genes have been proposed and studied in recent years [6 12] and, among them, genes encoding ethanol and acetaldehyde-metabolizing 1.

(1)

Genetic polymorphisms of ADH

2

, ADH

3

, CYP

450

2E1 Dra-I and Pst-I,

and ALDH

2

in Spanish men: lack of association with alcoholism

and alcoholic liver disease

Francesc Vidal

1,4,

*, Alfons Lorenzo

1

, Teresa Auguet

1,4

, Montserrat Olona

2

, Montserrat Broch

3,4

,

Cristina Gutie´rrez

3,4

, Carmen Aguilar

3

, Pere Estupin˜a`

3

, Mauro Santos

5

, Cristo´bal Richart

1,4

1

Department of Internal Medicine, Hospital Universitari de Tarragona Joan XXIII, C/Dr. Mallafre´ Guasch, 4, 43007 Tarragona, Spain

2

Department of Epidemiology and Preventive Medicine, Hospital Universitari de Tarragona Joan XXIII, Tarragona, Spain

3_{Research Unit, Hospital Universitari de Tarragona Joan XXIII, Tarragona, Spain} 4_{Department of Medicine and Surgery, University Rovira i Virgili, Tarragona, Spain} 5_{Department of Genetics and Microbiology, Universitat Auto`noma de Barcelona, Bellaterra, Spain}

Background/Aims

: The relationship between polymorphisms at the alcohol dehydrogenase 2 (ADH

2

), ADH

3

,

CYP

450

2E1 and aldehyde dehydrogenase 2 (ALDH

2

) loci and the individual predisposition to alcoholism and alcoholic

liver disease in Caucasians is controversial.

Methods

: We determined the genotypes of ADH

2

, ADH

3

, CYP

450

2E1 (Pst-I and Dra-I) and ALDH

2

in 519 male

Spaniards: 264 alcoholic subjects (47 without liver disease, 118 with non-cirrhotic liver disease and 99 with cirrhosis)

and 255 non-alcoholic subjects (64 healthy controls, 110 with non-cirrhotic non-alcoholic liver disease and 81 with

cirrhosis unrelated to alcohol). Genotyping was performed using PCR-RFLP methods on white cell DNA.

Results

: The distribution of the allelic variants (allele *1 and allele *2) in the whole subjects analyzed was: ADH

2

93.1% and 6.9%; ADH

3

55.7 and 44.3%; CYP

450

2E1 Dra-I 11.2 and 88.8%; CYP

450

2E1 Pst-I 96.2 and 3.8% and

ALDH2 100 and 0%, respectively. No differences were observed in the allelic distributions of the alcoholic and

non-alcoholic subjects for the loci examined. Allele distribution in non-alcoholics with no liver disease, with non-alcoholic steatosis or

hepatitis, and with cirrhosis was also similar.

Conclusions

: ADH

2

, ADH

3

, and CYP

450

2E1 Pst-I and Dra-I genetic variations are not related to alcoholism or

susceptibility to alcoholic liver disease in our male population. ALDH

2

locus is monomorphic.

q

Keywords

: Alcohol; Alcohol dehydrogenase; Aldehyde dehydrogenase; Cytochrome P

450

2E1; Alcoholic liver disease;

Cirrhosis

1. Introduction

Alcoholism and alcohol-induced liver damage are

clinically heterogenous diseases which result from a likely

multiplicity of interactive genetic and environmental

influences, rather than a major single gene effect

[1–5]

. In

order to study this genetic approach, several genes must be

analyzed in a susceptible population. Several ‘candidate’

genes have been proposed and studied in recent years

[6–12]

and, among them, genes encoding ethanol and

acet-aldehyde-metabolizing enzymes such as alcohol

dehydro-genase (ADH), cytochrome P

450

2E1 (CYP

450

2E1), and

aldehyde dehydrogenase (ALDH) have been extensively

studied, often with controversial or non-conclusive results,

especially in whites

[6,7,10,13,15]

.

ALDH

2

is the most important alcohol-metabolizing gene

that affects predisposition to alcoholism and alcoholic liver

disease in Asians populations. The ALDH

2

*2 allele, which

encodes for an inactive ALDH form, appears to protect

against alcoholism

[4,7,10]

. Furthermore, alcoholics with

this inactive allele may be at a greater risk of advanced

www.elsevier.com/locate/jhep

doi:10.1016/j.jhep.2003.06.003

Received 1 October 2002; received in revised form 1 May 2003; accepted 1 June 2003; available online 11 September 2004

* Corresponding author. Tel.:C34 977 29 58 33; fax:C34 977 29 58 05.

(2)

alcoholic liver disease

[15–21]

. However, the ALDH

2

*2

allele has not been found in Caucasians

[10–22]

.

ADH presents genetic variability at the ADH

2

and ADH

3

loci. Two alleles in both loci (*1 and *2) have been

described

[23]

. It has been reported that the prevalence of

the more active alleles ADH

2

*2

[13,14,16–21,24,25]

and

ADH

3

*1

[13–15,19]

is low in alcoholic Asians. Likewise,

alcoholics with the highly active ADH

2

*2 or ADH

3

*1 may

be at increased risk of organ damage

[26]

, as has been

shown in Asians

[15,18,25,27]

. A similar relationship has

been reported for Jewish and Australian men

[28,29]

.

