0095-1137/92/061509-05$02.00/0
Copyright © 1992, AmericanSocietyforMicrobiology
Detection of
Mycoplasma
hyopneumoniae
by Using
rRNA-Oligodeoxynucleotide
Hybridization
SATOSHI FUTO,l* YASUHIRO SETO,' SIZUOMITSUSE,' ANDYASUYUKI MORI2 CentralLaboratory, Nippon Flour Mills Co., Ltd., Atsugi, Kanagawa,' and
National Institute of AnimalHealth, Tsukuba, Ibaraki,2Japan Received10 November 1991/Accepted 16 March 1992
AsystemthatusesrRNA-oligodeoxynucleotide hybridizationwasdeveloped forthe detection ofMycoplasma
hyopneumoniae. Syntheticoligonucleotide MHP1washybridizedspecificallywith M.hyopneumoniae. Further-more,the detectionof M. hyopneumoniae in clinical samples, such as bronchoalveolar lavagefluidand lung
lesions from experimentallyinfected pigs,wasevaluatedby this assay.Theevidenceobtained from the assay
indicatedthatthesystemcanbeusedtoefficientlydiagnose mycoplasmal pneumoniaofswine.Additionally, a
nonradioisotopic systemwith chemiluminescence detectionwas tested. This systemwas 10-fold less sensitive than atestthat usedradioisotopes.
Mycoplasma hyopneumoniae is a widespreadrespiratory pathogen that causes mycoplasmal pneumonia of swine
(MPS) (23). The disease is one of the most common and
economicallyimportant diseases thatoccurin swine. Many attempts have been made to develop a useful diagnostic
system for MPS. Several serological tests such as the complement fixation test (20) or enzyme immunoassay (18,
19) have been used for thediagnosisofMPS;however,these
testshavefundamental reproducibilityproblems because of individual differences in pigs. Isolation and identification of microbial pathogens werecommonly used for thediagnosis
of infectious diseases, but M. hyopneumoniae is one of the
mostdifficult strains of mycolasmastoisolate and propagate in the laboratory.
Recently, assay systems that use DNA-DNA or RNA-DNA hybridization have been developed for the rapid de-tection of microbial pathogens. Systems that use rRNA sequences offer manyadvantagesover other systems (1, 5,
8, 9, 13). In this report, we describe the detection of M.
hyopneumoniae onthe basis of RNA-DNAhybridizationin whichwe used oligonucleotides complementary to specific
sequences in the 16S rRNA. The test appears to hold
promiseforuse in the diagnosis of MPS.
Additionally, anonradioactivelabeling and detection
sys-temthatis basedonthedigoxigeninenzyme-linked immuno-sorbent assay (ELISA) and the chemiluminescent alkaline phosphatase substrate AMPPD was applied toour assay.
MATERIALSANDMETHODS
Bacterial strains. The bacterial strains used in this study are described in Table 1. All but twoMycoplasma strains
weregrownin BHL medium (26) containing
specific-patho-gen-freeswineorhorseserum; M. hyosynoviae S-16 and M.
hyopharyngisH3-6B were grown inargininebroth(6). After incubation for 3 to 4 daysat 37°C, cultures were harvested for use. Other bacterial strains were grown in brain heart infusion medium(Difco Laboratories).
Selectionof thespecific oligonucleotide probe sequence. The sequence of M. hyopneumoniae 16S rRNA has been
re-ported previously (24).Estimation ofthespecific sequences
of M.hyopneumoniae was accomplished by using a
comput-* Correspondingauthor.
er-based comparison of its 16S rRNA with those of other bacteria (PC/GENE computer program; IntelliGenetics, Inc.-Teijin Ltd.).
