribute to the determination of the mechanism by
which laccase protects cells from oxidative stress.
MATERIALS AND METHODS
Strains and plasmids. Pichia pastoris GS115 and the expression vector
pPIC3.5K were purchased from Invitrogen. The plasmid pPIC3.5K-lac5930-1 was constructed in our previous work (54). The full-length cDNA of laccase gene lac5930-1, including its native signal peptide se-quence, was cloned into the plasmid pPIC3.5K, generating the recom-binant plasmid pPIC3.5K-lac5930-1 (containing the native signal pep-tide sequence of laccase). Thus, laccase can be secreted from cells using the native signal peptide sequence encoded by lac5930-1 as the secre-tion signal.
Buffered minimal glycerol (BMG) medium was composed of 100 mM potassium phosphate, pH 6.0, 1.34% YNB (yeast nitrogen base with am-monium sulfate without amino acids), 4⫻ 10⫺5% biotin, and 1% glyc-erol. Buffered minimal methanol (BMM) medium was composed of 100 mM potassium phosphate, pH 6.0, 1.34% YNB, 4⫻ 10⫺5% biotin, and 0.5% methanol. Both of these media were prepared according to the in-structions of the multicopy Pichia expression kit manual (Invitrogen). The yeast transformants pPIC3.5K-lac5930-1/GS115 and pPIC3.5K/ GS115 were obtained in one of our previous studies (54). In pPIC3.5K-lac5930-1/GS115, the recombinant plasmid pPIC3.5K-lac5930-1, con-taining the full-length cDNA of the laccase gene lac5930-1 from white rot fungus Trametes sp. 5930, was introduced into Pichia pastoris GS115. In pPIC3.5K/GS115, the empty expression vector pPIC3.5K, which lacks the laccase gene, was introduced into Pichia pastoris GS115 to serve as the control.
Detection of laccase gene expression in Pichia pastoris transfor-mants. The yeast transformants pPIC3.5K-lac5930-1/GS115 and
pPIC3.5K/GS115 were inoculated into separate 20-ml volumes of BMG medium in 250-ml Erlenmeyer flasks and incubated at 30°C to an optical density at 600 nm (OD600) of 10 with shaking at 200 rpm. Then the
cultures were centrifuged at 3,000⫻ g for 5 min, and the cell pellets were suspended to an OD600of 2.0 with 30 ml BMM medium (pH 6.0). The
cultures were grown at 20°C with shaking at 200 rpm, with 0.5% (vol/vol) methanol being added daily.
Laccase activity in the culture supernatants was measured using the 2,2=-azinobis(3-ethylbenzthiazoline-6-sulfonate) (ABTS) method (17). Assay mixtures contained 0.5 mM ABTS, 0.1 M sodium acetate (pH 5.0), and 100l culture fluid. Oxidation of ABTS was monitored by determin-ing the increase in A420(⑀ ⫽ 36,000 M⫺1cm⫺1). One unit of enzyme
activity was defined as the amount of enzyme required to oxidize 1mol of ABTS per min (17). The transcription of the laccase gene (lac5930-1) in Pichia pastoris transformants was detected by reverse transcription-PCR (RT-PCR) as follows. Total RNA was isolated from the cultures of yeast transformants using TRIzol reagent (Invitrogen) according to the manu-facturer’s instructions, followed by RNase-free DNase (Promega) diges-tion to remove the genomic DNA (gDNA) contaminadiges-tion. Then RT-PCR was performed to detect the transcription of the laccase gene in yeast using a PrimeScript RT-PCR kit (TaKaRa) according to the manufacturer’s in-structions. The PpGPD gene, encoding Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase, was used as the internal control. The se-quences of laccase gene-specific primers (Fw and lac5930-1-Rv) and PpGPD gene-specific primers (PpGPD-Fw and PpGPD-lac5930-1-Rv) used for RT-PCR are listed inTable 1. All experiments were performed in triplicate.
Detection of the level of resistance to H2O2-mediated oxidative stress of two yeast transformants. The Pichia pastoris transformants
pPIC3.5K-lac5930-1/GS115 and pPIC3.5K/GS115 were inoculated into separate 20-ml volumes of BMG medium in 250-ml Erlenmeyer flasks and incubated at 28°C to an OD600of 20 with shaking at 200 rpm. For
adaptation to the oxidative stress caused by exogenous H2O2, the cultures
were centrifuged at 3,000⫻ g for 5 min. The cell pellets were transferred to 30 ml BMM medium containing 100M H2O2. The cultures were then
incubated at 20°C with shaking at 200 rpm for 7 days, with 0.5% (vol/vol) methanol being added daily. Adapted yeast cells were transferred to 30 ml of fresh BMM medium (initial OD600was adjusted to 0.9) and then
incu-bated at 20°C with shaking at 200 rpm. After 2 days, H2O2was added into
the cultures at concentrations of 0, 50, 100, and 200 mM. Then the cul-tures with different concentrations of exogenous H2O2were grown at
20°C with shaking at 200 rpm. The growth of the yeast cells exposed to different concentrations of exogenous H2O2was monitored by measuring
the OD600daily. The yeast cultures were withdrawn at different times for
quantitative detection of the transcription of various genes and measure-ment of the physiological indexes. The points in time at which oxidation, enzyme levels, and transcription levels were measured were chosen based on the growth phases of Pichia (logarithmic phase). All experiments were performed in triplicate.
Preparation of yeast cell extracts. Preparation of whole-cell
homog-enate for measurement of the physiological indexes related to yeast oxi-dative stress and antioxioxi-dative activity was performed as follows. Yeast cells were collected by centrifugation and washed three times with distilled water to remove the external H2O2(used for exerting H2O2-mediated
oxidative stress) and any traces of growth medium. Then cells were dis-rupted using the method enclosed with the multicopy Pichia expression kit (Invitrogen). Cell homogenates were clarified by centrifugation. The resulting supernatant was collected and used as cell extract for further analysis. Protein concentration was determined using the method de-scribed by Bradford (7).
Measurement of the physiological indexes related to the yeast oxi-dative stress and antioxioxi-dative activity. (i) Measurement of MDA and intracellular H2O2. The level of malondialdehyde (MDA), an end
prod-uct of the peroxidation of polyunsaturated fatty acids, was measured using an MDA spectrophotometric detection kit (Nanjing Jiancheng Bioengi-neering Institute, Nanjing, China) according to the method described previously (43). MDA was determined using the thiobarbituric acid (TBA) method based on its reaction with TBA to form thiobarbituric acid-reactive substances (TBARS). The MDA level is expressed asmol/g of dry yeast cells. The level of intracellular H2O2was measured according
to the method described previously (23). All experiments were performed in triplicate.