Studies regarding ADH

3

*1 in whites are more controversial,

showing no correlation

[30–36]

, protection against

alcohol-ism

[37]

, or non-conclusive results

[22,29,38]

.

CYP

450

2E1 is responsible for 10% of total ethanol

metabolism, but it can be induced by chronic alcohol

administration

[39]

. The CYP

450

2E1 gene also exhibits

polymorphism. Two point mutations in the 5

0

flanking

region of the gene (Pst-I, Rsa-I) are in close linkage

disequilibrium and alter the transcriptional activity of the

gene

[40]

. So far, studies have failed to demonstrate that this

polymorphism is related to an increased risk of alcohol

dependence

[41]

. An association with alcoholic liver disease

has been documented in the Japanese

[18]

, but only one

report has been able to find a similar association in

Caucasians

[42]

. Less information is available regarding

other mutations that affect this gene (Dra-I, Msp-I)

[41,43]

.

In the present work, we have studied the frequency of

ADH

2

, ADH

3

, ALDH

2

, and CYP

450

2E1 Dra-I and Pst-I

polymorphisms and their relation to alcoholism and

alcoholic liver disease (ALD) in 519 subjects living in

Tarragona (Catalonia, Spain), a region with a long tradition

of producing and consuming alcoholic beverages, specially

wine.

2. Material and methods

2.1. Subjects

We studied 519 Spanish white men between 20 and 84 years of age at the Hospital Universitari de Tarragona Joan XXIII (Spain). Immigrants from other countries and their descendents were excluded. Subjects were classified into two groups according to their alcohol intake: alcoholics and non-alcoholics. Each group was divided further into the following subgroups: controls, non-cirrhotic liver disease, and cirrhosis of the liver.

People who drank a total amount of alcohol in the beverages ingested greater than 100 g/day for more than 10 years were considered alcoholics. The drinking history was obtained by a face-to-face interview based on a standardized questionnaire. In doubtful cases, relatives were also interviewed. Ninety-six percent of alcoholics met the DSM-IV diagnostic criteria for alcoholism[44].

Alcoholic subjects included patients with alcohol-induced cirrhosis, non-cirrhotic alcoholic liver disease (hepatitis and/or steatosis) and heavy drinkers without liver disease. The different types of ALD were diagnosed by examination of a liver biopsy. Alcoholics with no liver disease were diagnosed by means of percutaneous needle biopsy of the liver, usually done because of the presence of an enlarged liver and/or abnormalities in the liver enzyme levels, or during elective abdominal surgery. Histologic examination of these samples indicated a normal liver.

Non-alcoholic subjects were people who drank less than 10 g/day of alcohol. They included healthy controls and patients with non-alcoholic chronic liver disease (in most cases chronic hepatitis or cirrhosis due to HCV infection, diagnosed by liver biopsy examination). Healthy controls were people with no history of alcoholism or chronic disease, no evidence of liver disease at physical examination, and normal liver function tests. Information about toxic and medical history was collected through a short standardized questionnaire.

The study protocol was approved by the Ethical Committee of our hospital. Informed consent was obtained from each subject.

2.2. Blood samples

A 10 ml sample of blood was drawn in an EDTA vacutainer by venipuncture. Within 1 h of drawing, buffy coat was separated from the blood by centrifugation at 800 g for 10 min. Genomic DNA was isolated from the buffy coat using QiaAMP spin columns (Qiagen, Chatsworth, CA).

2.3. Analytical methods: genotype determination

Restriction fragment length polymorphisms (RFLP) in the ADH2,

ADH3, CYP4502E1, and ALDH2genes were detected by digesting

PCR-amplified DNA[19,40,41]. For each PCR analysis, 100 ng of DNA was used. PCR analyses were performed with a Perkin Elmer 9700 Thermal Cycler. RFLP were detected by ethidium bromide staining after agarose gel electrophoresis.

2.3.1. ADH

2

and ADH

3

genotypes

The amplification reactions were carried out in a final volume of 15ml containing 1.5 mM of MgCl2, 0.2 mM of each nucleotide (Boehringer

Mannheim, Germany), 0.2mM of each primer and 2 units ofThermus aquaticus(Taq) DNA polymerase (Gibco BRL). DNA was amplified for 35 cycles. Each cycle consisted of 1 min denaturation at 948C, 45 s annealing at 558C and 5 min extension at 728C. The primers used were:

50ATTCTTTTCTGAATCTGAACA30and 50

GAAGGGGGGTCACCAG-GTTG30for ADH2genotypes, and 50

GCTTTAAGAGTAAATAATCTG-TCCCC30and 50AATCTACCTCTTTCCAGAGC30 for ADH3genotypes

(Gibco BRL). For allele detection, aliquots of the amplified DNA products were digested withMaeIIIat 558C for ADH2, or withSspIat 378C (Roche

Molecular Biochemicals) for ADH3. Digestion products were run on 2.5%

high resolution agarose gels and stained with ethidium bromide. The genotypes identified were named according to the presence or absence of the enzyme restriction sites. So MaeIII G/GZ*1/*1, G/AZ*1/*2 and

A/AZ2*/*2 are homozygotes for the absence of site (95 bp), heterozygotes (60/35/95 bp), and homozygotes for the presence of site (60/35 bp).SpsI

G/GZ*1/*1, G/AZ*1/*2 and A/AZ*2/*2 are homozygotes for the absence of site (130 pb), heterozygotes (67/63/130 bp), and homozygotes for the presence of site (67/63 bp).