Oligonucleotide synthesis and 32P-labeling procedure. All oligonucleotides complementary to the selected sequences were synthesized by the phosphoamidite coupling method with a DNA synthesizer (model 391-EP; Applied Biosys-tems). The synthesized oligonucleotides were purified by reversed-phase high-pressure liquid chromatography. The oligonucleotides were labeled at the 5' termini byusing T4 polynucleotide kinase (Takara Shuzo Co., Kyoto, Japan) and
[y-32P]ATP
(>185TBq/mmol; Amersham) (16)and were separated from theincorporated[y-32P]ATP
by gel filtration. Hybridization. A dot blot hybridization procedure wasusedfor the detection ofM. hyopneumoniae. Samples were spottedonto a nylon membrane (Nytran 13N; Schleicher & Schuell) by using a dot blotting apparatus (MillBlot-D;
Millipore). The membrane was baked for 1 h at 80'C. Hybridizationwasaccomplishedasdescribedby Gobeletal. (9), with some modifications. The membranewas prehybrid-ized for 30 min in the hybridization buffer (5x SSC[Ix SSC is 0.15MNaClplus 0.015Msodiumcitrate], 5x Denhardt's solution, 0.25% sodium dodecyl sulfate [SDS], 100 ,ug of denatured calfthymus DNA per ml, 50 ,ug of yeasttRNAper ml). The hybridization was performed in the same buffer
containing 0.5 x 106 cpm of the labeled oligonucleotide probe per ml for 2 h. The hybridization temperature was usually 55'C. After hybridization, the membrane was
washed with 5x SSC-0.25 % SDS twice at room temperature and then once atthe sametemperature byusing hybridiza-tion for 3 mineach time. The dried membrane was autora-diographed byusinganintensifierscreen at -70°Cfor 16 h. Swine experimentally inoculated with M. hyopneumoniae. Twohysterectomy-produced, colostrum-deprived pigs (age,
10days)wereinoculatedintranasallywith 2 ml of theculture
containing5 x 108 color-changing units (CCU) of M. hyo-pneumoniaeE-1perml asreportedpreviously (20). Control
experimentswere done byusingtwononinoculated hyster-ectomy-produced, colostrum-deprived pigs. Four weeks
later,theanimalswerekilledandtheirlungswerecollected.
Bronchoalveolar lavage fluidwas recovered following infu-sion of 20 ml of phosphate-buffered saline (PBS) into the
airways two times. Lung homogenate was prepared by grinding a section of a pneumonic lesion in PBS. Control
1509
on April 12, 2020 by guest
http://jcm.asm.org/
Downloaded from
on April 12, 2020 by guest
http://jcm.asm.org/
Downloaded from
on April 12, 2020 by guest
http://jcm.asm.org/
1510 FUTO ET AL.
TABLE 1. Specificity of the oligonucleotide probe MHP1'
Bacterial Reactivity
strain
MHPlb
Mycoplasma hyopneumoniae
ATCC 25934... +
VPP-11... + E-l1'... No. 75+...
Mycoplasma hyorhinis
BTS-7... V-10C...
TOYAMA2' ... Mycoplasmafiocculare Ms42... Mycoplasma hyosynoviae S16... Mycoplasma hyopharyngisH3-6BF ... Achoreplasma laidlawii NCTC10116... Bordetella bronchiseptica
Si... ATCC 4617... Alcaligenes faecalisL282... Pasteurella multocida
Kobe5(serotypeA)... Kobe6(serotype D)... ZF-777(serotypeA)C... ZF-848(serotype D)c ... Actinobacilluspleuropneumoniae ... Shope4O74 (serotype I)... S1536(serotype II)... S1421/5 (serotype III)... Hi-1(serotype V)... MF83(serotype VII)... Haemophilusparasuis ... Nagasaki... HS-2... Escherichia coliNIHJ ... Pseudomonas aeruginosa ATCC9721... Klebsiellapneumoniae ATCC 22736...
Staphylococcusaureus209P... BacillussubtilisIF03032...
ProteusvulgarisATCC6380...
aCultureequivalent to108 cellswasused for the dot blothybridization experiments. Hybridizationwasperformedat55°C for 2 h, and three washings weredoneat55°C for 3 min each time.
-,nohybridizationwasobserved; +,hybridizationwasobserved.