(ii) Measurement of intracellular reduced GSH. The amount of
in-tracellular glutathione (GSH) was determined using a GSH detection kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) based on the method reported by Jollow et al. (35). 5,5=-Dithiobis-2-nitrobenzoic acid (DTNB) was used to develop color. The development of yellow color was monitored at 412 nm on a spectrophotometer. GSH content is ex-pressed asmol/g of dry yeast cells. All experiments were performed in triplicate.
(iii) Measurement of glutathione peroxidase activity. The activity of
glutathione peroxidase (GPx) was measured using a GSH-Px detection kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) according to the manufacturer’s instructions; the kit was designed based on princi-ples described by Hafeman et al. and Banni et al. (5,29). Glutathione peroxidase degraded H2O2in the presence of GSH, decreasing GSH levels.
The remaining GSH was then measured using the reaction with DTNB. Absorbance was recorded at 412 nm. One unit of GPx enzyme activity was defined as that capable of consuming 1mol of GSH per minute. The activity of glutathione peroxidase is expressed as U/mg of dry yeast cells. All experiments were performed in triplicate.
(iv) Measurement of␥-GCS activity. The activity of
␥-glutamylcys-teine synthetase (␥-GCS) was measured using a ␥-glutamylcysteine syn-thetase detection kit (Nanjing Jiancheng Bioengineering Institute, Nan-jing, China) according to the manufacturer’s instructions; the kit was designed using principles described by Chung et al. and Kenchappa et al. (15,36). The amount of inorganic phosphate (Pi) released by␥-GCS was
calculated from the standard curve. One unit of␥-GCS activity was de-fined as the amount of enzyme capable of synthesizing 1mol of Piper
hour under assay conditions. The activity of␥-GCS is expressed as U/mg of dry yeast cells. All experiments were performed in triplicate.
(v) Measurement of glutathione reductase activity. The activity of
glutathione reductase (GR) was measured using a GR detection kit (Nan-jing Jiancheng Bioengineering Institute, Nan(Nan-jing, China) according to the manufacturer’s instructions; the kit was designed based on the method described by Di Ilio et al. and Casalone et al. (9,24). GR activity was determined by following the decrease in absorbance at 340 nm due to the oxidation of NADPH to NADP⫹. The activity of GR is expressed as mU/mg of dry yeast cells. All experiments were performed in triplicate.
(vi) Measurement of catalase activity. The activity of CAT was
mea-sured using a CAT detection kit (Nanjing Jiancheng Bioengineering Insti-tute, Nanjing, China) according to the manufacturer’s instructions. CAT activity was measured using the ammonium molybdate spectrophoto-metric method, which is based on the fact that ammonium molybdate can rapidly terminate the H2O2degradation reaction catalyzed by CAT and
react with the residual H2O2to generate a yellow complex, which could be monitored by the absorbance at 405 nm (30). All experiments were per-formed in triplicate.
qRT-PCR detection of the transcription of various genes in yeast transformants under H2O2-mediated oxidative stress. Total RNA was
isolated from yeast cells using the TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. First-strand cDNA was then synthe-sized using a PrimeScript RT reagent kit with gDNA eraser (TaKaRa). Two microliters of RT product was used as a template for quantitative real-time RT-PCR (qRT-PCR). qRT-PCR was performed using an iCycler iQ5 real-time PCR system (Bio-Rad) and a SYBR Premix Ex Taq II kit (Tli RNaseH Plus; TaKaRa) according to the manufacturer’s instructions. The primer pairs used for quantitative measurement of the transcription of the laccase gene (lac5930-1) and other genes related to the glutathione redox system (PpGPX1, PpPMP20, PpGLR1, PpGSH1, and PpYAP1) are listed in Table 1. The qRT-PCR mixture (25l) contained 2.0 l of cDNA and 0.4 M each gene-specific primer as well as 1⫻ SYBR Premix Ex Taq II (Ta-KaRa). The qRT-PCR was performed as follows: 10 min at 95°C followed by 30 cycles of 30 s at 95°C, 30 s at 55°C, and 30 s at 72°C, followed by a melting cycle from 55°C to 95°C to check for amplification specificity. The PpACT1 gene, encoding actin, and PpGPD gene, encoding glyceralde-hyde-3-phosphate dehydrogenase, were used as internal controls. The
TABLE 1 Oligonucleotide primers used in this study
Primer Nucleotide sequence
lac5930-1-Fw ATGGTGGGACTACAGCGCTTC lac5930-1-Rv CTATCGGTCCGTCAGCGAACC PpGPD-Fw TCCAGAATTGAACGGTAAGCTGAC PpGPD-Rv CGACGACTCTGGTGGAGTAAC qRT-lac5930-1-Fw AGCGCTTCAGCTTCTTCGTTAC qRT-lac5930-1-Rv CCAGTGGATACTGGTGGACTTG qRT-PpGPX1-Fw ACCAGTTTGGTCATCAGGAACCAGG qRT-PpGPX1-Rv ACCTTTGAATCCGAGGAGACCAGAC qRT-PpPMP20-Fw GTGATCACTGCCAACGATGC qRT-PpPMP20-Rv TGACCCAGTCCAGCAACTGA qRT-PpGLR1-Fw TTGTGTCCATGTTCTATGCCATGTCC qRT-PpGLR1-Rv TCTTCAGCACTGGTTGGATGGATAG qRT-PpGSH1-Fw CCGAAGAGGTTGTAAAGTGGCTATC qRT-PpGSH1-Rv AGCTTCTGCGTCACTGTATGGAAAC qRT-PpYAP1-Fw CTGGCCGAGTTTGACCCTAC qRT-PpYAP1-Rv TTGGATGTCGCTCTCAATGG qRT-PpACT1-Fw GCCGGTAGAGATTTGACCGACTACTTGATG qRT-PpACT1-Rv GTAAGTGGTTTGGTCGATACCAGAAGCCTC qRT-PpGPD-Fw TAAGGCCGTCGGTAAGGTTATT qRT-PpGPD-Rv TGTAACCCAAAACACCCTTGAG
relative abundance of mRNAs was normalized against the levels of PpACT1. Each sample was amplified in triplicate in each experiment. Two independent experiments were performed, and they showed the same results.
RESULTS
Expression of laccase gene from Trametes sp. 5930 in Pichia
pas-toris. The cDNA of the laccase gene from white rot fungus
Trame-tes sp. 5930, lac5930-1 (
54
), was cloned into the expression vector
of Pichia pastoris pPIC3.5K, producing the recombinant plasmid
pPIC3.5K-lac5930-1. Then pPIC3.5K-lac5930-1 and the empty
vector pPIC3.5K were transformed into Pichia pastoris GS115,
generating two yeast transformants, pPIC3.5K-lac5930-1/
GS115 and pPIC3.5K/GS115. Successful expression of the
lac-case gene in Pichia pastoris was confirmed by measuring the
secreted laccase activity of these yeast transformants (
Fig. 1A
)
and detecting the transcription level of the lac5930-1 gene by
RT-PCR (
Fig. 1B
).
