Test 5 2011
1. The volume of a solution of 0.25 M NaOH that must be added to adjust the pH from 4.48 to 12.38 in 5 mL of a 100 mM solution of phosphoric acid is:
20 0.065 a) 1 mL 55 0.177 b) 2 mL 110 0.355 c) 3 mL## 107 0.345 d) 4 mL 17 0.055 e) 5 mL
2. Which of the following statements is incorrect? 173 0.558 a) Z-type DNA is negatively supercoiled##
2 0.006 b) Topoisomerases relax supercoils by cleaving one or both strands of the DNA, passing the DNA through the break or allowing controlled rotation of the uncleaved strand, and resealing the broken strand(s).
20 0.065 c) Stacking interaction between bases is enthalpically driven
21 0.068 d) The structures of nucleic acids are stabilized by divalent cations that shield adjacent phosphate groups
94 0.303 e) All listed statements are correct
3. A plasmid with 2400 bp of closed circular duplex DNA was isolated from E. coli. The plasmid was transferred to a high salt solution and then treated with an enzyme with type IB topoisomerase activity. After topoisomerase treatment the plasmid is transferred back to a low salt solution and then treated with an enzyme with type IA topoisomerase activity. This plasmid has a 300-bp segment of alternating C and G. This segment undergoes equilibrium transition from the B conformation to the Z conformation upon transfer to the high salt solution. Given that B-DNA contains one right-handed turn per 10 base pairs, Z-DNA contains one left-handed turn per 12 base pairs and linking number (L) equals twist (T) plus writhing number (W). Which of the followings is correct?
9 0.029 a) Its original twist is equal to 185 32 0.103 b) Its final writhing number is -55 49 0.158 c) Its final linking number is 185 193 0.623 d) Its final twisting number is 240## 25 0.081 e) All answers are correct
4. If 5% of the DNA in a originally relaxed circular-covalently-closed plasmid forms open complexes with RNA polymerases. What happens to the value of the writhing number? 154 0.497 a) increases##
42 0.135 b) decreases
104 0.335 c) remains the same 1 0.003 d) mutiplies by a factor of 3 8 0.026 e) none of the answers
5. After Okazaki fragements are formed by DNA polymerase III and primase, which of the following activities of DNA polymerase I is/are used to replace the RNA primers?
80 0.258 b) 5' -> 3' exonuclease activities 31 0.100 c) 5' -> 3' polymerase activities
5 0.016 d) None of the three stated activities are used 172 0.555 e) All of the three stated activitties are used##
6. Which of the following statements is true about DNA: 8 0.026 a) G-C has a lower boiling point than A-T
45 0.145 b) G-C has a lower absolute stacking energy than A-T 153 0.494 c) Higher stacking energies indicate more stable structure## 17 0.055 d) Hydrophobic effects contribute little to DNA's stability
87 0.281 e) Hydrogen bonding is what primarily makes C-G more stable than A-T
7. Common DNA Binding motifs include the followings except 19 0.061 a) the helix-turn-helix motif
2 0.006 b) zinc fingers 26 0.084 c) leucine zippers##
10 0.032 d) basic helix-loop-helix motifs
253 0.816 e) all of the listed are common DNA binding motifs
8. A plasmid with 3600 bp of closed circular duplex DNA was isolated from E. coli. The plasmid was transferred to a high salt solution and then treated with an enzyme with type Ib topoisomerase activity. After topoisomerase treatment the plasmid is transferred back to a low salt solution. This plasmid has a 300-bp segment of alternating C and G. This segment undergoes equilibrium transition from the B conformation to the Z conformation upon transfer to the high salt solution. Given that B-DNA contains one right-handed turn per 10 base pairs, Z-DNA contains one left-handed turn per 12 base pairs and linking number (L) equals twist (T) plus writhing number (W). Which of the followings is incorrect?
33 0.106 a) Its original twist is equal to 360 30 0.097 b) Its final writhing number is -55 200 0.645 c) Its final linking number is 360## 37 0.119 d) Its final twisting number is 360 10 0.032 e) All answers are correct
9. Which of the following is false about prokaryotic transcription?
0 0.000 a) Conserved sequences are found upstream from the starting point 7 0.023 b) 10 bases before the start of transcription is known as the pribnow box 60 0.194 c) the sigma factor is released as transcription proceeds
6 0.019 d) the conserved sequences found upstream from the starting point are known as the -10 and -35 region.
237 0.765 e) all answers are true##
10. Select the false statement
1 0.003 a) some eukaryotic rRNAs are self-splicing 4 0.013 b) RNA can act as an enzyme
296 0.955 c) self-splicing rRNAs require energy input##
5 0.016 e) in order to be an efficient catalyst, a macromolecule must be able to form a stable structure
11. How does the preinitiation complex begin to form at a TATA box containing promoter? 38 0.123 a) RNAP binds to the sigma factor
13 0.042 b) RNAP binds to the initiator (Inr) element
248 0.800 c) TATA-binding protein binds to the TATA box## 6 0.019 d) RNAP binds to the Rho factor
4 0.013 e) none of the above
12. According to Table 3, which positions on DNA corresponds to the 5' end of the transcribed RNA?
48 0.155 a) A 72 0.232 b) B 24 0.077 c) D 103 0.332 d) F## 62 0.200 e) H
13. Studies at different pHÕs show that an enzyme has two catalytically important residues whose pKÕs are approximately 4 and 10. Chemical modification experiments indicate that a Glu and a Lys residue are essential for activity. Which of the following statements is most likely to be correct?