'Wild-type strain.
lunghomogenatewaspreparedfrom normallung tissueofan uninoculated hysterectomy-produced, colostrum-deprived pig. To prevent degradation ofrRNA, N-acetyl-L-cysteine
wasaddedto giveafinalconcentration of 100mg/ml. Each
samplewasincubatedat37°Cfor 1 htoreleaseanyadherent
mycoplasmasfrom thepigcells andwascentrifugedat1,000
x g for5 min. The supernatantwas used for dot blotting.
Titration ofM. hyopneumoniae in these samples was carried outbeforethe addition ofN-acetyl-L-cysteine.
Nonradioactive system using chemiluminescence detection. Digoxigenin-labeled oligonucleotides were prepared by 3'-end-tailing method by using digoxigenin-11-dUTP (Boehr-inger GmbH) and terminal deoxynucleotidyl transferase
(Bethesda ResearchLaboratories, Inc.) (14, 15).
Detection of digoxigenin-labeled-oligonucleotide was donebyusingalkalinephosphatase-labeledanti-digoxigenin antibody Fab fragments (Boehringer GmbH) (14) and the chemiluminescent alkaline phosphatase substrate AMPPD
(Southern Lighttestkit;TROPIX,Inc.) (2).The resultswere
obtained byexposing the blots to X-ray film.
Hybridization conditions were essentially the same as
those described above for theradioisotopic method, except for thefollowingmodification of thehybridization buffer:5x
SSC, 2%blocking reagent (purified casein fraction;
Boehr-inger GmbH), 0.2% SDS, 50
jig
of yeast tRNA per ml. The procedures used for detection ofoligonucleotideswerethose recommendedby the supplier.RESULTS
Construction of M. hyopneumoniae-specific probes.
Com-puterized analysisof bacterial 16S rRNA sequences allowed identification ofhighly conserved, semiconserved, and vari-ableregions(10). Comparison of 16S rRNA sequences from M. hyopneumoniae with those reported for other bacteria(4,
7, 11,12, 21, 25)wasaccomplished bycomputerized analy-sis. M. hyopneumoniae 16S rRNA has three highly specific regions (Fig. 1). These regions correspond to the variable regions V2, V4, and V6 ofEscherichiacoli16S rRNA(4, 10,
21).The sequences suitable for the construction of
oligonu-cleotideprobeswere selected from theseregions. Oligonu-cleotides complementary to the selected sequences were synthesizedandnamedMHP1, MHP2, and MHP3(Fig. 1).
Specificities and sensitivities of oligonucleotide probes. The
specificitiesof theoligonucleotide probesweretestedbythe dot blot method at various hybridization temperatures against closely related mycoplasmas which have a high probability of being isolated from pigs. The results are
shown inFig. 2. Probe MHP1hybridizedspecificallyat55°C
with M. hyopneumoniaestrains,whereasprobesMHP2and
MHP3 cross-reacted with Mycoplasma flocculare. With
higher hybridization temperatures(70°C),thespecificitiesof probes MHP2 and MHP3 for the detection of M.
hyopneu-moniaewere
improved.
Theoligonucleotide probe MHP1 was used in a dot blot hybridization assay that included variousmycoplasmas and other bacterial genera which haveahighprobabilityofbeing
isolated from pigs. The results aregivenin Table 1. Myco-plasmasand bacterialspeciesother than M.hyopneumoniae
didnotgenerate positive signals.
The sensitivity of the assay was measured by using a
membrane spotted with serial dilutions of anM. hyopneu-moniaeculture
(Fig.
3).The detectionlimit of this assaywasestimated tobe about 103CCU.
Detection of M. hyopneumoniae from experimentally in-fected pigs. To apply the method described here to the
diagnosis ofMPS, we attempted to detect M. hyopneumo-niae in clinical samples. It is known that bronchoalveolar lavage fluid andlung lesions frompigswith MPScontain a
large number ofM. hyopneumoniaecells. The results (Fig.