2.3.2. CYP

450

2E1 genotypes

The amplification reactions were conducted in a final volume of 50ml containing 1.5 mM of MgCl2, 0.2 mM of each nucleotide (Boehringer

Mannheim, Germany), 0.2mM of each primer and 2 units of Taq DNA polymerase (Gibco BRL). DNA was amplified for 35 cycles. Each cycle consisted of 30 s denaturation at 958C, 30 s annealing at 548C for the Pst-I polymorphism and at 638C for the Dra-I polymorphism, and 45 s extension at 728C. The primers used were 50 TTCATTCTGTCT-TCTAACTGG30 and 50CCAGTCGAGTCTACATTGTCA30 for Pst-I,

and 50AGTCGACATGTGATGGATCCA30 and 50

GACAGGGTTT-CATCATGTTGG30for Dra-I (Gibco BRL). For allele detection, aliquots of the amplified DNA products were digested withPstIandDraI, both at 378C for each polymorphism (Roche Molecular Biochemicals). Digestion products were run on 4% agarose gels and stained with ethidium bromide. The genotypes identified were named according to the presence or absence of the enzyme restriction sites. So, Pst-I *1/*1, *1/*2 and 2*/*2 were homozygotes for the absence of site (410 bp), heterozygotes (290/120/410 bp), and homozygotes for the presence of site (290/120 bp). Dra-I *1/*1, *1/*2 and *2/*2 were homozygotes for the absence of site (375 bp), heterozygotes (249/126/375 bp), and homo-zygotes for the presence of site (249/126 bp).

(3)

2.3.3. ALDH

2

genotypes

An amplification created restriction site was performed by introducing a single base mismatch into the 30-end of an antisense primer, which is immediately adjacent to the mutation site (G/C-A/T) in exon 12 and can create an MboII recognition site in the wild type nucleotide sequences after amplification.

In accordance with the principle mentioned above the primers used in

the PCR were 50CAAATTACAGGGTCAAGGGCT30 and

50CCACACTCACAGTTTTCTCTT30. Amplification was performed in a final volume of 50ml containing 0.2 mM of each nucleotide (Boehringer Mannheim), 1 mM MgCl2, 1mM of each oligonucleotide and 1 U of Taq

polymerase (Gibco BRL). The reaction was carried out using 30 thermal cycles in the following conditions: an initial denaturation of 5 min at 948C and a final extension of 10 min at 728C. The cycle program consisted of a 1 min denaturation at 948C, 3 min annealing at 538C and a 1 min extension at 728C. PCR products were digested with MboII restriction enzyme at 378C overnight and electrophoresed on a 4% agarose gel. A 135 bp band corresponded to the mutant allele (AZ*2) and a set of 125 and 10 bp bands corresponded to the wild-type allele (GZ*1).

2.4. Statistical analysis

The descriptive analysis of the different variables analyzed has been performed by means of absolute and relative frequencies for categoric variables, and mean and standard deviation (SD) for continuous variables. The variation in the allele frequencies of different groups was analyzed by means of the population genetics software GENEPOP[45]. Differences between groups were analyzed through the Pearsonc2_{test or Fisher’s exact}

test for categoric variables. For continuous variables, one-factor analysis of variance (ANOVA) was used.c2goodness of fit tests were used to study agreement with Hardy-Weinberg expectations. Linkage disequilibrium between ADH2 and ADH3 was estimated by means of the composite

digenic disequilibrium coefficientDAB[46,47].

3. Results

3.1. General

The main characteristics of the subjects studied are

shown in

Table 1

. All alcoholic subjects (n

Z

264) were

white Spaniards. Ninety-nine (37.5%) alcoholic subjects

had cirrhosis, 118 (44.7%) had non-cirrhotic liver disease,

and 47 (17.8%) showed no evidence of ALD.

All non-alcoholic subjects (n

Z

255) were also white

Spaniards. Sixty-four (25.1%) were healthy controls; the

non-alcoholic non-cirrhotic liver disease was made up of 110

subjects (43.3%); and 81 (31.8%) had viral cirrhosis. The

allelic frequencies for each gene analyzed in this series is

shown in

Table 2

. The genotype distribution of all groups fits

the expected Hardy-Weinberg equilibrium (

Tables 3–6

).

3.2. ADH

2

gene polymorphisms

The allelic distribution of the ADH

2

*1 and ADH

2

*2

genotypes in the whole population analyzed was 93.1 and

6.9%, respectively (

Table 2

). We compared the allelic

frequencies observed in the different groups defined

(alcoholics vs. non-alcoholics, controls vs. liver disease

patients), and, in no cases were the differences found to be

significant (

Table 3

).

3.3. ADH

3

gene polymorphisms

The allele distribution in the whole series was 55.7% for

ADH

3

*1 and 44.3% for ADH

3

*2.

Table 4

shows the ADH

3

allele distribution according to alcoholism and/or liver

disease. Differences were not significant when the control

group was compared with the different groups of patients

with alcoholism and/or liver disease.