240 0.774 a) Glu acts as a base catalyst and Lys acts as an acid catalyst## 54 0.174 b) Glu acts as an acid catalyst and Lys acts as a base catalyst 6 0.019 c) Glu acts as an nucleophile
8 0.026 d) Lys acts as an nucleophile
2 0.006 e) None of the given statements is correct
14. The covalent catalytic mechanism of an enzyme depends on a single active site tyr whose pK is 10. A mutation in a nearby residue alters the microenvironment so that this pK decreases to 8. Which of the following statements is most likely to be correct at pH = 7
141 0.455 a) The mutation causes the reaction rate to increase## 140 0.452 b) The mutation causes the reaction rate to decrease
20 0.065 c) The mutation causes the reaction to proceed via acid-base catalytic mechanism 4 0.013 d) The mutation causes the reaction to proceed via metal ion catalytic mechanism 4 0.013 e) The mutation causes the reaction to preceed via proximity and orientation effects mechanism
15. Which of the following statements is most likely to be correct?
33 0.106 a) Tosyl-L-phenylalanine chloromethylketone is a competitive inhibitor of chymotrypsin catalyzed reactions
19 0.061 b) 1,6-Dihydroinosine is an irreversible inhibitor of adenosine deaminase catalyzed reactions
229 0.739 c) Pyrrole-2-Carboxylate is a competitive inhibitor of proline racemase catalyzed reactions##
15 0.048 e) Tosyl-L-lysine chloromethylketone is a competitive inhibitor of chymotrypsin catalyzed reactions
16. What is the likely consequence of mutation of Asp 102 of trypsin (Figure 3)? 250 0.806 a) The mutated enzyme has reduced catalytic activity##
33 0.106 b) The mutated enzyme has reduced affinity to its substrate
4 0.013 c) The mutated enzyme has increased affinity to the tetrahedral intermediate 7 0.023 d) The mutated enzyme lost its ability to catalyze peptide bond formation under all conditions
16 0.052 e) None of the given statements is correct.
17. Activation of coagulation factor IX can be accomplished in vivo by 8 0.026 a) Aggregation of inactive subunits
5 0.016 b) Dissociation of inactive subunits 260 0.839 c) Factor XIa alone##
31 0.100 d) Factor VIIa alone 6 0.019 e) Factor Xa and Factor Va
18. Which of the following residues does not act as an acid catalyst (Figures 3 & 6)? 18 0.058 a) His 12 in RNase A
10 0.032 b) His 119 in RNase A 39 0.126 c) His 57 in serine protease 204 0.658 d) Asp 102 in serine protease##
38 0.123 e) all listed act as acid catalyst at some point in the respective enzyme catalyzed reaction
19. According to Figure 2 and step 1 in Figure 3, the pKa of Ser 195 is 67 0.216 a) increased by the combined action of Asp 102 and His 57 70 0.226 b) decreased by the combined action of Asp 102 and His 57## 107 0.345 c) increased by the action of His 57
45 0.145 d) increased by the action of Asp 102 20 0.065 e) not affected by its environment
20. According to Figure 5, Which of the following is not likely to be a serine protease? 156 0.503 a) Factor Ix
19 0.061 b) Factor VIIa 78 0.252 c) Factor Va## 7 0.023 d) Factor Xa
50 0.161 e) all listed are serine proteases
21. Which of the following is correct about enzyme catalyzed reaction with an uncompetitive inhibitor (I)
253 0.816 e) Both Vmax and Km are smaller with I when compared to no I##
22. Which of the following is correct about enzyme catalyzed reaction with an pure noncompetitive inhibitor (I)
176 0.568 a) Vmax is smaller and Km is unchanged with I when compared to no I## 11 0.035 b) Km is smaller and Vmax is unchanged with I when compared to no I 21 0.068 c) Vmax is larger and Km is unchanged with I when compared to no I 57 0.184 d) Both Vmax and Km are smaller with I when compared to no I 45 0.145 e) None of the rest
23. Which of the following is correct about enzyme catalyzed reaction with a competitive inhibitor (I)
24 0.077 a) Vmax is smaller and Km is unchanged with I when compared to no I 40 0.129 b) Km is smaller and Vmax is unchanged with I when compared to no I 12 0.039 c) Vmax is larger and Km is unchanged with I when compared to no I 9 0.029 d) Both Vmax and Km are smaller with I when compared to no I 225 0.726 e) None of the rest##
24. Restriction fragments from which of the following enzymes could be ligated together. The cleavage site is indicated with an apostrophe (').
Enzyme A B C D E
Cleavage site GTATA'C ATATA'T C'TATAG GATAT'C T'ATATA 14 0.045 a) A and D
12 0.039 b) B and C 11 0.035 c) C and E 73 0.235 d) B and E
200 0.645 e) none of the rest##
25. Which of the following primers can amplify the following DNA segment by PCR? 5'
GACTGGTCGCGGATAGCGTATAATATTTCGGAATACGGTATACCCGGATACGGATA 12 0.039 a) 5'ATAGGCATAGGC and 5'TATCCGTATCCG