4) show that the methodcanbeusedtodetectM. hyopneu-moniae in clinical samples from
experimentally
infectedpigs. Samples fromspecific-pathogen-freecontrol pigswere J.CLIN. MICROBIOL.
on April 12, 2020 by guest
http://jcm.asm.org/
MHP1
201 250
M.hyopneumoniae TTTA-TTCAAAGGAGCCTTCA-AGCTTCACCAAGAAATGGGGGTGC---GCAACA
M.hyorhinis AG ..A.AG... - C... TT.A...---.G
M.pneumoniae CAA.G...G....GTT.TTTG...A..C.T.
Mycoplasma PG50 AAG... A .A..G.TT-G.-..-..T.T...A...---.GCGT. M.capricolum AAG.--. ... A...G.TT--.G. T.T...A..A---.GCGT.
B.subtilis CAA.CA.A ...T.G. G-GCTAC ... ...ACCC ---.GCG..
E.coli CAA.---G.GG..GA. GGG---C.T.TTGCC.TCG.AT ....CCAGT.GCC..
MHP2
601 650
M.hyopneumoniae TAAGTTTAAAGTTAAATGCTAAAGCTCAACTTTAGTCCG-CTTTAGATACT
M.hyorhinis ...C.GG.... G... C..-... G.
Mycoplasma PG50 C... G.G. GT.CGG. CCG ..T..-.C ..GA.A...
M.capricolum C. G.G.... GT.CGG... CCG.T. -.C..GA.G...
M.pneumoniae A.C.GGT....G.AGCT ..T. . AG.T ..AT.-.A. .G..A...
B.subtilis ...C.G.T ....GC.CCCG...CGGG.AGG.T.A .G...
E.coli ...CAG.T. .... C.CCGG... C.GG.AA.TG.A.CT.
MHP3
1001 1050
M.hyopneumoniae M.hyorhinis
Mycoplasma PG50 M.capricolum
M.pneumoniae
B.subtilis E.coli
CGCAAAACTAT----AGAGATATAGCCGAG---GCTAACGAGATCACAGATGGTGCA
T....G..----. . ....TG. ---.T.... AGA. ...
T....G... .. TA.. ---.T.T... ATTGAG....G.
T.T. .G... ..TA.. ---.T.... ATTGAG... .G.
G.C.... GT ---G... ATG... ---.T.... CA.G...G....G
.T.TG.CAAT--CCT...GGA.GTCCCCTTC.GGG-.AGAG.G .... ...
.A.GG ..G.T.TCAG...GAGAATGT.CCTTCGGG... CGTGAG... G...
FIG. 1. Alignment of M. hyopneumoniae 16S rRNA sequence with 16S rRNA from othermycoplasmasand bacteria(4, 7, 11, 12, 21, 25). Positions in the sequences which are identical to the M. hyopneumoniae sequence are indicated with a dot. The numbers indicate the appropriatebase positionsinthe M. hyopneumoniae 16S rRNA. The sequencescomplementary toMHP1,MHP2, and MHP3 areboxed.
consistentlynegative. Additionally, areduction inthe signal
intensity was not observed following storage of clinical
samples containing 100 mg ofN-acetyl-L-cysteine per ml at
-20°C (data not shown).
Development ofa nonradioactivehybridization system.
De-velopmentofanonradioactivehybridizationsystemwas one
of the most important objectives of this study. The digoxi-geninELISA method (14),which wasdeveloped for
nonra-dioactive labeling and detection of nucleic acids, and
AMPPDwereused inourassay. The resultsaregiveninFig.
5. Thespecificityof the nonradioactive MHP1probewasthe
same as that of the radioactive probe. The sensitivity of detection was 10-fold less than that by the radioisotope
assay.
MHP1 MHP2 MHP3
17 1 7 1 7
2 8 2 d 2
3 9 3 9 3 9
4 10 4 10 4 10
5 5 5
6 6 6
FIG. 2. Specificities ofoligonucleotide probes MHP1, MHP2, and MHP3. Cultures (50 ,ul per well) were spotted onto nylon membranes and probed with 32P-labeled oligodeoxynucleotides. Dots: 1, M. hyopneumoniae ATCC 25934; 2, M. hyopneumoniae
VPP-11; 3,M.hyopneumoniae E-1; 4,M.hyopneumoniaeno.75;5, M. hyorhinisBST-7;6, M.hyorhinis V-10; 7,M. hyosynoviae S16; 8,M. hyopharyngis H3-6BF; 9,A. laidlawii NCTC 10116; 10,M.
flocculareMs42.