Likewise, when individuals were put in groups of

alcoholics and non-alcoholics, as had previously been

done for ADH

2

, no differences were found regarding the

ADH

3

allele frequencies (

Table 4

).

3.4. Linkage disequilibrium between ADH

2

and ADH

3

loci

An association in the direction ADH

2

*2–ADH

3

*1 was

observed, but no significant linkage disequilibrium could be

demonstrated. The digenic disequilibrium coefficients were

D

AB

Z

K

0.0143,

P

Z

0.21, for the non-alcoholic group and

D

AB

Z

K

0.0064,

P

Z

0.45, for the alcoholics.

Table 1

Main characteristics of the groups defined

Alcoholics (nZ264) Non-alcoholics (nZ255)

No liver diseasen

(%)

Non-cirrhotic liver diseasen(%)

Cirrhosisn(%) No liver diseasen

(%)

Non-cirrhotic liver dis-easen(%)

Cirrhosisn(%)

Population 47 (17.8) 118 (44.7) 99 (37.5) 64 (25.1) 110 (43.1) 81 (31.8)

Alcohol consumption (meanGSD)

g/day 130G32 132G47 167G59 9G4.1 N* N*

years 11G6.3 13.4G7.6 16G8.5 – – –

Mean age 56.8G13.5 49.5G11.5 56.5G11.3 46.2G14.6 43.8G15.6 62.2G12.9

*_{N, negligible.}

Table 2

Genotype number and allele frequencies (%) of ADH2, ADH3,

CYP4502E1 Dra-I and Pst-I, and ALDH2in the series analyzed

Gene n Genotype Allele

*1/*1 *1/*2 *2/*2 *1 *2 ADH2 519 448 70 1 93.1 6.9 ADH3 519 170 238 111 55.7 44.3 CYP4502E1 Dra-I 519 4 108 407 11.2 88.8 CYP4502E1 Pst-I 519 482 33 3 96.2 3.8 ALDH2 100 100 0 0 100 0

(4)

3.5. CYP

450

2E1 gene polymorphisms in the Dra-I locus

The overall allele frequencies for the rare d1 and

common d2 alleles in the Dra-I locus were 11.2 and

88.8%, respectively.

The rare d1 allele was slightly more common among

subjects with alcohol-related cirrhosis than among heavy

drinkers without alcohol-related liver disease, but the

differences were not significant. The mutation was less

frequent in the non-alcoholic cirrhosis group (8%), but it

was not statistically significative (

Table 5

). The distribution

of the CYP

450

2E1 genotypes for the Dra-I rare d1 allele was

also similar in alcoholics and non-alcoholics (

Table 5

).

3.6. CYP

450

2E1 gene polymorphisms in the Pst-I locus

The global allelic frequencies for the common c1 and rare

c2 alleles in the Pst-I locus were 96.2 and 3.8%, respectively

(

Table 2

). The results of allelic and genotypic distributions

observed in the groups defined are shown in

Table 6

.

The rare c2 allele was slightly more common among

heavy drinkers without ALD than among subjects with

alcohol-related cirrhosis and healthy controls, but the

differences were not significant. The frequency of the rare

c2 allele was comparable for alcoholics and non-alcoholics,

as is reflected in

Table 6

.

3.7. Analysis of ADH-CYP

450

2E1 polymorphism

associations

No evidence of gene–gene interaction was observed in

relation to alcohol consumption or the development of

ALD, when the polymorphic ADH and CYP

450

2E1 systems

were analyzed together.

3.8. ALDH

2

gene polymorphisms

We evaluated these polymorphisms in 100 individuals, 50

alcoholics and 50 non-alcoholics, either with and without liver

disease. All subjects expressed the 1/1 genotype (

Table 2

).

Table 3

Genotype number and allele frequencies (%) of ADH2according to

drinking habits and presence and type of liver disease

Group N Genotype Allele

*1/*1 *1/*2 *2/*2 *1 *2 Alcoholics 264 226 37 1 92.6 7.4 No liver disease 47 42 5 0 94.7 5.3 Non-cirrhotic liver disease 118 99 19 0 92 8 Cirrhosis 99 85 13 1 92.4 7.6 Non-alcoholics 255 222 33 0 93.5 6.5 No liver disease 64 54 10 0 92.2 7.8 Non-cirrhotic liver disease 110 95 15 0 93.2 6.8 Cirrhosis 81 73 8 0 95.1 4.9

Differences in allele frequencies between the groups defined were not significant.

Table 4

Genotype number and allele frequencies (%) of ADH3according to

drinking habits and presence and type of liver disease

Group n Genotype Allele

*1/*1 *1/*2 *2/*2 *1 *2 Alcoholics 264 90 116 58 56.1 43.9 No liver disease 47 14 20 13 51.1 48.9 Non-cirrhotic liver disease 118 41 51 26 56.4 43.6 Cirrhosis 99 35 45 19 58 42 Non-alcoholics 255 80 122 53 55.3 44.7 No liver disease 64 15 42 7 56.2 43.8 Non-cirrhotic liver disease 110 34 52 24 54.5 45.5 Cirrhosis 81 31 28 22 55.6 44.4