Expression of the laccase gene in Pichia pastoris could
in-crease the level of resistance to H
2O
2-mediated oxidative stress
and protect the yeast cells from lipid oxidative damage caused
by exogenous H
2O
2. The level of resistance to H
2O
2-mediated
oxidative stress was analyzed by detection of the growth rate of
pPIC3.5K-lac5930-1/GS115 and pPIC3.5K/GS115 subjected to
various concentrations of exogenous H
2O
2. As shown in
Fig. 2A
,
the growth of pPIC3.5K-lac5930-1/GS115 and that of pPIC3.5K/
GS115 were very similar in the absence of exogenous H
2O
2. As
shown in
Fig. 2B
, the growth of pPIC3.5K/GS115 was strongly
inhibited under oxidative stress caused by exogenous H
2O
2when
no laccase was expressed. However, the growth of
pPIC3.5K-lac5930-1/GS115, in which laccase was successfully expressed, was
not influenced by exogenous H
2O
2. pPIC3.5K-lac5930-1/GS115
was more resistant to exogenous H
2O
2(50 mM) than pPIC3.5K/
GS115 (
Fig. 2B
). We also found that pPIC3.5K-lac5930-1/GS115
could be resistant to higher concentrations of exogenous H
2O
2(100 and 200 mM) (data not shown). These results indicate that
the expression of laccase in Pichia pastoris can increase the
resis-tance of yeast to H
2O
2-mediated oxidative stress.
The oxidative damage to the two yeast transformants exposed
to different concentrations of H
2O
2was evaluated further. The
degree of oxidative damage to lipids was assessed by determining
the levels of oxidized lipids. These were determined by measuring
levels of malondialdehyde (MDA), an end product of the
peroxi-dation of polyunsaturated fatty acids. As shown in
Fig. 3A
, the
MDA levels of pPIC3.5K/GS115 exposed to 50 mM and 100 mM
H
2O
2became significantly higher than those of control cells not
exposed to exogenous H
2O
2. For example, after 12 h, the MDA
levels of pPIC3.5K/GS115 exposed to 50 mM and 100 mM H
2O
2were found to be 1.06 and 1.85
mol/g dry cells but the MDA
content of pPIC3.5K/GS115 exposed to 0 mM H
2O
2was only 0.13
mol/g dry cells. The MDA level of pPIC3.5K/GS115 increased as
exogenous H
2O
2stress increased. The high level of oxidized lipids
confirmed the development of severe oxidative stress in the yeast
cultures subjected to exogenous H
2O
2(
Fig. 3A
). As shown in
Fig.
3A
, the MDA levels of pPIC3.5K-lac5930-1/GS115 exposed to 50
mM and 100 mM H
2O
2were much lower than those of pPIC3.5K/
GS115 under the same concentrations of H
2O
2for the same time.
For example, the MDA contents of pPIC3.5K-lac5930-1/GS115
exposed to 50 mM and 100 mM H
2O
2for 12 h were found to be
only 0.36 and 0.45
mol/g dry cells, respectively, much lower than
those of pPIC3.5K/GS115 (
Fig. 3A
). These results suggest that the
degree of lipid oxidative damage to pPIC3.5K-lac5930-1/GS115
upon exposure to exogenous H
2O
2is much less than that to
pPIC3.5K/GS115. Laccase gene expression in
pPIC3.5K-lac5930-FIG 1 Detection of laccase gene expression in Pichia pastoris transformants.(A) Measurement of the laccase activity produced by the two yeast transfor-mants. In lac5930-1/GS115, the recombinant plasmid pPIC3.5K-lac5930-1, carrying the laccase gene lac5930-1 from white rot fungus Trametes sp. 5930, was introduced into Pichia pastoris GS115. In pPIC3.5K/GS115, the empty expression vector pPIC3.5K, without the laccase gene, was introduced into Pichia pastoris GS115 as the control. Results are means⫾ standard devi-ations (n⫽ 3). (B) RT-PCR for detection of the transcription of laccase gene lac5930-1 in Pichia pastoris transformants. Lane 1, pPIC3.5K/GS115 (control); lane 2, pPIC3.5K-lac5930-1/GS115. Transcription of the PpGPD gene, encod-ing Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase, was used as the internal control.
FIG 2 Growth curves of the Pichia pastoris transformants
pPIC3.5K-lac5930-1/GS115 and pPIC3.5K/GS115 under oxidative stress caused by 0 mM (A) or 50 mM (B) exogenous H2O2. Results are means⫾ standard
1/GS115 can protect the yeast cells from lipid oxidative damage
caused by exogenous H
2O
2.
The intracellular H
2O
2concentrations of two yeast
transfor-mants exposed to different concentrations of H
2O
2were also
determined. As shown in
Fig. 3B
, the intracellular
concentra-tions of H
2O
2in pPIC3.5K/GS115 exposed to 50 mM and 100
mM exogenous H
2O
2were much higher than those in
pPIC3.5K-lac5930-1/GS115. For example, the intracellular
H
2O
2concentrations in pPIC3.5K/GS115 exposed to 50 mM
and 100 mM H
2O
2for 12 h were found to be 21.1 and 32.0
mmol/g dry cells, respectively, but the intracellular H
2O
2con-centrations in pPIC3.5K-lac5930-1/GS115 under the same
conditions were only 6.9 and 7.2 mmol/g dry cells (
Fig. 3B
).
The concentration of intracellular H
2O
2in pPIC3.5K/GS115
increased as exogenous H
2O
2stress increased. These results
indicate that pPIC3.5K-lac5930-1/GS115 has a greater ability
to scavenge intracellular H
2O
2than pPIC3.5K/GS115. This
im-plies that laccase gene expression in pPIC3.5K-lac5930-1/
GS115 can contribute to the scavenging of intracellular H
2O
2and protect cells against H
2O
2-mediated oxidative stress.
Expression of the laccase gene in Pichia pastoris could
en-hance the level of resistance to H
2O
2-mediated oxidative stress
by stimulating the glutathione redox system of yeast. The above
results indicated that the expression of the laccase gene in Pichia
pastoris could enhance resistance to H
2O
2-mediated oxidative
stress. pPIC3.5K-lac5930-1/GS115 had greater ability to resist this
oxidative stress than pPIC3.5K/GS115. Based on this finding, we
studied the mechanism of how laccase gene expression increased
the resistance of yeast to H
2O
2-mediated oxidative stress. In order
to determine the mechanism underlying the differences in
resis-tance to H
2O
2-mediated oxidative stress between
pPIC3.5K-lac5930-1/GS115 and pPIC3.5K/GS115, the levels of antioxidant
defense activity of these two yeast transformants in the presence of
H
2O
2were evaluated.