DISCUSSION
Detectionofpathogensonthe basis of RNA-DNA
hybrid-ization isauseful tool for thediagnosisofvarious infectious
diseases. We used this method to detect and identify M.
hyopneumoniae. As a result, probe MHP1 was hybridized
specificallytoM.hyopneumoniaeunderlow-stringency con-ditions (5x SSC, 55°C). Probes MHP2 and MHP3
cross-reactedwith M.flocculareat alow temperature (55°C),but
theywere specific for M. hyopneumoniae at a high
temper-ature(70°C).M.flocculalre iscloselyrelatedtoM. hyopneu-moniae; in particular, the serological cross-reactivity
be-tweenM. hyopneumoniae and M.flocculare is well known
(17). No cross-reactivity of these probes to other bacterial genera ormycoplasmaswasobserved.
MPS caused by M. hyopneumoniae is a widespread,
chronic, and economically important disease in swine (23). However, isolation and direct detection ofthis organism is
notcommonly done. M. hyopneumoniae isoneofthemost
difficult strains ofmycoplasmas to cultivate under artificial conditions. Forexample, in Japan only four or five labora-tories have the capability of isolating M. hyopneumoniae
102 101 (CCU)
FIG. 3. Sensitivity of DNA-RNA hybridization by using
32P-labeled probe MHP1. The numbers of mycoplasmal cells were
measuredbythe enumeration of CCU.
,106
105
104
103
on April 12, 2020 by guest
http://jcm.asm.org/
1512 FUTO ET AL.
1
2W
3
4
8
5
9
6
010
7
.
11
FIG. 4. Detection of M.hyopneumoniaeinclinical samples from experimentally infected pigs by using 32P-labeled probe MHP1. Samples (50,ul perwell)werespottedonto anylon membraneand weredetected by RNA-DNAhybridization. Dots: 1,M. hyopneu-moniae ATCC 25934 (107); 2, M. hyorhinis BTS-7 (108); 3, M. flocculare Ms42 (108); 4, bronchoalveolar lavage fluid from pig 1 (inoculated with M. hyopneumoniae); 5, bronchoalveolar lavage fluid from pig 2 (inoculated with M. hyopneumoniae); 6, lung homogenate from pig1; 7,lung homogenate frompig2;8, broncho-alveolar lavage fluid frompig3 (uninoculated); 9, bronchoalveolar lavage fluidfrompig4(uninoculated); 10,lung homogenatefrompig 3; 11, lunghomogenate frompig4.