Table 5

Genotype number and allele frequencies (%) of CYP4502E1 Dra-I

according to drinking habits and presence and type of liver disease

*1/*1 *1/*2 *2/*2 d1 d2 Alcoholics 264 1 58 205 11.4 88.6 No liver disease 47 0 11 36 11.7 88.3 Non-cirrhotic liver disease 118 0 24 94 10.2 89.8 Cirrhosis 99 1 23 75 12.6 87.4 Non-alcoholics 255 3 50 202 11 89 No liver disease 64 1 18 45 15.6 84.4 Non-cirrhotic liver disease 110 1 21 88 10.5 89.5 Cirrhosis 81 1 11 69 8 92

Table 6

Genotype number and allele frequencies (%) of CYP4502E1 Pst-I

according to drinking habits and presence and type of liver disease

*1/*1 *1/*2 *2/*2 c1 c2 Alcoholics 264 246 16 2 96.6 3.4 No liver disease 47 42 4 1 93.6 6.4 Non cirrhotic liver disease 118 110 7 1 96.2 3.8 Cirrhosis 99 94 5 0 97.5 2.5 Non-alcoholics 255 236 18 1 96.1 3.9 No liver disease 64 57 7 0 94.5 5.5 Non cirrhotic liver disease 110 103 6 1 96.4 3.6 Cirrhosis 81 76 5 0 96.9 3.1

(5)

4. Discussion

The results of the present work indicate, for a large and

homogeneous Spanish male sample, that ADH

2

, ADH

3

and

CYP

450

2E1 Dra-I and Pst-I genotypes are not related to the

individual risk of alcoholism or the development of

advanced alcoholic liver disease. We have not detected

polymorphism at the ALDH

2

locus.

The highly active ADH

2

*2 allele is very frequent in

Asians (60–80%) but not in whites (0–10%)

[10]

. Our

results showed an ADH

2

*2 allele frequency of 7.8% for our

healthy Spanish controls, higher than the one reported in

French

[33]

, Americans

[48]

, Germans, Swedes and Finns

[10,49]

, but lower than in Turks

[10]

and Swiss

[50]

. It is

similar to frequencies described in other Spanish samples

[51,52]

. It is difficult to find an explanation for the higher

ADH

2

*2 frequency in our population, but perhaps reflects

migration patterns and the occupation of Spain historically

by eastern populations.

It has been reported in Asians that the risk of alcohol

dependence and alcoholic liver disease associated with

ADH

2

*1 is greater than the risk associated with ADH

2

*2

[13,14,16,17,19–21,24,25]

. Our results suggest that there is

no relationship between the atypical ADH

2

and alcohol

abuse in Spaniards, because the frequencies of ADH

2

*2

obtained in alcoholics and non-alcoholics are very similar

(7.4% vs. 6.5%, respectively). These results are in

agreement with most previous studies in whites

[48,52]

.

Only two reports in Jewish from Israel

[28]

and in

Australian whites

[29]

have found a relationship similar to

that found in Asians.

The two ADH

2

alleles encode for dimeric isoenzymes

with different metabolic ratios of ethanol to acetaldehyde.

The ADH

2

*2 encodes a very active enzyme and may be

expected to generate more acetaldehyde because of the

higher activity. So, it could be expected that alcoholics

with the more active

b

2

b

2

isoenzyme were at greater risk of

ethanol intake causing tissular damage due to an increased

accumulation of acetaldehyde. However, our results do not

confirm this hypothesis for the development of alcoholic

cirrhosis, because the allelic frequencies observed are

similar for alcoholics, either with or without liver disease.

These results agree with other results in Caucasians and

Asians

[30,31]

. Only one research group has reported that

alcoholics expressing the allele *2 are at greater risk

[18,

25,27]

. Moreover, the high frequency of the ALDH

2

*2

allele in Asians overshadows the effects of ADH

variability. This strong influence could be provided in

Europeans, since the ALDH

2

*2 is virtually absent in

Caucasians, as demonstrated in the present work.

Regarding ADH

3

, important differences are also

observed in allelic distribution between Asian and white

populations: ADH

3

*1 is more prevalent in Asians (

O

90%)

than in whites (50–60%)

[12,48]

. Our genotype

distri-bution is consistent with previous reports in whites

[21,23,

34,37,46]

.

Several reports in Asians have suggested that alcoholics

with the more active ADH

3

*1 may be at greater risk for

developing alcoholic liver disease

[15,18]

. This correlation

has not been proved in whites

[22,29–38]

. The allelic

frequencies are very similar for all the groups studied, and

among alcoholics and non-alcoholics. So, in our population,

ADH

3

variation does not play a causative role in the

predisposition to alcoholism or ALD.

The fact that class I ADH genes all lie within 80 kb on

chromosome 4 led to the hypothesis that variants were not

inherited independently. ADH

2

and ADH

3

genes are

contiguous in the region 4q21-23

[53]

, and evidence of

allele linkage has been found in Asians

[13,21,54]

.

Recently, this linkage has also been reported in Europeans

[37]

. Our results show that the ADH

2

*2 and ADH

3

*1 alleles

are associated, but they do not demonstrate a significant

disequilibrium linkage in our population. However, the low

ADH

2

*2 frequency in Caucasians means that the effect of

the allele linkage on the ADH

3

distribution must be smaller

than in Asians. In oriental populations, the excess of

ADH

3

*1 observed in non-alcoholics could be influenced by

the association with ADH

2

*2

[13,15–17]

.