First, the levels of glutathione-based antioxidative activity of
the two yeast transformants exposed to exogenous H
2O
2were
investigated. As shown in
Fig. 4
and
5
, the levels of glutathione
redox activity of pPIC3.5K-lac5930-1/GS115 and pPIC3.5K/
GS115, including the intracellular GSH content and the activities
of glutathione peroxidase, glutathione reductase, and
␥-gluta-mylcysteine synthetase, were very similar in the absence of
exo-genous H
2O
2. In contrast, the level of glutathione redox activity of
pPIC3.5K-lac5930-1/GS115 was much higher than that of pPIC3.5K/
GS115 when the yeast transformants were exposed to exogenous
H
2O
2. A significant increase in the level of glutathione redox activity
was observed when pPIC3.5K-lac5930-1/GS115 was exposed to
ex-ogenous H
2O
2. However, the activity of the glutathione redox system
of pPIC3.5K/GS115 remained very low under H
2O
2stress conditions
(
Fig. 4
and
5
). As shown in
Fig. 4A
, the intracellular GSH content
of pPIC3.5K-lac5930-1/GS115 was significantly higher than that of
pPIC3.5K/GS115 when the yeast transformants were exposed to
exogenous H
2O
2(50 and 100 mM) for 12 h (
Fig. 4A
). The activities of
glutathione peroxidase (
Fig. 4B
),
␥-GCS (
Fig. 5A
), and glutathione
reductase (
Fig. 5B
) of pPIC3.5K-lac5930-1/GS115 were also always
higher than those of pPIC3.5K/GS115 when the yeast transformants
were exposed to exogenous H
2O
2for 12 h. We also observed that the
levels of intracellular GSH and the activities of glutathione
peroxi-dase,
␥-GCS, and glutathione reductase in pPIC3.5K-lac5930-1/
GS115 all increased as the concentration of exogenous H
2O
2in-creased (
Fig. 4
and
5
).
The activity of another antioxidative enzyme, catalase, was also
FIG 3 Detection of the malondialdehyde (MDA) and the intracellular H2O2contents of the Pichia pastoris transformants pPIC3.5K-lac5930-1/GS115 and pPIC3.5K/GS115 when subjected to different concentrations of exogenous H2O2(0, 50, and 100 mM). (A) MDA content of yeast cells exposed to H2O2for
12 h. (B) Intracellular H2O2content of yeast cells exposed to H2O2for 12 h.
Results are means⫾ standard deviations (n ⫽ 3).
FIG 4 Detection of the intracellular glutathione content and glutathione
per-oxidase activity of the Pichia pastoris transformants pPIC3.5K-lac5930-1/ GS115 and pPIC3.5K/GS115 when subjected to different concentrations of exogenous H2O2(0, 50, and 100 mM). (A) Intracellular glutathione content of
yeast cells exposed to H2O2for 12 h. (B) Intracellular glutathione peroxidase
activity of yeast cells exposed to H2O2for 12 h. Results are means⫾ standard
measured. It was found that the catalase activity of
pPIC3.5K-lac5930-1/GS115 exposed to exogenous H
2O
2was similar to that
of pPIC3.5K/GS115 (data not shown).
The transcription of the laccase gene in pPIC3.5K-lac5930-1/
GS115 could be stimulated by the oxidative stress caused by
exogenous H
2O
2. The effects of the level of oxidative stress on
laccase gene transcription in pPIC3.5K-lac5930-1/GS115 were
in-vestigated. A time course detection of laccase gene transcription in
pPIC3.5K-lac5930-1/GS115 exposed to different concentrations
of H
2O
2was performed. As shown in
Fig. 6A
and
B
, the
transcrip-tion of the laccase gene increased over time when
pPIC3.5K-lac5930-1/GS115 was exposed to 50 or 100 mM exogenous H
2O
2but not when it was exposed to 0 mM H
2O
2. It instead remained
low throughout the incubation (
Fig. 6A
and
B
). This suggested
that the transcription of the laccase gene in pPIC3.5K-lac5930-1/
GS115 was significantly increased upon exposure to exogenous
H
2O
2. The transcription levels of the laccase gene in
pPIC3.5K-lac5930-1/GS115 exposed to 50 mM and 100 mM H
2O
2for 12 h
were about 5.3 and 9.2 times higher than the level of transcription
in pPIC3.5K-lac5930-1/GS115 not exposed to H
2O
2. The
tran-scription levels of the laccase gene in pPIC3.5K-lac5930-1/GS115
exposed to 50 mM and 100 mM H
2O
2for 24 h were about 7.8 and
9.8 times higher (
Fig. 6A
and
B
).
We also compared laccase transcription levels in
pPIC3.5K-lac5930-1/GS115 exposed to different concentrations of H
2O
2(50
and 100 mM). As shown in
Fig. 6A
and
B
, the transcription levels
of the laccase gene in pPIC3.5K-lac5930-1/GS115 subjected to 100
mM H
2O
2for 2, 8, and 12 h were increased to about 2.1, 2.8, and
1.9 times, respectively, that of the same transformant subjected to
50 mM H
2O
2for the same amount of time. This suggested that the
transcription of laccase genes in yeast increased as the level of
oxidative stress increased.
The effects of phases of growth on the transcription of the
housekeeping gene PpACT1 in pPIC3.5K-lac5930-1/GS115 were
also detected. Another housekeeping gene, PpGPD, encoding
glyceraldehyde-3-phosphate dehydrogenase, was used as an
inter-nal control. The transcription levels of PpACT1 (used as the
neg-ative control in the quantitneg-ative real-time RT-PCR in
Fig. 6A
and
B
) in different phases of growth were measured by qRT-PCR. As
shown in
Fig. 6C
, the transcription levels of PpACT1 did not differ
across phases.
Expression of the laccase gene in Pichia pastoris could
stim-ulate the transcription of genes involved in the
glutathione-based antioxidative system in response to H
2O
2-mediated
oxi-dative stress. The above results suggested that the expression of
FIG 5 Detection of intracellular␥-glutamylcysteine synthetase (␥-GCS)ac-tivity and glutathione reductase acac-tivity of the Pichia pastoris transformants pPIC3.5K-lac5930-1/GS115 and pPIC3.5K/GS115 when subjected to different concentrations of exogenous H2O2(0, 50, and 100 mM). (A) Intracellular
␥-GCS activity of yeast cells exposed to H2O2for 12 h. (B) Intracellular
gluta-thione reductase activity of yeast cells exposed to H2O2for 12 h. Results are
means⫾ standard deviations (n ⫽ 3).