fromclinical samples. Even for theselaboratories, it would takeover amonthtoidentifythisorganism. Recently,many pig breeders have tried to produce specific-pathogen-free pigs. For this purpose, it is very important to be able to detect M.hyopneumoniae quicklytocontrol MPS.Although
the diagnosis ofMPS usually dependson serological meth-ods like thecomplementfixation test orenzyme
immunoas-say, these tests have reproducibility problems. The assay system that uses DNA-RNA hybridization is more reliable than serological tests. However, widespread acceptance of this method among diagnosticians is restricted because of the use ofradioisotopes, as has also been acknowledged by Gobel et al.(9). Thedevelopment of nonradioactive labeling and detection systems thatallow forasensitive and reliable test and that can be used in diagnostic laboratories is required. Recently, several chemiluminescent substrates
were developed for the sensitive detection of reporter
en-zymes (2, 22). AMPPD is a chemiluminescent substrate for alkaline phosphatase, and the detection system that uses AMPPD may be 100-foldmoresensitive than a colorimetric system (2, 3). When short oligonucleotides are used as
nonradioactive probes, it isnoteasy tobind the numbers of reporter molecules by the chemical modification method. Furthermore, direct coupling of reporter enzymes has
sev-eralproblems, suchasstabilityatvarious temperatures and sensitivity of detection. Therefore, we adopted the digoxi-genin ELISA system(14),whichisacommerciallyavailable
nonradioactive labeling and detection system, and the ter-minal deoxynucleotidyl transferase tailing method with digoxigenin-11-dUTP. Approximately 15 to 20 bases of
digoxigenin-dUTPwere attached to the 3' end of the oligo-nucleotide in our system. After hybridization, the existence of the digoxigenin-labeled probe was detected by using alkalinephosphatase-labeledanti-digoxigenin conjugateand AMPPD. The sensitivity of this systemwas approximately 10-fold less than that of theradioisotopeassay.Isolation and titration of M. hyopneumoniaefrombronchoalveolarlavage fluid andlunglesionhomogenatesfrom manypigswith MPS in the field have been carried out in our laboratory. More than
104
CCUof M. hyopneumoniae per ml were detected from most of thesampleswhen theorganismwasfoundtobe presentinasample(datanotshown). Therefore,this system isconsideredtohaveenoughsensitivityfor the detection of M. hyopneumoniae in pigs with MPS.The DNA-RNA hybridization assay system can also be used toefficiently study pathogenesis. We arestudyingthe localization of M. hyopneumoniae byusingthis assay
sys-tem(datanotshown). Furthermore,the assay systemmight
be useful in the development of vaccines against MPS. Detection ofpathogens isoneofthemost importantcriteria forestimatingtheefficacies of vaccines.
1
*4
2
3
5
6
FIG. 5. Nonradioactive detection of M.hyopneumoniaeby using
an oligonucleotide probe. Cultures (50 ,ul perwell) were spotted
onto a nylon membrane. The membrane was hybridized with
digoxigenin-labeled probeMHP1 at55°C for 3 h underthe
condi-tions described in the text. Probes were detected with alkaline
phosphatase labeled antidigoxigenin antibody Fab fragments and AMPPD. TheblotswereexposedtoX-ray film for 20 min. Dots: 1,
M.hyopneumoniae ATCC 25934 (106CCU); 2,M.hyopneumoniae
ATCC 25934 (105 CCU);3, M. hyopneumoniae ATCC 25934 (104 CCU); 4,M. hyopneumoniae VPP-11 (107CCU); 5, M. hyorhinis
BST-7 (108CCU); 6,M.flocculare Ms42 (108 CCU). Numbers of mycoplasmalcellsweremeasuredbytheenumeration ofCCU.
ACKNOWLEDGMENTS
Wethank R. F. Ross and Y.Kurimoto forreadingthemanuscript andformaking valuablecommentsonit.Thebacterial strainsused in thisstudywerekindgifts from S. Sato,T.Sakano,M.Okada,A. Taneda,T. Morozumi,andS.Ishikawa.
REFERENCES
1. Barry,T., R. Powell, and F. Gannon. 1990. Ageneralmethodto
generate DNA probes for microorganisms. Bio/Technology 8:233-236.
2. Bronstein, I., and P. McGrath. 1989. Chemiluminescencelight up. Nature (London)338:599.
3. Bronstein,I., J. C.Voyta, and B. Edwards. 1989. Acomparison ofchemiluminescentand colorimetric substrates inahepatitisB virus DNAhybridizationassay.Anal. Biochem. 180:95. 4. Brosius, J.,L. Palmer, J. P.Kennedy, and H. F. Noller. 1978.
Complete nucleotide sequence ofa 16S ribosomal RNA gene from Escherichia coli. Proc. Natl. Acad. Sci. USA 75:4801-4805.
5. DeLong,E. F.1989.Phylogeneticstains:ribosomal RNA-based probes for the identification ofsinglecells. Science 243:1360-1363.