Polymorphism of CYP

450

2E1 has been shown to

influence the risk for ALD in some reports

[43,55]

, but

others have failed to find such an association

[56]

.

Additionally, to date, no evidence of influence on

alcoholism and alcohol dependence has been reported

[41]

. In the population analyzed, the allelic distribution

for the CYP

450

2E1 Dra-I polymorphism among alcoholic

and non-alcoholic subjects did not show differences. The

frequencies of the rare Dra-I d1 allele were comparable in

non-alcoholic population and alcoholics, and similar to

those reported for Caucasians by other authors

[31,41,43]

.

Nevertheless, we were unable to confirm the lower

frequency of the d1 allele in alcoholics with liver cirrhosis

commented on in some reports

[43]

.

Regarding the CYP

450

2E1 Pst-I polymorphism, we

found no association between the c2 mutation in the 5

0

-flanking region of the gene and a higher risk of

alcoholism, since the mutant allele was detected in a

comparable percent of alcoholic and non-alcoholic

population. A relationship with alcoholic cirrhosis has

been suggested in Asians, but results are controversial

[16,57]

. Although rare in Caucasians, this allele has been

found to increase the risk of advanced alcoholic liver

disease, particularly in patients with the less active

isoenzymes of ADH

3

[42]

. Our results do not confirm

this but demonstrated that the c2 allele is less frequent in

alcoholics with liver cirrhosis than in alcoholics without

cirrhosis or advanced liver disease. The combination study

between the CYP

450

2E1/ADH

3

genotypes and risk of

alcohol-related liver disease was also negative. CYP

450

2E1

variants were not seen to be associated with alcoholism or

risk of alcoholic liver disease, perhaps because of their

low prevalence, which may explain why different reports

have come up with different results.

(6)

We can conclude that polymorphisms of ADH

2

, ADH

3

,

and CYP

450

2E1 are not related to the risk for developing

alcoholism and/or alcoholic liver disease, at least in a large

Caucasian population such as the one presented here, and

that the allele ALDH

2

*2 is not expressed in the population

analyzed.

Acknowledgements

This study has been partially financed by a grant from the

Fondo de Investigaciones Sanitarias (FIS 97/0245 and

00/0988) and a grant from the Fundacio´n Biociencia.

References

[1] Couzigou P, Begleiter H, Kiianmaa K. Alcohol and genetics. In: MacDonald I, editor. Health Issues Related to Alcohol Consumption. Brussels: ILSI Europe; 1998. p. 63–101.

[2] Schuckit MA. Biological, psychological and environmental predictors of the alcoholism risk: a longitudinal study. J Stud Alcohol 1998;59: 485–494.

[3] Rode´s J, Salaspuro M, Sorensen TIA. Alcohol and liver disease. In: MacDonald I, editor. Health Issues Related to Alcohol Consumption. Brussels: ILSI Europe; 1998. p. 396–450.

[4] Day CP, Bassendine MF. Genetic predisposition to alcoholic liver disease. Gut 1992;33:1444–1447.

[5] Savolainen VT, Perola M, Lalu K, Penttila¨ A, Virtanen I, Karhunen PJ. Early centrolobular fibrogenesis-precirrhotic lesions among moderate alcohol consumers and chronic alcoholics. J Hepatol 1995;23:524–531.

[6] Lumeng L, Crabb DW. Genetic aspects and risk factors in alcoholism and alcoholic liver disease. Gastroenterology 1994;107: 572–578.

[7] Yoshida A, Hsu L-C, Yasunami M. Genetics of human alcohol-metabolizing enzymes. Prog Nucl Acid Res Mol Biol 1991;40: 255–287.

[8] Noble EP, Blum K, Ritchie T, Montgomery A, Sheridan PJ. Allelic association of the D2 dopamine receptor gene with receptor-binding characteristics in alcoholism. Arch Gen Psychiatry 1991;48:648–654. [9] Hallikainen T, Saito T, Lachman H, Volakva J, Pohjalainen T, Ryyna¨nen OP, et al. Association between low activity serotonin transporter promoter genotype and early onset of alcoholism with habitual impulsive violent behaviour. Mol Psychiatry 1999;4: 385–388.

[10] Goedde HW, Agarwal DP, Fritze G, Meier-Tackmann D, Singh S, Beckmann G, et al. Distribution of ADH2 and ALDH2 genotypes in different populations. Hum Genet 1992;88:344–346.

[11] Shibuya A, Yoshida A. Genotypes of alcohol metabolizing enzymes in Japanese with alcohol liver diseases: a strong association of the usual Caucasian-type aldehyde dehydrogenase gene (ALDH21) with the disease. Am J Hum Genet 1988;43:744–748.

[12] Agarwal DP, Goedde HW, editors. Alcohol metabolism, alcohol intolerance, and alcoholism. Biochemical and pharmacological approaches. Berlin: Springer; 1990.

[13] Thomasson HR, Edenberg HJ, Crabb DW, Mai XL, Jerome RE, Li TK, et al. Alcohol and aldehyde dehydrogenase genotypes and alcoholism in Chinese men. Am J Hum Genet 1991;48:677–681.

[14] Thomasson HR, Crabb DW, Edenberg HJ, Li TK. Alcohol and aldehyde dehydrogenase polymorphisms and alcoholism. Behav Gen 1993;23:131–136.