FIG 6 Quantitative real-time RT-PCR (qRT-PCR) for detecting the
transcrip-tion level of the laccase gene in pPIC3.5K-lac5930-1/GS115 exposed to differ-ent concdiffer-entrations of exogenous H2O2(0, 50, and 100 mM). (A) Time course
detection of the transcription level of the laccase gene in pPIC3.5K-lac5930-1/ GS115 exposed to 0 and 50 mM H2O2. (B) Time course detection of the
transcription level of the laccase gene in pPIC3.5K-lac5930-1/GS115 exposed to 0 and 100 mM H2O2. (C) Effect of different growth phases on the
transcrip-tion of the housekeeping gene PpACT1 in pPIC3.5K-lac5930-1/GS115 when exposed to 0 or 100 mM H2O2. The transcription levels of PpACT1 in
pPIC3.5K-lac5930-1/GS115 exposed to 0 or 100 mM H2O2for 12 h were set as
the laccase gene in Pichia pastoris could stimulate the level of
glu-tathione-based antioxidative activity. Based on this, the
transcrip-tion levels of genes related to the glutathione-based antioxidative
system, such as PpGPX1, which encodes glutathione peroxidase,
PpPMP20, which encodes peroxisome glutathione peroxidase,
PpGLR1, which encodes glutathione reductase, PpGSH1, which
encodes
␥-glutamylcysteine synthetase, and PpYAP1, which
en-codes the PpYAP1 transcription factor (
55
), were also measured
by qRT-PCR under H
2O
2-mediated oxidative stress.
First, the transcription levels of genes related to the glutathione
redox systems of the two yeast transformants exposed to
exoge-nous H
2O
2were compared. As shown in
Fig. 7F
, the
transcrip-tion levels of PpGPX1, PpPMP20, PpGLR1, PpGSH1, and
PpYAP1 in pPIC3.5K-lac5930-1/GS115 exposed to 50 mM
H
2O
2for 12 h were much higher than those in pPIC3.5K/
GS115 exposed to H
2O
2for the same amount of time
(
Fig. 7F
).The transcription levels of PpGPX1, PpPMP20,
PpGLR1, PpGSH1, and PpYAP1 in pPIC3.5K-lac5930-1/GS115
exposed to 50 mM H
2O
2for 12 h were increased to about 7.8,
5.7, 5.5, 10.2, and 12.1 times, respectively, those of the
corre-sponding genes in pPIC3.5K/GS115 (
Fig. 7F
).
The time course of the transcription of genes involved in the
glu-tathione-based antioxidative system was determined in two yeast
transformants subjected to exogenous H
2O
2stress.
Figure 7A
to
E
show the change in the transcription levels of PpGPX1, PpGLR1,
PpGSH1, PpYAP1, and PpPMP20 over a 12-hour period when
pPIC3.5K-lac5930-1/GS115 and pPIC3.5K/GS115 were exposed to
50 mM H
2O
2. To evaluate changes in gene transcription over time,
the transcription levels of various genes at 0 h were set as baseline. As
shown in
Fig. 7A
to
E
, the transcription levels of PpGPX1, PpGLR1,
PpGSH1, PpYAP1, and PpPMP20 in pPIC3.5K/GS115 upon
expo-sure to exogenous H
2O
2increased slightly over time. In contrast, the
transcription levels of PpGPX1, PpGLR1, PpGSH1, PpYAP1, and
PpPMP20 in pPIC3.5K-lac5930-1/GS115 were markedly
stimu-lated over time under oxidative stress (
Fig. 7A
to
E
). This
sug-gested that the expression of the laccase gene in Pichia pastoris
could stimulate the transcription of genes involved in the
gluta-thione-based antioxidative system in response to the H
2O
2-medi-ated oxidative stress. PpYAP1 was the first gene to be induced.
After only 2 h of exposure to 50 mM H
2O
2, the transcription of the
PpYAP1 gene in pPIC3.5K-lac5930-1/GS115 was increased to
about 5.4 times the baseline level (
Fig. 7D
).
FIG 7 qRT-PCR for detecting the transcription levels of genes related to the glutathione-based antioxidative system, including PpGPX1, PpGLR1, PpGSH1,
PpYAP1, and PpPMP20, in the Pichia pastoris transformants pPIC3.5K-lac5930-1/GS115 and pPIC3.5K/GS115 when exposed to 50 mM H2O2. (A to E) Time
course detection of the transcription level of PpGPX1 (A), PpGLR1 (B), PpGSH1 (C), PpYAP1 (D), and PpPMP20 (E) in the Pichia pastoris transformants pPIC3.5K-lac5930-1/GS115 and pPIC3.5K/GS115 when exposed to 50 mM H2O2. To evaluate the change of gene transcription over time, the transcription levels
of various genes at 0 h were set as 1-fold. (F) Comparison of the transcription levels of PpGPX1, PpPMP20, PpGLR1, PpGSH1, and PpYAP1 between pPIC3.5K-lac5930-1/GS115 and pPIC3.5K/GS115 exposed to 50 mM H2O2for 12 h. The transcription levels of various genes in pPIC3.5K/GS115 were set as 1-fold. PpACT1
is the housekeeping gene that encodes the actin of Pichia pastoris. PpGPX1 encodes glutathione peroxidase. PpPMP20 encodes peroxisome glutathione peroxi-dase. PpGLR1 encodes glutathione reductase. PpGSH1 encodes␥-glutamylcysteine synthetase. PpYAP1 encodes the PpYAP1 transcription factor. Results are means⫾ standard deviations (n ⫽ 3).
DISCUSSION
Our work suggests that the expression of the laccase gene in Pichia
pastoris can enhance resistance to H
2O
2-mediated oxidative stress.
This is consistent with the results of a previous study that showed
that expression of the laccase gene from the fungus Coprinellus
congregatus in Saccharomyces cerevisiae increased yeast survival
under the oxidative stress caused by H
2O
2(
37
). There have been
few reports of increased resistance to oxidative stress induced by
heterologous expression of fungal genes in yeast. Zhang et al. have
reported that the expression of the superoxide dismutase (SOD)
gene from the thermophilic fungus Chaetomium thermophilum in
Pichia pastoris could increase the yeast resistance to paraquat- and
menadione-mediated oxidative stress (
60
). Yoo et al. have found
that the overexpression of the human Cu/Zn superoxide
dismu-tase gene in Saccharomyces cerevisiae increased the resistance to
oxidative stresses caused by paraquat, menadione, and heat shock
(
57
). Superoxide dismutase can catalyze the removal of
superox-ide radicals. It is thought to be the first line of cellular defense
against oxidative damage caused by superoxide anion radicals
(
57
). This shows that the expression of SOD genes from other
species in yeast can increase the resistance of yeast to paraquat and
menadione, both of which generate superoxide radicals. Laccase is
a group of copper-containing polyphenol oxidases that can
cata-lyze the four-electron reduction of O
2to H
2O, with the
concom-itant oxidation of phenolic compounds. The mechanism of the
antioxidative role of laccase may be quite different from that
found in previous studies using the SOD gene to increase the
resistance of yeast to oxidative stress (
57
,
60
).