J. CLIN. MICROBIOL.
on April 12, 2020 by guest
http://jcm.asm.org/
6. Freundt, E. A. 1983.Culture media for classic mycoplasmas,p. 127-135. In S. Razin, and J. G. Tully (ed.), Methods in my-coplasmology, vol. 1.Academic Press, Inc.,New York. 7. Frydenberg,J., andC. Christiansen. 1985. The sequence of 16S
rRNAfromMycoplasma strainPG50.DNA4:127-137. 8. Gobel,U., A.Geiser,and E.J.Stanbridge. 1987.
Oligonucleo-tide probes complementary to variable regions of ribosomal RNA discriminate betweenMycoplasma species. J. Gen. Mi-crobiol. 133:1969-1974.
9. Gobel, U., R. Maas, G. Haun, C. Vinga-Martins, and E. J. Stanbridge. 1987.Syntheticoligonucleotide probes complemen-tary to rRNA for group- and species-specific detection of mycoplasmas. Isr.J. Med.Sci. 23:742-746.
10. Gray,M.W., D.Sankoff, and R. J.Cedergren. 1984. On the evolutionary descent of organisms and organelles: a global phylogeny basedon ahighlyconserved structural core insmall subunit ribosomal RNA. Nucleic AcidsRes.12:5837-5852. 11. Green,C. J.,G. C.Stewart,M.A.Hollis,B.S.Vold, and K. F.
Bott. 1985. Nucleotide sequence of theBacillus subtilis ribo-somalRNA operon, rrnB. Gene37:261-266.
12. Iwami,M., A.Muto, F. Yamano, and S. Osawa. 1984. Nucleo-tide sequence ofnmB 16S ribosomal RNAgene from Myco-plasma capricolum.Mol. Gen. Genet. 196:317-322.
13. Jensen,N.S., T. A.Casey, and T. B. Stanton. 1990. Detection and identification of Treponema hyodysenteriae by using oli-godeoxynucleotide probes complementary to 16S rRNA. J. Clin. Microbiol. 28:2717-2721.
14. Kessler, C.,H.-J.Holtke,R.Seibl,J. Burg, and K.Muhlegger. 1990.Non-radioactivelabelinganddetectionofnucleicacids.I. Anovel DNAlabelinganddetectionsystembasedon digoxige-nin: anti-digoxigenin ELISA principle. Biol. Chem. Hoppe-Seyler 371:917.
15. Kumar, A., P. Tchen, F. Roullet, and J. Cohen. 1988. Nonra-dioactivelabelingofsyntheticoligonucleotide probes with ter-minaldeoxynucleotidyl transferase. Anal. Biochem. 169:376. 16. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1989. Molecular
cloning: a laboratory manual, 2nd ed., vol. 2, 11.20. Cold
SpringHarborLaboratoryPress, ColdSpringHarbor, N.Y. 17. Meyling, A., and N. F. Friis. 1972. Serological identification of
new porcine mycoplasma, M. flocculare. Acta Vet. Scand. 13:287-289.
18. Mori, Y., T. Hamaoka, and S. Sato. 1987. Use of monoclonal antibodyin an enzyme-linked immunosorbent assay(ELISA) for the detectionof antibodies against Mycoplasma hyopneu-moniae. Isr. J.Med. Sci. 23:657-662.
19. Mori, Y., T.Hamaoka, S. Sato, and S. Takeuchi. 1988. Immu-noblotting analysis of antibody responsein swine experimen-tallyinoculatedwithMycoplasma hyopneumoniae.Vet. Immu-nol. Immunopathol.19:239-250.
20. Mori, Y., Y. Yoshida, C. Kuniyasu, and K. Hashimoto. 1983. Improvement ofcomplement fixationtestantigenfordiagnosis ofMycoplasma hyopneumoniae infection. Natl. Inst. Anim. HealthQ.23:111-116.
21. Neefs,J.-M., Y. Van de Peer, L. Hendriks, and R. De Wachter. 1990.Compilation ofsmallribosomalsubunit RNA sequences. Nucleic Acids Res. 18:2237-2317.