[15] Chao YC, Liou SR, Chung YY, Tang HS, Hsu CT, Li TK, et al. Poly-morphism of alcohol and aldehyde dehydrogenase genes and alcoholic cirrhosis in Chinese patients. Hepatology 1994;19:360–366. [16] Maezawa Y, Yamauchi M, Toda G, Suzuki H, Sakurai S.

Alcohol-metabolizing enzyme polymorphisms and alcoholism in Japan. Alcohol Clin Exp Res 1995;19:951–954.

[17] Muramatsu T, Zu-Cheng W, Yi-Ru F, Kou-Bao H, Heqin Y, Yamada K, et al. Alcohol and aldehyde dehydrogenase genotypes and drinking behavior of Chinese living in Shangai. Hum Genet 1995; 96:151–154.

[18] Yamauchi M, Maezawa Y, Mizuhara Ohata M, Hirakawa J, Nakajima H, Toda G. Polymorphisms in alcohol metabolizing enzyme genes and alcoholic cirrhosis in Japanese patients: a multivariate analysis. Hepatology 1995;22:1136–1142.

[19] Nakamura K, Iwahashi K, Matsuo Y, Miyatake R, Ichikawa Y, Suwaki H. Characteristics of Japanese alcoholics with the aty-pical aldehyde dehyodrogenase 2*2. I. A comparison of the genotypes of ALDH2, ADH2, ADH3, and cytochrome P-4502E1 between alcoholics and non-alcoholics. Alcohol Clin Exp Res 1996;20:52–55. [20] Tanaka F, Shiratori Y, Yokosuka O, Imazeki F, Tsukada Y, Omata M. High incidence of ADH2*1/ALDH2*1 genes among Japanese alcohol dependents and patients with alcoholic liver disease. Hepatology 1996;23:234–239.

[21] Chen CC, Lu RB, Chen YC, Wang MF, Chang YC, Li TK, et al. Interaction between the functional polymorphisms of the alcohol metabolism genes in protection against alcoholism. Am J Hum Genet 1999;65:795–807.

[22] Day CP, Bashir R, James OFW, Bassendine MJ, Crabb DW, Thomasson HR, et al. Investigation of the role of polymorphisms at the alcohol and aldehyde dehydrogenase loci in genetic predisposition to alcohol-related end-organ damage. Hepatology 1991;14:798–801.

[23] Bosron WF, Li T-K. Catalytic properties of human liver alcohol dehydrogenase isoenzymes. Enzyme 1987;37:19–28.

[24] Thomasson HR, Crabb DW, Edenberg HJ, Li TK, Hwu HJ, Chen CC, et al. Low frequency of the ADH2*2 allele among Atayal natives of Taiwan with alcohol use disorders. Alcohol Clin Exp Res 1994;18: 640–643.

[25] Yamauchi M, Maezawa Y, Toda G, Suzuki H, Sakurai S. Association of a restriction fragment length polymorphism in the alcohol dehydrogenase 2 gene with Japanese alcoholic liver cirrhosis. J Hepatol 1995;23:519–523.

[26] Couzigou P, Coutelle C, Fleury B, Iron A. Alcohol and aldehyde dehydrogenase genotypes, alcoholism and alcohol related disease. Alcohol Alcohol 1994;2:21–27.

[27] Yamauchi M. Association of polymorphism in the alcohol dehydro-genase 2 gene with alcohol-related organ injuries, especially liver cirrhosis. Addict Biol 1998;3:151–157.

[28] Neumark YD, Friedlander Y, Thomasson HR, Li TK. Association of the ADH2*2 allele with reduced ethanol consumption in Jewish men in Israel: a pilot study. J Stud Alcohol 1998;59:133–139.

[29] Whitfield JB, Nightingale BN, Bucholz KK, Madden PAF, Heath AC, Martin NG. ADH genotypes and alcohol use and dependence in Europeans. Alcohol Clin Exp Res 1998;22:1463–1469.

[30] Couzigou P, Fleury B, Groppi A, Cassaigne A, Begueret J. Genotyping study of alcohol dehydrogenase class I polymorphism in French patients with alcoholic cirrhosis. Alcohol Alcohol 1990;25: 623–626.

[31] Ceni E, Galli A, Casini A. Genetics, alcohol and cirrhosis. Ann Intern Med 1997;126:1000 letter.

[32] Ricciardi BR, Saunders JB, Williams R, Hopkinson DA. Hepatic ADH and ALDH isoenzymes in different racial groups and in chronic alcoholism. Pharmacol Biochem Behav 1983;18:61–65.

[33] Poupon RE, Nalpas B, Coutelle C, Fleury B, Couzogou P, Higueret D. Polymorphism of alcohol dehydrogenase, alcohol and aldehyde dehydrogenase activities: implication in alcoholic cirrhosis in white patients. Hepatology 1992;15:1017–1022.

(7)

[34] Gilder FJ, Hodgkinson S, Murray RM. ADH and ALDH genotype profiles in Caucasians with alcohol-related problems and controls. Addiction 1993;88:383–388.