One previous study only showed that the expression of the
laccase gene from the fungus Coprinellus congregatus in
Saccharo-myces cerevisiae could increase the survival rate of yeast subjected
to oxidative stress caused by H
2O
2. However, the mechanism by
which yeast resistance to H
2O
2stress was increased and its
con-nection to the laccase gene remained unknown (
37
). In our
re-search, the mechanism by which laccase protects yeast from H
2O
2stress was further investigated. This study is the first to reveal the
mechanism by which laccase gene expression increases the
resis-tance of yeast to oxidative stress. Our results indicate that the
expression of laccase in Pichia pastoris can increase the resistance
of yeast to H
2O
2-mediated oxidative stress by stimulating the
ac-tivity of the glutathione-based antioxidative system (including
GSH, glutathione peroxidase,
␥-glutamylcysteine synthetase, and
glutathione reductase). The high level of glutathione-based
anti-oxidative activity can increase the cell’s ability to detoxify H
2O
2and protect itself from oxidative damage.
To determine whether expression of the laccase gene is really
linked to defense mechanisms like enhanced glutathione
produc-tion, we expressed gene cdh, encoding cellobiose dehydrogenase,
which was cloned from white rot fungus Trametes sp. 5930, in
Pichia pastoris and then determined whether the heterologous
ex-pression of cellobiose dehydrogenase could also enhance yeast
resistance to H
2O
2-mediated oxidative stress. Our results showed
that cdh could be successfully expressed in Pichia pastoris.
How-ever, the growth of the yeast transformant expressing cdh was
inhibited under the oxidative stress caused by exogenous H
2O
2.
Our results indicate that the expression of the cdh gene in Pichia
pastoris cannot increase the resistance of the yeast to H
2O
2-medi-ated oxidative stress by enhancing the glutathione-dependent
an-tioxidative system. Our work also suggested that it was not a
co-incidence that the heterologous expression of the laccase gene in
Pichia pastoris could enhance the resistance of the yeast to H
2O
2-mediated oxidative stress by stimulating the
glutathione-depen-dent antioxidative system. The heterologous expression of
an-other enzyme, such as cellobiose dehydrogenase, did not lead to
effects similar to those observed in cells expressing laccase.
Although our work has suggested that a real link between
lac-case expression and enhancement of the glutathione-dependent
antioxidative system exists, the question of how laccase expression
is linked to defense mechanisms like enhanced glutathione
pro-duction remains unclear. The mechanism by which laccase
ex-pression in Pichia pastoris can stimulate the
glutathione-depen-dent antioxidative system remains unknown. We here put
forward one hypothesis that may answer this question based on
the following findings. In this study, we found that laccase gene
expression in Pichia pastoris could significantly stimulate the
tran-scription of the PpYAP1 gene in response to the oxidative stress
caused by exogenous H
2O
2. Time course analysis revealed that the
transcription of various genes related to the
glutathione-depen-dent antioxidative system in pPIC3.5K-lac5930-1/GS115 was
stimulated over time under the oxidative stress caused by
exoge-nous H
2O
2(
Fig. 7A
to
E
). Out of the five genes studied here,
PpYAP1 was the first to be induced. The transcription of PpYAP1
in pPIC3.5K-lac5930-1/GS115 exposed to 50 mM H
2O
2was
stim-ulated after only 2 h, increasing 5.4-fold over the baseline (0-h)
level (
Fig. 7D
). After 12 h of exposure to 50 mM H
2O
2, PpYAP1
showed the highest level of transcriptional induction among the
five genes related to the glutathione-dependent antioxidative
sys-tem (
Fig. 7F
). In Pichia pastoris, the PpYAP1 gene encodes the
PpYAP1 transcription factor, which is the Pichia pastoris
homo-logue of ScYAP1, which was first discovered in Saccharomyces
cerevisiae. Previous research has revealed that ScYAP1 is an
im-portant transcription factor in Saccharomyces cerevisiae, in which
it can stimulate the expression of several genes of the
glutathione-dependent antioxidative system, such as GLR1, GPX2, and GSH1
(
28
,
38
–
40
,
53
,
55
). Recent studies have shown that the
PpYAP1-regulated glutathione redox system plays an important role in the
detoxification of reactive oxygen species in the methanol
metab-olism of Pichia pastoris (
55
). PpYAP1 can act as a regulator of the
redox system in Pichia pastoris. It plays an important role in the
defense against oxidative stress by activating the expression of
other antioxidative genes involved in the glutathione-based
anti-oxidant system (
55
,
56
). Based on our results and previous
re-search, we propose the following hypothesis to address the issue of
how laccase expression is linked to defense mechanisms like
en-hanced glutathione production. The transcription of the laccase
gene can be stimulated by the oxidative stress caused by exogenous
H
2O
2. The stimulation of laccase gene expression in response to
exogenous H
2O
2stress may further activate some transcriptional
activator that can specially stimulate the transcription of the
PpYAP1 gene. Laccase expression first contributes to the
tran-scriptional induction of the PpYAP1 gene, increasing the
produc-tion of the PpYAP1 transcripproduc-tion regulator. Then PpYAP1
in-duces the expression of other important genes involved in the
glutathione-dependent antioxidative system, including PpGPX1,
PpGLR1, PpGSH1, and PpPMP20. In this way, the level of
gluta-thione-based antioxidative activity in yeast (including the
intra-cellular GSH level and the enzymatic activities of glutathione
peroxidase, glutathione reductase, and
␥-GCS) is elevated
corre-spondingly, which confers a strong ability to scavenge
intracellu-lar H
2O
2and protect against oxidative stress. Further studies need
to be performed to validate this hypothesis. Research into the
molecular mechanism underlying the connection between laccase
expression and stimulation of the glutathione-dependent
antioxi-dative system in Pichia pastoris is ongoing in our laboratory.
In conclusion, we found that the heterologous expression of
laccase gene in Pichia pastoris can enhance the resistance of yeast
to H
2O
2-mediated oxidative stress by stimulating the
glutathione-dependent antioxidative system. Our work will shed light on the
function and mechanism of laccase in the defense against
oxida-tive stress. This study may be of interest especially for the
under-standing of laccase’s physiological role and function. Pichia
pasto-ris has been widely applied as a heterologous expression system for
eukaryotic proteins. Our findings may help increase the efficiency
of Pichia pastoris systems expressing useful proteins by enhancing
the resistance of yeast to oxidative stress.
ACKNOWLEDGMENTS
This work was supported by the National Natural Sciences Foundation of China (no. 31070069, 30800007, and 31170104), the Doctoral Fund of the New Teacher Program of the Ministry of Education of China (no. 200804871024), the Fundamental Research Funds for the Central Univer-sities (HUST M2009046 and 2011TS083), the Natural Sciences Founda-tion of Hubei Province (no. 2009CDB009), Major S&T Projects on the Cultivation of New Varieties of Genetically Modified Organisms (grant 2009ZX08009-120B), the Major State Basic Research Development Pro-gram of China (2007CB210200), and the Open Fund of Key Laboratory of Oil Crops Biology of the Ministry of Agriculture in China.