22. Pollard-Knight, D., A. C. Simmonds, A. P. Schaap, H. Akhavan, andM. A.W.Brady.1990. Nonradioactive DNAdetection on Southernblots byenzymatically triggered chemiluminescence. Anal. Biochem.185:353.
23. Ross, R. F. 1986. Mycoplasmal disease, p. 469-483. In A. D. Leman(ed.), Diseasesofswine,6thed. Iowa StateUniversity Press, Ames.
24. Taschke, C., K. Ruland, and R. Herrmann. 1987. Nucleotide sequence of the 16S rRNAofMycoplasma hyopneumoniae. Nucleic Acids Res. 15:3918.
25. Weisburg, W. G., J. G. Tully, D. L. Rose, J. P. Petzel, H. Oyaizu,D.Yang, L. Mandelco, J. Sechrest, T. G. Lawrence, J. VanEtten, J.Maniloff, and C. R. Woese. 1989. A phylogenetic analysis of the mycoplasmas: basis for theirclassification. J. Bacteriol. 171:6455-6467.
26. Yamamoto, K., and M. Ogata. 1982. Mycoplasmal and bacterial flora in the lungs ofpigs. Proc. 7th Int. Congr. Pig. Vet. Soc. Mexico 7:94.
on April 12, 2020 by guest
http://jcm.asm.org/
ERRATUM
Detection of
Mycoplasma hyopneumoniae by Using
rRNA-Oligodeoxynucleotide Hybridization
SATOSHI FUTO, YASUHIROSETO, SIZUO MITSUSE,ANDYASUYUKIMORI CentralLaboratory,Nippon Flour Mills Co., Ltd., Atsugi, Kanagawa, and
National Institute
of
AnimalHealth,Tsukuba, Ibaraki,
Japan
Volume 30,no. 6,p. 1511: Figure 1 should appear asshownbelow.
MHP1
201 250
M. hyopneumoniae TTA-TTCAAAGGAGCCTTCA-AGCTTCACCAAGAATGGGGGTGC---GCAACA
M. hyorhinis AG ..A.AG -C ..TT.A...---.G
M. pneumoniae CAA.G.. ...G .GTT.TTTG
Mycoplasma PG50 AAG... .A...A.G.TT-G. .-..T.T...A...---.GCGT.
M. capricolum AAG ...A...A..G.TT--.G T.T..G ...A---.GCGT.
B. subtilis CAA.CA.A... G-GCTAC TT.C.G ACCC---.GCG..
E. coli CAA.---G.GG.. ...GGG---C.T.TTGCC.TCG.AT ....CCAGT.GCC..
MHP2
6(
M. hyopneumoniae
M. hyorhinis
Mycoplasma PG50
M. capricolum
M. pneumoniae
B. subtilis
E. coli
MHP3
10(
M. hyopneumoniae
M. hyorhinis Mycoplasma PG50
M. capricolum
M. pneumoniae
B. subtilis
E. coll
Dl 650
TAAGTTTA AGTTAAATGCTAAAGCTCAACTTTAGT CTTTAGATACT
...C.GG.... G... C.. ... G.
C. G.G. GT.CGG... CCG ..T..-.C. GA.A....
C. G.G. GT.CGG. CG....-.0..GA.G...
A... C.GGT. G. ..AGCT...T. AG.T ..AT.-.A .G...
...C.G.T... GC.CCCG...CGGG.AGG.T.A .G.. ... ...CAG.T..G.... C.CCGG... C.GG.AA.TG.A.CT.
Dl _ 1050
rCGCAAAACTAT----AGAGATATAGCCGAG---GCTACGAGATCACAGATGGTGCA
T.... G... ... .. ....TG...---.T...AGA.. .... . .. .
T...G... TA ...---.T... ATTGAG...G....
T.T ... ..----.... TA... ---.T.... ATTGAG... G. G.C ...GT---G..A.C ...ATG ..---.T .... CGAG.G.. .G.
.T.TG.CAAT--CCT...GGA.GTCCCCTTC.GGG-.AGAG.G ... .A.GG ..G.T.TCAG...GAGAATGT.CCTTCGGG... CGTGAG... G...