[35] Pare´s X, Farre´s J, Pare´s A, Soler X, Pane´s J, Ferre´ LJ, et al. Genetic polymorphism of liver alcohol dehydrogenase in Spanish subjects: significance of alcohol consumption and liver disease. Alcohol Alcohol 1994;29:701–705.

[36] Espino´s C, Sa´nchez F, Ramı´rez C, Juan F, Na´jera C. Polymorphism of alcohol dehydrogenase genes in alcoholic and non-alcoholic individ-uals from Valencia (Spain). Hereditas 1997;126:247–253.

[37] Borra`s E, Coutelle C, Rosell A, Ferna´ndez-Muixı´ F, Broch M, Crosas B, et al. Genetic polymorphism of alcohol dehydrogenase in Europeans: the ADH2*2 allele decreases the risk of alcoholism and is associated with ADH3*1. Hepatology 2000;31:984–989.

[38] Poupon RE, Ward P, Balkau B. Alcohol dehydrogenase polymorph-isms and predisposition to alcoholic cirrhosis. Hepatology 1993;18: 231–232.

[39] Takahashi T, Lasker JM, Rosman AS, Lieber CS. Induction of cytochrome P-4502E1 in the human liver by ethanol is caused by a corresponding increase in encoding messenger RNA. Hepatology 1993;17:236–245.

[40] Hayashi S, Watanabe J, Kawajiri K. Genetic polymorphisms in the 50 -flanking region change transcriptional regulation of the human cytochrome P450IIE1 gene. J Biochem 1991;110:559–565. [41] Pastorelli R, Bardazzi G, Saieva C, Cerri A, Gestri D, Allamani A,

et al. Genetic determinants of alcohol addiction and metabolism: a survey in Italy. Alcohol Clin Exp Res 2001;25:221–227.

[42] Grove J, Brown ASJM, Daly AK, Bassendine MF, James OF, Day CP. The RsaI polymorphism of CYP2E1 and susceptibility to alcoholic liver disease in Caucasians: effect on age of presentation and dependence on alcohol dehydrogenase genotype. Pharmacogenetics 1998;8:335–342.

[43] Ingelman-Sundberg M, Johansson I, Yin H, Terelius Y, Eliasson E, Clot P, et al. Ethanol-inducible cytochrome P4502E2: genetic polymorphism, regulation and possible role in the etiology of alcohol-induced liver disease. Alcohol 1993;10:447–452.

[44] Grant BF, Hardford TC, Hasin DS, Chou P, Pickering R. DSM-III-R and the proposed DSM-IV alcohol use disorders, United States 1988: A nosological comparison. Alcohol Clin Exp Res 1992;16: 215–221.

[45] Raymond M, Rousset F. GENEPOP (version 1.2): population genetics software for exact tests and ecumenicism. J Heredity 1995;86: 248–249.

[46] Weir BS, Cockerham CC. Complete characterization of disequili-brium at two loci. In: Feldman ME, editor. Mathematical Evolutionary Theory. Princeton: Princeton Univ. Press; 1989. p. 86–110.

[47] Weir BS. Genetic data analysis. Sunderland, MA: Sinauer; 1990. [48] Bosron WF, Li T-K. Genetic polymorphism of human liver alcohol

and aldehyde dehydrogenase, and their relationship to alcohol metabolism and alcoholism. Hepatology 1986;6:502–510.

[49] Nuutinen HU. Activities of ethanol-metabolizing enzymes in liver diseases. Scand J Gastroenterol 1986;21:678–684.

[50] von Wartburg JP, Papenberg J, Aebi H. An atypical human alcohol dehydrogenase. Can J Biochem 1965;43:889–898.

[51] Pane´s J, Soler X, Pare´s A, Caballerı´a J, Farre´s J, Rode´s J, et al. Influence of liver disease on hepatic alcohol and aldehyde dehydrogenases. Gastroenterology 1989;97:708–714.

[52] Vidal F, Pe´rez J, Panisello J, Toda R, Gutie´rrez C, Richart C. Atypical liver alcohol dehydrogenase in the Spanish population: its relation with the development of alcoholic liver disease. Alcohol Clin Exp Res 1993;17:782–785.

[53] Yasunami M, Kikuchi I, Sarapata D, Yoshida A. The human class I alcohol dehydrogenase gene cluster: three genes are tandemly organized in an 80-kb-long segment of the genome. Genomics 1990; 7:152–158.

[54] Osier M, Patstis AJ, Kidd JR, Lee JF, Yin SJ, Ko HC, et al. Linkage disequilibrium at the ADH2 and ADH3 loci and risk of alcoholism. Am J Hum Genet 1999;64:1147–1157.

[55] Pirmohamed M, Kitteringham NR, Quets LJ, Allot LR, Green VJ, Gilmore IT, et al. Genetic polymorphism of cytochrome P4502E1 and risk of alcoholic liver disease in Caucasians. Pharmacogenetics 1995; 5:351–357.

[56] Savolainen VT, Pajarinen J, Perola M, Penttila¨ A, Karhunen PJ. Polymorphism in the cytochrome P450 2E1 gene and the risk of alcoholic liver disease. J Hepatol 1997;26:55–61.

[57] Tsutsumi M, Takada A, Wang JS. Genetic polymorphisms of cytochrome P4502E1 related to the development of alcoholic liver disease. Gastroenterology 1994;107:1430–1435.

www.elsevier.com/locate/jhep