REFERENCES
1. Abadulla E, et al. 2000. Decolorization and detoxification of textile dyes with a laccase from Trametes hirsuta. Appl. Environ. Microbiol. 66:3357– 3362.
2. Amoroso A, Mancilla RA, Gonzalez B, Vicuna R. 2009. Hydroquinone and H2O2differentially affect the ultrastructure and expression of
ligni-nolytic genes in the basidiomycete Ceriporiopsis subvermispora. FEMS Mi-crobiol. Lett. 294:232–238.
3. Ardon O, Kerem Z, Hadar Y. 1998. Enhancement of lignin degradation and laccase activity in Pleurotus ostreatus by cotton stalk extract. Can. J. Microbiol. 44:676 – 680.
4. Baldrian P. 2006. Laccases— occurrence and properties. FEMS Micro-biol. Rev. 30:215–242.
5. Banni M, Chouchene L, Said K, Kerkeni A, Messaoudi I. 2011. Mech-anisms underlying the protective effect of zinc and selenium against cad-mium-induced oxidative stress in zebrafish Danio rerio. Biometals 24: 981–992.
6. Belinky PA, Flikshtein N, Lechenko S, Gepstein S, Dosoretz CG. 2003. Reactive oxygen species and induction of lignin peroxidase in Phanero-chaete chrysosporium. Appl. Environ. Microbiol. 69:6500 – 6506. 7. Bradford MM. 1976. A rapid and sensitive method for the quantitation of
microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248 –254.
8. Camarero S, et al. 2004. Efficient bleaching of non-wood high-quality paper pulp using laccase-mediator system. Enzyme Microb. Technol. 35: 113–120.
9. Casalone E, Dillio C, Federici G, Polsinelli M. 1988. Glutathione and glutathione metabolizing enzymes in yeasts. Antonie Van Leeuwenhoek
54:367–375.
10. Chairattanamanokorn P, et al. 2005. Decolorization of alcohol distillery wastewater by thermotolerant white rot fungi. Appl. Biochem. Microbiol.
41:662– 667.
11. Chen SC, Ge W, Buswell JA. 2004. Molecular cloning of a new laccase from the edible straw mushroom Volvariella volvacea: possible involve-ment in fruit body developinvolve-ment. FEMS Microbiol. Lett. 230:171–176. 12. Cho NS, Wilkolazka AJ, Staszczak M, Cho HY, Ohga S. 2009. The role
of laccase from white rot fungi to stress conditions. J. Fac. Agr. Kyushu Univ. 54:81– 83.
13. Cho SJ, Park SJ, Lim JS, Rhee YH, Shin KS. 2002. Oxidation of polycyclic aromatic hydrocarbons by laccase of Coriolus hirsutus. Biotechnol. Lett.
24:1337–1340.
14. Choi GH, Larson TG, Nuss DL. 1992. Molecular analysis of the laccase gene from the chestnut blight fungus and selective suppression of its ex-pression in an isogenic hypovirulent strain. Mol. Plant Microbe Interact.
5:119 –128.
15. Chung AS, Maines MD, Reynolds NA. 1982. Inhibition of the enzymes of glutathione metabolism by mercuric chloride in the rat kidney; reversal by selenium. Biochem. Pharmacol. 31:3093–3100.
16. Coelho JS, Oliveira AL, Souza CGM, Bracht A, Peralta RM. 2010. Effect of the herbicides bentazon and diuron on the production of ligninolytic enzymes by Ganoderma lucidum. Int. Biodeterior. Biodegradation 64: 156 –161.
17. Collins PJ, Dobson ADW. 1997. Regulation of laccase gene transcription in Trametes versicolor. Appl. Environ. Microbiol. 63:3444 –3450. 18. Cordoba Canero D, Roncero MIG. 2008. Functional analyses of laccase
genes from Fusarium oxysporum. Phytopathology 98:509 –518. 19. Cordoba Canero D, Roncero MIG. 2008. Influence of the chloride
chan-nel of Fusarium oxysporum on extracellular laccase activity and virulence on tomato plants. Microbiology 154:1474 –1481.
20. Crowe JD, Olsson S. 2001. Induction of laccase activity in Rhizoctonia solani by antagonistic Pseudomonas fluorescens strains and a range of chemical treatments. Appl. Environ. Microbiol. 67:2088 –2094. 21. Cullen D. 1997. Recent advances on the molecular genetics of ligninolytic
fungi. J. Biotechnol. 53:273–289.
22. Cullen D, Kersten PJ 2004. Enzymology and molecular biology of lignin degradation, p. 249 –273. In Brambl R, Marzluf GA (ed), The mycota III: biochemistry and molecular biology, 2nd ed. Springer-Verlag, Berlin, Germany.
23. Deiana L, Carru C, Pes G, Tadolini B. 1999. Spectrophotometric mea-surement of hydroperoxides at increased sensitivity by oxidation of Fe2⫹ in the presence of xylenol orange. Free Radic. Res. 31:237–244. 24. Di Ilio C, Polidoro G, Arduini A, Muccini A, Federici G. 1983.
Gluta-thione peroxidase, glutaGluta-thione reductase, glutaGluta-thione S-transferase, and gamma-glutamyltranspeptidase activities in the human early pregnancy placenta. Biochem. Med. 29:143–148.
25. Dodor DE, Hwang HM, Ekunwe SIN. 2004. Oxidation of anthracene and benzo[a] pyrene by immobilized laccase from Trametes versicolor. Enzyme Microb. Technol. 35:210 –217.
26. Erkurt EA, Unyayar A, Kumbur H. 2007. Decolorization of synthetic dyes by white rot fungi involving laccase enzyme in the process. Process Biochem. 42:1429 –1435.
27. Fillat A, Roncero MB, Vidal T. 2012. Elucidating the effects of laccase-modifying compounds treatments on bast and core fibers in flax pulp. Biotechnol. Bioeng. 109:225–233.
28. Grant CM, Maciver FH, Dawes IW. 1996. Stationary-phase induction of GLR1 expression is mediated by the yAP-1 transcriptional regulatory pro-tein in the yeast Saccharomyces cerevisiae. Mol. Microbiol. 22:739 –746. 29. Hafeman DG, Sunde RA, Hoekstra WG. 1974. Effect of dietary selenium
on erythrocyte and liver glutathione peroxidase in the rat. J. Nutr. 104: 580 –587.
30. Hou H, et al. 2009. The effect of pacific cod (Gadus macrocephalus) skin gelatin polypeptides on UV radiation-induced skin photoaging in ICR mice. Food Chem. 115:945–950.
31. Jaouani A, Guillen F, Penninckx MJ, Martinez AT, Martinez MJ. 2005. Role of Pycnoporus coccineus laccase in the degradation of aromatic com-pounds in olive oil mill wastewater. Enzyme Microb. Technol. 36:478 – 486.
32. Jarosz-Wilkołazka A, et al. 2006. Species-specific Cd-stress response in the white rot basidiomycetes Abortiporus biennis and Cerrena unicolor. BioMetals 19:39 – 49.
33. Jaszek M, et al. 2006. Ligninolytic enzymes can participate in a multiple response system to oxidative stress in white-rot basidiomycetes: Fomes fomentarius and Tyromyces pubescens. Int. Biodeterior. Biodegradation 58: 168 –175.
34. Jaszek M, Grzywnowicz K, Malarczyk E, Leonowicz A. 2006. Enhanced extracellular laccase activity as a part of the response system of white rot fungi: Trametes versicolor and Abortiporus biennis to paraquat-caused ox-idative stress conditions. Pestic. Biochem. Physiol. 85:147–154. 35. Jollow DJ, Mitchell JR, Zampaglione N, Gillette JR. 1974.
for 3,4-bromobenzene oxide as the hepatotoxic metabolite. Pharmacol-ogy 11:151–169.
36. Kenchappaa RS, Ravindranath V. 2003.␥-Glutamyl cysteine synthetase is up-regulated during recovery of brain mitochondrial complex I follow-ing neurotoxic insult in mice. Neurosci. Lett. 350:51–55.
37. Kim D, Kwak E, Choi HT. 2006. Increase of yeast survival under oxida-tive stress by the expression of the laccase gene from Coprinellus congrega-tus. J. Microbiol. 44:617– 621.
38. Kuge S, Jones N, Nomoto A. 1997. Regulation of yAP-1 nuclear local-ization in response to oxidative stress. EMBO J. 16:1710 –1720. 39. Kuge S, Toda T, Iizuka N, Nomoto A. 1998. Crm1 (XpoI) dependent
nuclear export of the budding yeast transcription factor yAP-1 is sensitive to oxidative stress. Genes Cells 3:521–532.
40. Lee J, et al. 1999. Yap1 and Skn7 control two specialized oxidative stress response regulons in yeast. J. Biol. Chem. 274:16040 –16046.
41. Li D, Alic M, Brown JA, Gold MH. 1995. Regulation of manganese peroxidase gene transcription by hydrogen peroxide, chemical stress, and molecular oxygen. Appl. Environ. Microbiol. 61:341–345.
42. Lu CX, Wang HY, Luo YM, Guo L. 2010. An efficient system for pre-delignification of gramineous biofuel feedstock in vitro: Application of a laccase from Pycnoporus sanguineus H275. Process Biochem. 45:1141– 1147.
43. Mihara M, Uchiyama M. 1978. Determination of malonaldehyde precur-sor in tissues by thiobarbituric acid test. Anal. Biochem. 86:271–278. 44. Murugesan K, et al. 2006. Purification and characterization of laccase
produced by a white rot fungus Pleurotus sajor-caju under submerged culture condition and its potential in decolorization of azo dyes. Appl. Microbiol. Biotechnol. 72:939 –946.
45. Nagai M, et al. 2003. Important role of fungal intracellular laccase for melanin synthesis, purification and characterization of an intracellular laccase from Lentinula edodes fruit bodies. Microbiology 149:2455–2462. 46. Pointing SB. 2001. Feasibility of bioremediation by white-rot fungi. Appl.
Microbiol. Biotechnol. 57:20 –33.
47. Porro D, et al. 2011. Production of recombinant proteins and metabolites in yeasts. Appl. Microbiol. Biotechnol. 89:939 –948.
48. Rodríguez Couto S, Toca Herrera JL. 2006. Industrial and biotechnology applications of laccases: a review. Biotechnol. Adv. 24:500 –513. 49. Romanos M. 1995. Advances in the use of Pichia pastoris for high-level
expression. Curr. Opin. Biotechnol. 6:527–533.
50. Soden DM, O’Callaghan J, Dobson ADW. 2002. Molecular cloning of a laccase isozyme gene from Pleurotus sajor-caju and expression in the het-erologous Pichia pastoris host. Microbiology 148:4003– 4014.
51. Suguimoto HH, Barbosa AM, Dekker RFH, Castro-Gomez RJH. 2001. Veratryl alcohol stimulates fruiting body formation in the oyster mush-room, Pleurotus ostreatus. FEMS Microbiol. Lett. 194:235–238. 52. Wei DS, et al. 2010. Laccase and its role in production of extracellular
reactive oxygen species during wood decay by the brown rot basidiomy-cete Postia placenta. Appl. Environ. Microbiol. 76:2091–2097.
53. Wu AL, Moye-Rowley WS. 1994. GSH1, which encodes ⌼-glutamylcys-teine synthetase, is a target gene for yAP-1 transcriptional regulation. Mol. Cell. Biol. 14:5832–5839.
54. Yang Y, et al. 2011. Characterization of a laccase gene from the white-rot fungi Trametes sp. 5930 isolated from Shennongjia Nature Reserve in China and studying on the capability of decolorization of different syn-thetic dyes. Biochem. Eng. J. 57:13–22.
55. Yano T, Takigami E, Yurimoto H, Sakai Y. 2009. Yap1-regulated gluta-thione redox system curtails accumulation of formaldehyde and reactive oxygen species in methanol metabolism of Pichia pastoris. Eukaryot. Cell
8:540 –549.
56. Yano T, Yurimoto H, Sakai Y. 2009. Activation of the oxidative stress regulator PpYap1 through conserved cysteine residues during methanol metabolism in the yeast Pichia pastoris. Biosci. Biotechnol. Biochem. 73: 1404 –1411.
57. Yoo HY, Kim SS, Rho HM. 1999. Over-expression and simple purifica-tion of human superoxide dismutase (SOD1) in yeast and its resistance to oxidative stress. J. Biotechnol. 68:29 –35.
58. Yurimoto H, Oku M, Sakai Y. 7 July 2011. Yeast methylotrophy: metab-olism, gene regulation and peroxisome homeostasis. Int. J. Microbiol. doi:10.1155/2011/101298.
59. Zeng XK, et al. 2012. Anthraquinone dye assisted the decolorization of azo dyes by a novel Trametes trogii laccase. Process Biochem. 47:160 –163. 60. Zhang LQ, et al. 2011. Expression of a novel thermostable Cu, Zn-superoxide dismutase from Chaetomium thermophilum in Pichia pastoris and its antioxidant properties. Biotechnol. Lett. 33:1127–1132. 61. Zhao J, Kwan HS. 1999. Characterization, molecular cloning, and
differ-ential expression analysis of laccase genes from the edible mushroom Lentinula edodes. Appl. Environ. Microbiol. 65:4908 – 4913.
